Potato StKFB29 gene mutant based on CRISPR / Cas9 system as well as method and application of potato StKFB29 gene mutant
Potato StKFB29 gene was knocked out in a site-directed manner through the CRISPR/Cas9 system, which solved the problem of low anthocyanins content in the existing technology, achieved a significant increase in the anthocyanins content and enriched breeding resources, and provided a new strategy for colored potato breeding.
Patent Information
- Application Number
- CN202510474145.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art is difficult to efficiently edit the potato StKFB29 gene to increase the anthocyanin content, and there is a lack of effective breeding resources.
GRNA was designed using the CRISPR/Cas9 system, and the StKFB29 gene sequence of potatoes was knocked out through the CRISPR/Cas9 system, and the CRISPR/Cas9 gene editing vector was constructed, and the mutant plants were transformed to achieve efficient site-based knockout of the StKFB29 gene.
It significantly increases the content of potato anthocyanins, enhances its antioxidant, anti-aging, cancer prevention, and lipid-lowering health functions, and provides germplasm resources for colored potato breeding.
Smart Images

Figure CN120290591A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly relates to a mutant of potato StKFB29 gene based on the CRISPR / Cas9 system, a method and an application thereof. Background Art
[0002] Potato is the fourth largest food crop in the world after rice, wheat and corn, and is an important source of food and industrial processing raw materials. In recent years, with people's preference for colored foods, the research focus of potatoes has begun to shift to red, purple, blue and other colored potatoes. Colored potatoes are rich in anthocyanins and have rich nutritional value. The enrichment of anthocyanins endows colored potatoes with health care functions such as antioxidant, anti-aging, cancer prevention, lipid-lowering and physical fitness enhancement. KFB structural proteins are widely involved in many biochemical and physiological processes of plants. The research group previously found through transcriptome sequencing analysis, whole-genome identification and qRT-PCR analysis of potato KFB family members that potato KFB29 is differentially expressed in purple potato and yellow potato tubers.
[0003] Genome editing technology is an emerging genetic engineering technology for site-directed modification and modification of DNA sequences at the genome level, and it plays an important role in gene function research, plant genetic improvement and molecular breeding. The CRISPR / Cas9 system consists of sgRNA (Short guide RNA) and Cas9 nuclease, and has become the most popular gene editing technology due to its advantages such as high efficiency, simplicity, low cost and wide use. Summary of the Invention
[0004] Based on the existing research technology, the present invention aims to provide a mutant of potato StKFB29 gene based on the CRISPR / Cas9 system, a method and an application thereof, providing valuable germplasm resources for potato breeding.
[0005] In order to achieve the above object, the specific technical solution of the present invention is as follows:
[0006] A mutant of potato StKFB29 gene based on the CRISPR / Cas9 system, and the CDS sequence of the gene is as shown in SEQ ID NO.1.
[0007] A gRNA for editing potato StKFB29 gene, the StKFB29 gene mutant contains the gRNA, the gRNA sequence contains gRNA1 and gRNA2, the nucleotide sequence of gRNA1 is as shown in SEQ ID NO.2, and the nucleotide sequence of gRNA2 is as shown in SEQ ID NO.3;
[0008] Use of the gRNA in constructing potato gene editing materials, wherein the gene editing materials include recombinant bacteria, recombinant vectors, potato transgenic systems and tissues targeting potato StKFB29.
[0009] A CRISPR / Cas9 system comprising the gRNA for mutating potato StKFB29.
[0010] Use of the potato StKFB29 gene or related biological materials in the synthesis and accumulation of anthocyanins.
[0011] A method for constructing a CRISPR / Cas9 gene editing vector for the potato StKFB29 gene, comprising the following steps:
[0012] Design gRNA based on the CRISPR / Cas9 system for the potato StKFB29 gene sequence, design primers for this gRNA sequence, use the pCBC-DTDT2 backbone vector as a template for PCR amplification, and further ligate it with the pHSE401 expression vector to obtain the CRISPR / Cas9 gene editing vector for the potato StKFB29 gene.
[0013] A method for obtaining a CRISPR / Cas9 gene edited plant of the potato StKFB29 gene, comprising the following steps:
[0014] Design gRNA based on the CRISPR / Cas9 system for the potato StKFB29 gene sequence, design primers for this gRNA sequence, use the pCBC-DTDT2 backbone vector as a template for PCR amplification, and further ligate it with the pHSE401 expression vector to obtain the CRISPR / Cas9 gene editing vector for the potato StKFB29 gene, transform the potato, and achieve site-directed knockout of the potato StKFB29 gene, thereby obtaining a potato mutant plant.
[0015] A method for increasing the anthocyanin content of potatoes, comprising the following steps: Design gRNA based on the CRISPR / Cas9 system for the potato StKFB29 gene sequence, design primers for this gRNA sequence, use the pCBC-DTDT2 backbone vector as a template for PCR amplification, and further ligate it with the pHSE401 expression vector to obtain the CRISPR / Cas9 gene editing vector for the potato StKFB29 gene, transform the potato, and achieve site-directed knockout of the potato StKFB29 gene, thereby increasing the anthocyanin content of potatoes.
[0016] Potato cultivars are tetraploid plants, so their genes often exist in multiple copies. Therefore, in this invention, multiple sgRNAs are designed in the conserved regions of candidate genes, and a set of CRISPR / Cas9 multi-target systems modified and optimized for dicotyledonous plants are used to simultaneously express multiple sgRNAs to achieve efficient site-directed knockout of multiple homologous genes of candidate genes in potatoes. This invention enriches and improves the breeding resources rich in anthocyanins and also provides a new strategy for large-scale production of anthocyanins using potatoes as plant metabolic bioreactors.
[0017] The effects of the potato StKFB29 gene on the biosynthesis and accumulation of potato anthocyanins were verified by phenotypic observation, enzyme activity detection, and determination of the expression levels of anthocyanin-related genes in wild-type and transgenic potato plants. Brief Description of the Drawings
[0018] Figure 1 is the tertiary structure of StKFB29;
[0019] Figure 2 is the CDS of the StKFB29 gene and the target positions;
[0020] Figure 3 is the sequencing result diagram of the CRISPR / Cas9 gene editing vector plasmid of the StKFB29 gene;
[0021] Figure 4 is the identification of the CRISPR / Cas9 gene editing lines of the StKFB29 gene;
[0022] Figure 5 are the phenotypes and related gene expression levels of gene-edited potato seedlings and wild-type potato seedlings;
[0023] Figure 6 is the determination of enzyme activities of gene-edited potato seedlings and wild-type potato seedlings. Detailed Embodiments
[0024] The following combines specific embodiments to elaborate on this invention in detail.
[0025] To analyze the effects of potato StKFB29 on anthocyanin biosynthesis and accumulation, this embodiment presents a method for efficiently site-directed knockout of multiple homologous genes of potato StKFB29 based on the CRISPR / Cas9 system, and gene-edited materials of potatoes rich in high anthocyanin content are obtained.
[0026] The specific implementation process is as follows:
[0027] 1. Construction of the CRISPR / Cas9 gene editing vector of the potato StKFB29 gene
[0028] (1) Selection of gRNA target sites and synthesis of primers
[0029] In the present invention, the CDS sequence of the potato KFB29 gene (shown as SEQ ID NO.1) was downloaded from a database. Based on the analysis of the StKFB29 sequence, target sites were screened and gRNAs were designed according to the principle of CRISPR / Cas9 technology.
[0030]
[0031] Target design principles: The target length is 19bp + NGG; the target needs to be on the exon; the target avoids repetitive sequences and TTTT; the target preferably starts with "G"; the GC content is 20% - 80%.
[0032] Referring to the above principles, two gRNA targets, gRNA1 and gRNA2, were designed in the first exon region of StKFB29. The gRNA size is 19bp, and the PAM region is NGG.
[0033] gRNA1: 5’-TATTTCATTAGGTATCCCC-3’(SEQ ID NO.2)
[0034] gRNA2: 5’-ACCCGAACCGTTTTCGCCA-3’(SEQ ID NO.3)
[0035] According to the above two gRNA sequences, the following primers were designed and sent to Sangon Biotech Co., Ltd. in Shanghai for synthesis.
[0036] StKFB29-DT1-BsF: ATATATGGTCTCGATTGTATTTCATTAGGTATCCCCGTT(SEQ ID NO.4)
[0037] StKFB29-DT1-F0: TGTATTTCATTAGGTATCCCCGTTTTAGAGCTAGAAATAGC(SEQ ID NO.5)
[0038] StKFB29-DT2-R0: AACTGGCGAAAACGGTTCGGGTCAATCTCTTAGTCGACTCTAC(SEQ IDNO.6)
[0039] StKFB29-DT2-BsR: ATTATTGGTCTCGAAACTGGCGAAAACGGTTCGGGTCAA(SEQ ID NO.7)
[0040] (2) PCR amplification, purification and recovery
[0041] Dilute the concentrations of the primers StKFB29-DT1-BsF and StKFB29-DT2-BsR to 100 μM, and dilute the concentrations of the primers StKFB29-DT1-F0 and StKFB29-DT2-R0 to 10 μM. Using the pCBC-DTDT2 backbone vector diluted 100 times as a template, perform PCR amplification, and use a gel extraction kit to recover the target band.
[0042] (3) Ligation of the target band with the CRISPR / Cas9 gene editing vector
[0043] The gel-extracted product and the pHSE401 expression vector were digested with Bsa I restriction endonuclease respectively and then ligated with T4 ligase.
[0044] Table 1: Restriction digestion reaction system
[0045]
[0046] Table 2: Ligation reaction system:
[0047]
[0048] (4) Transformation of Escherichia coli and identification of the expression vector
[0049] After the ligation product was transformed into Escherichia coli competent cell DH5α by heat shock method, Kan and SpR resistance screening and colony PCR identification were carried out. The primers were U626-IDF and U629-IDR. The positive clones obtained were used to extract plasmids and then sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing primers were U626-IDF, U629-IDF and U629-IDR. The plasmids with correct sequencing results were stored for future use. The primer sequences are as follows:
[0050] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO.8)
[0051] U629-IDF: TTAATCCAAACTACTGCAGCCTGAC (SEQ ID NO.9)
[0052] U629-IDR: AGCCCTCTTCTTTCGATCCATCAAC (SEQ ID NO.10)
[0053] (5) Transformation of Agrobacterium
[0054] The successfully constructed vector CRISPR-StKFB29 was transformed into Agrobacterium competent cell EHA105 to obtain recombinant bacteria. The specific operation is as follows:
[0055] Preparation work: Turn on the 42°C water bath; ligation product; stopwatch; 1000 μL pipette; take competent cells from -80°C with ice, liquid nitrogen.
[0056] The Agrobacterium tumefaciens competent cells EHA105 stored at -80°C were thawed on ice. 5 μL of the successfully constructed CRISPR-StKFB29 plasmid was added to 100 μL of GV3101 competent cells without pipetting. After ice-bathing for 30 min and water-bathing at 42°C for 90 s, it was immediately placed in liquid nitrogen for 1 min. After natural thawing, 900 μL of LB liquid medium was added to each tube, and cultured in a shaker at 28°C and 180 rpm for 4 h. The bacteria were collected by centrifugation at 12000 rpm for 1 min, the supernatant was discarded, and 100 μL of the supernatant was left to resuspend the bacteria, which was evenly spread on the LB solid medium supplemented with 50 mg / mL Kan + 50 mg / mL Rif. After air-drying, it was cultured in the dark and inverted in an incubator at 28°C. After 48 h, single colonies were streaked on the LB solid medium supplemented with 50 mg / mL Kan + 50 mg / mL Rif, and after air-drying, it was cultured in the dark and inverted in an incubator at 28°C. After verification by colony PCR, the positive clones were transferred to the LB liquid medium supplemented with 50 mg / mL Kan + 50 mg / mL Rif and cultured overnight in a shaker at 28°C and 180 rpm. The bacterial liquid was mixed with 50% glycerol at a ratio of 1:1 and stored at -80°C for a long time.
[0057] 2. Obtaining and Identification of CRISPR / Cas9 Gene-Edited Plants of Potato StKFB29 Gene
[0058] (1) Preparation of Agrobacterium tumefaciens infection solution
[0059] The Agrobacterium tumefaciens stored at -80°C was activated and cultured in the resistant liquid medium to obtain an Agrobacterium tumefaciens solution with an OD 600 value of 0.25 - 0.35. It was centrifuged at 4000 rpm for 9 min to collect the bacteria, and M1 medium (1 L of M1 medium was obtained by mixing 4.43 g of MS salts containing vitamins, 30 g of sucrose and distilled water, pH = 5.8) was added. It was centrifuged at 4000 rpm for 15 min, the supernatant was discarded, and M2 medium (M2 medium is M1 medium + AS 200 μM, pH 5.4) was added to suspend the bacterial liquid to an OD 600 value of 0.8 for standby.
[0060] (2) Agrobacterium tumefaciens infection
[0061] The potato microchips pre-cultured at 23°C in the dark for 2 - 3 days were placed in the bacterial liquid for infection for 5 - 10 min, and shaken once every 2 - 3 min. After infection, the potato chips were placed on sterile filter paper to absorb the bacterial liquid. They were laid flat on the EY2 medium (EY2 medium is MS solid medium + 6-BA 1 mg / L + ZT 1 mg / L + IAA 1 mg / L + AS 100 μM) and cultured in the dark at 23°C for 2 days.
[0062] (3) Screening and regeneration culture
[0063] Transfer the micro potato chips to a sterilized culture flask, wash them 2 - 3 times with sterile water + Cef (500 mg / L), dry them with sterile filter paper, and transfer them to EY3 medium (EY3 medium is EY2 medium + Kan 100 mg / L + Cb 500 mg / L) for callus induction. Replace the medium every 2 weeks. Incubate at 25 °C, with a 16 hr light / 8 hr dark cycle and a light intensity of 2500 Lux. Globular green bud points appear on the cut surface and outer ring of the callus after about 1 - 2 months. Transfer the green bud points of the potato to the differentiation medium EY4 (EY4 medium is MS solid medium + 6 - BA 0.5 mg / L + IAA 0.2 mg / L + Kan 100 mg / L + Cf 500 mg / L). Incubate at 25 °C, with a 16 hr light / 8 hr dark cycle and a light intensity of 2500 Lux. After the potato shoots grow to 3 - 5 cm seedlings, transfer them to the rooting medium EY5 (EY5 medium is MS solid medium + IBA 0.1 mg / L + Kan 100 mg / L + Cf 250 mg / L). Incubate at 25 °C, with a 16 hr light / 8 hr dark cycle and a light intensity of 2500 Lux. Perform PCR verification after the transgenic plants become seedlings.
[0064] (4) Identification of CRISPR / Cas9 gene - edited plants of potato StKFB29 gene
[0065] Extract the leaf DNA of wild - type and transgenic regenerated plants, and perform PCR identification using the two primer pairs U626 - IDF and U629 t - IDR. The regenerated plants that obtain fragments of the expected size after amplification are transgenic positive plants. After identification, CRISPR - StKFB29 - 1, CRISPR - StKFB29 - 2, CRISPR - StKFB29 - 6, and CRISPR - StKFB29 - 8 are positive plants ( Figure 4 ). Design primers upstream of gRNA1 and downstream of gRNA2, and use the DNA of wild - type and transgenic positive plants CRISPR - StKFB29 - 1, CRISPR - StKFB29 - 6, and CRISPR - StKFB29 - 8 as templates for PCR respectively. Sequence the PCR products using the HI - TOM technology and analyze the editing of the target sequence. The primer sequences are as follows:
[0066] U629t - IDR: TATTGGTTTATCTCATCGGAACTGC (SEQ ID NO.11)
[0067] HI - CRISPR - StKFB29 - F: GGAGTGAGTACGGTGTGCAAAGGCGAGCTAGGGCCATG (SEQ IDNO.12)
[0068] HI-CRISPR-StKFB29-R: GAGTTGGATGCTGGATGGGTGCAGTATCACCCTCTGGT (SEQ ID NO. 13)
[0069] Sequencing results of the HI-TOM technique showed that compared with the wild type, different types of mutations occurred at target site 1 in the CRISPR-StKFB29-1, CRISPR-StKFB29-6, and CRISPR-StKFB29-8 lines (Table 3), including base substitutions, deletions, and insertions; base substitutions occurred at target site 2 (Table 4), indicating that StKFB29 was successfully edited.
[0070] Table 3: Statistical analysis of the editing efficiency of CRISPR / Cas9 gene-edited plants of the potato StKFB29 gene
[0071]
[0072]
[0073] Table 4:
[0074]
[0075]
[0076] (5) Phenotypic analysis and determination of enzyme activity content in potato StKFB29 gene-edited plants
[0077] The identified positive gene-edited potato plants were continuously cultured in a sterile tissue culture bottle, and their phenotypes were observed. It was found that compared with the control (WT), red pigment accumulation occurred at some positions on the leaves of the gene-edited potato ([[]] Figure 5 ). Transcriptome sequencing was performed on the tubers obtained from planting. The results showed that the expression of two PAL members was upregulated in the mutants. At the same time, the expression of some genes ANS and DFR in the anthocyanin synthesis pathway also showed an upward trend; in addition, the expression of a large number of transcription factors also showed an upward trend ([[]] Figure 5 ).
[0078] After measuring the antioxidant enzyme activities of WT and CRISPR plants under normal growth conditions, it was found that the SOD enzyme activity of the StKFB29 mutant was significantly increased, the CAT enzyme activity was significantly decreased, and the MDA content was decreased ([[]] Figure 6 ).
[0079] It should be understood that those of ordinary skill in the art can make improvements or changes based on the above description, and all such improvements and changes should fall within the protection scope of the appended claims of the present invention.
Claims
1. A mutant of potato StKFB29 gene based on the CRISPR / Cas9 system, characterized in that, The CDS sequence of this gene is shown in SEQ ID NO.
1.
2. A gRNA for editing the potato StKFB29 gene, characterized in that, The StKFB29 gene mutant described in claim 1 contains the said gRNA. The gRNA sequence contains gRNA1 and gRNA2. The nucleotide sequence of gRNA1 is shown in SEQ ID NO.2, and the nucleotide sequence of gRNA2 is shown in SEQ ID NO.
3.
3. The application of the gRNA described in claim 2 in constructing potato gene editing materials, where the gene editing materials include recombinant bacteria, recombinant vectors, potato transgenic systems and tissues targeting potato StKFB29.
4. A CRISPR / Cas9 system that contains the gRNA described in claim 2 and mutates potato StKFB29.
5. The application of the potato StKFB29 gene or related biological materials in the synthesis and accumulation of anthocyanins.
6. A method for constructing a CRISPR / Cas9 gene editing vector for the potato StKFB29 gene, characterized in that, It includes the following steps: Based on the CRISPR / Cas9 system, design gRNA for the potato StKFB29 gene sequence, design primers for this gRNA sequence, use the pCBC-DTDT2 backbone vector as a template for PCR amplification, and further connect it to the pHSE401 expression vector to obtain the CRISPR / Cas9 gene editing vector for the potato StKFB29 gene.
7. A method for obtaining CRISPR / Cas9 gene-edited potato plants with the StKFB29 gene, characterized in that, It includes the following steps: Based on the CRISPR / Cas9 system, design gRNA for the potato StKFB29 gene sequence, design primers for this gRNA sequence, use the pCBC-DTDT2 backbone vector as a template for PCR amplification, and further connect it to the pHSE401 expression vector to obtain the CRISPR / Cas9 gene editing vector for the potato StKFB29 gene, transform potatoes, achieve site-directed knockout of the potato StKFB29 gene, and thus obtain potato mutant plants.
8. A method for increasing the anthocyanin content in potatoes, characterized in that, It includes the following steps: Based on the CRISPR / Cas9 system, design gRNA for the potato StKFB29 gene sequence, design primers for this gRNA sequence, use the pCBC-DTDT2 backbone vector as a template for PCR amplification, and further connect it to the pHSE401 expression vector to obtain the CRISPR / Cas9 gene editing vector for the potato StKFB29 gene, transform potatoes, achieve site-directed knockout of the potato StKFB29 gene, and thus increase the anthocyanin content in potatoes.