An LrPR1A gene and its application

Abstract

This invention relates to the field of genetic engineering technology, and specifically discloses a... LrPR1A Genes and their applications, the aforementioned LrPR1A The nucleotide sequence of the gene is shown in SEQ ID NO.3. This invention provides... LrPR1A The gene inhibits the growth of black goji berry thorns by reducing the number and length of black goji berry thorns.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a... LrPR1A Genes and their applications. Background Art

[0002] Black goji berries, Latin name is Lycium ruthenium *Murr.*, a thorny shrub belonging to the Solanaceae family and the *Lycium* genus, produces purplish-black berries and is mainly distributed in northwestern China, Central Asia, and Europe. Black goji berries are rich in anthocyanins, amino acids, polysaccharides, fatty acids, and other bioactive components and nutrients, making them a plant with both medicinal and edible uses. Black goji berries also play an important role in windbreak and sand fixation, as well as in the control of desertification and salinization, thanks to their developed root system and strong environmental adaptability, making them a pioneer tree species with high ecological benefits. However, the harvest period for black goji berry fruits is short, and the fruits are soft, thin-skinned, and easily broken during harvesting and transportation. Worse still, the dense thorns on the stems significantly increase the difficulty of fruit harvesting, reducing harvesting efficiency and greatly increasing labor costs. The evolution of thorn structures is mainly related to the plant's self-protection mechanisms; thorns on fruits and branches can effectively defend against animal predation, while the thorn-like structures formed by leaf degeneration help adapt to arid environments. However, for economic crops, the presence of thorns is often detrimental to production management; therefore, thornless breeding for relevant economic tree species is essential. For example, using sea buckthorn as the research subject, a large-fruited, thornless sea buckthorn variety named "Wucifeng" was obtained, whose Latin name is Sea buckthorn . rhamnoides The absence of thorns in 'Wucifeng' enhances its disease resistance, increases yield, lengthens fruit stalks, and promotes denser fruit growth, significantly improving harvesting efficiency. Its Latin name is... Solanum . cleistogamous In the closed flower eggplant PL Gene editing almost completely suppressed the thorns while maintaining the fruit's morphology and sweetness. Therefore, based on precedents in other species where thorn loss does not lead to biomass reduction, and to better utilize resources such as black goji berry fruit, there is an urgent need to breed thornless or low-thorn black goji berries. Thus, it is necessary to investigate genes that influence thorn formation in black goji berry branches. Summary of the Invention

[0003] To explore the genes that influence the occurrence of thorns on black wolfberry branches, this invention provides a... LrPR1A Genes and their applications. Through overexpression of the gene provided by this invention... LrPR1A The gene reduces the number of thorns on black goji berry branches, decreases the length of thorns, and reduces the diameter of the thorn base, thereby inhibiting the growth of black goji berry branches and thorns.

[0004] This invention provides LrPR1A Genes, the ones mentioned LrPR1AThe gene is used to inhibit the occurrence and growth of thorns on black goji berry branches. LrPR1A The nucleotide sequence of the gene is shown in SEQ ID NO.3.

[0005] This invention utilizes overexpression LrPR1A The gene reduces the number of thorns on black goji berry branches, decreases the length of thorns, and reduces the diameter of the thorn base, thereby inhibiting the growth of black goji berry branches and thorns.

[0006] The present invention also provides an overexpression recombinant vector, wherein the overexpression recombinant vector contains the aforementioned... LrPR1A Gene.

[0007] Furthermore, the overexpression recombinant vector by... LrPR1A Gene ligated into pRI101-AN vector Kpn I and Eco The RI restriction site was constructed.

[0008] The present invention also provides a recombinant cell containing the overexpression recombinant vector described above.

[0009] An infection solution containing the recombinant cells.

[0010] The present invention also provides LrPR1A The application of the gene in inhibiting the occurrence and growth of thorns in black wolfberry branches, through overexpression of the aforementioned gene. LrPR1A Genes inhibit the occurrence and growth of thorns on black wolfberry branches.

[0011] Furthermore, the aforementioned LrPR1A Genes are used to reduce the number and length of thorns on black goji berry branches.

[0012] The present invention also provides the application of a gene product in inhibiting the thorns of black goji berry branches, wherein the gene product is selected from any one of the overexpression recombinant vector, the recombinant cells, and the infection solution.

[0013] The present invention also provides LrPR1A The application of genes in promoting the growth and development of black goji berries, through overexpression LrPR1A Genes promote the length and width of black goji berry leaves.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] This invention provides a method related to the occurrence of thorns on black wolfberry branches. LrPR1A Genes, overexpression LrPR1A The gene is used to reduce the number of thorns, length, and base diameter of black goji berry branches, thereby inhibiting thorn growth. Overexpression LrPR1AThe genes also promote the growth and development of black goji berries, including increasing leaf length and width. Attached Figure Description

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] Figure 1 pRI101- LrPR1A Agrobacterium tumefaciens PCR electrophoresis image; in the image, lane M indicates the sample is a DL2,000 DNA Ladder; lane 1 indicates the sample is the target bacterial culture.

[0018] Figure 2 pRNAi- LrPR1A Agrobacterium tumefaciens PCR electrophoresis image; in the image, lane M indicates the sample is a DL2,000 DNA Ladder; lane 1 indicates the sense strand, and lane 2 indicates the antisense strand.

[0019] Figure 3 Black goji berries LrPR1A Electrophoresis diagram of PCR detection of overexpressing resistant seedlings; in the diagram, lane M indicates that sample M is a DL2,000 DNA Ladder; A is the water control; - is the negative control: wild-type WT; + is the positive control; 1-8 represent 8 resistant lines.

[0020] Figure 4 Black goji berries LrPR1A Electrophoresis diagram of PCR detection of the sense and antisense strands of the resistant seedlings; where M represents the DL5,000 DNA Ladder; - represents the negative control; + represents the positive control; 1-7 represent the 7 strains respectively;

[0021] A represents black goji berries. LrPR1A Electrophoresis image of positive strand PCR detection of suppressed resistant vaccine;

[0022] B is black goji berries. LrPR1A Electrophoresis diagram of PCR detection of antisense strand in resistant seedlings.

[0023] Figure 5 Black goji berry overexpression strain LrPR1A Relative gene expression levels.

[0024] Figure 6 Strains that inhibit the expression of black goji berries LrPR1A Relative gene expression levels.

[0025] Figure 7 Black goji berries LrPR1A Phenotypic images of representative branches from overexpression lines, suppressed expression lines, and wild-type WT lines;

[0026] In the picture, A represents black goji berries. LrPR1A Representative branches of the overexpression line OE6, the suppressed expression line R4, and the wild-type WT line are shown in the diagrams. B is an enlarged view of the dashed area in A, with the first thorn below the terminal bud inside the dashed circle. Detailed Implementation

[0027] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0028] Example 1: A LrPR1A Genes and their applications.

[0029] I. Plant Materials and Main Reagents

[0030] 1. Plant materials

[0031] The black goji berry material used in this invention was grown at the Liaoning Provincial Key Laboratory of Forest Genetics, Breeding and Cultivation, College of Forestry, Shenyang Agricultural University, at 41° 49' 25'' N; 123° 34' 10'' E. The cultivation conditions were: 12 h light / 12 h dark, and 25±2℃.

[0032] 2. Main reagents

[0033] (1) MS liquid medium: 40 g / L sucrose + 4.74 g / L MS dry powder, add 4.5 g / L agar powder to make MS solid medium, pH=5.8.

[0034] (2) 1 / 2MS liquid medium: 20 g / L sucrose + 2.37 g / L MS dry powder, add 4.5 g / L agar powder to make 1 / 2MS solid medium, pH=5.8.

[0035] (3) Acetyleugenol, English name: AS: Weigh 0.1962 g of acetyleugenol powder, add 3 mL of DMSO and stir until dissolved, add distilled water to make up to 10 mL, filter and sterilize, and store at -20 ℃.

[0036] (4) Cephalosporin, English name: Cef: Weigh 5 g of cephalosporin powder, add distilled water, stir to dissolve and make up to 50 mL, filter and sterilize, and store at -20 ℃.

[0037] (5) Kanamycin, English name: Kan: Weigh 5 g of kanamycin powder, add distilled water to make up to 100 mL, filter and sterilize, and store at -20 ℃.

[0038] (6) LB liquid medium: Weigh 1 g tryptone, 0.5 g yeast extract, and 1 g NaCl, add distilled water to a final volume of 100 mL, and adjust the pH to 7.0. Add 1.5 g / L agar powder to obtain LB solid medium.

[0039] (7) YEP liquid medium: Weigh 1 g beef extract powder, 1 g yeast extract powder, and 0.5 g NaCl, add distilled water to a final volume of 100 mL, and adjust the pH to 7.0. Add 1.5 g / L agar powder to obtain YEP solid medium.

[0040] (8) 2000 times carbendazim solution: purchased from Anhui Guangxin Agricultural Chemical Co., Ltd., active ingredient content: 50%, wettable powder.

[0041] (9) Bifenthrin·Thiamethoxam: purchased from Jiangmen Plant Protection Co., Ltd., bifenthrin content: 0.5%; thiamethoxam content: 0.5%, granules.

[0042] II. Experimental Methods

[0043] 1. LrPR1A Cloning of genes

[0044] (1) Total RNA extraction from black wolfberry

[0045] Total RNA was extracted from the tender stem nodes of black goji berries using the R4312-02 RNA extraction kit from Shanghai Maigen Biotechnology Co., Ltd. 1 μL of the product was taken for concentration and purity determination using an ND-2000 ultra-micro UV spectrophotometer. Samples were taken according to RNA concentration for agarose gel electrophoresis detection.

[0046] (2) Detection of reverse transcription and internal reference primers

[0047] Total RNA successfully extracted from black goji berries was reverse transcribed using the HiScript® III RT SuperMix for qPCR (+gDNA wiper) from Nanjing Novizan Biotechnology Co., Ltd. After reverse transcription, cDNA was detected by PCR using internal control primers DNActinF and DNActinR to assess its quality. The nucleotide sequence of DNActinF is shown in SEQ ID NO.1, and the nucleotide sequence of DNActinR is shown in SEQ ID NO.2. The reaction system is shown in Table 1.

[0048] SEQ ID NO. 1: 5'-TCCGAATTTTATGAGTTG-3'.

[0049] SEQ ID NO. 2: 5'-TGATAAGCGATACCACTG-3'.

[0050]

[0051] The reverse transcription PCR program was set as follows: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 30 s, 58 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for 36 cycles; 72 ℃ extension for 10 min; storage at 12 ℃. Successfully detected cDNA was stored at -20 ℃ for later use.

[0052] (3) Cloning of the target gene

[0053] Based on the results revealed by RNA-Seq LrPR1A Gene sequence characteristics, LrPR1A The gene sequence is shown in SEQ ID NO.3. Specific primers PR1-F and PR1-R were designed using Primer Premier 5. The nucleotide sequence of PR1-F is shown in SEQ ID NO.4, and the nucleotide sequence of PR1-R is shown in SEQ ID NO.5. Using the successfully validated cDNA as a template, PR1-F and PR1-R were used as primers for cloning. LrPR1A The full-length CDS sequence of the gene was obtained. The gene DNA sequence was amplified by PCR using DNA as a template, and compared with the CDS sequence to verify whether the gene possesses intron structure. The PCR reaction system is shown in Table 2.

[0054] SEQ ID NO.3:

[0055] .

[0056] SEQ ID NO. 4: 5'-ATGGGATTCTCCAATGTCTT-3'.

[0057] SEQ ID NO. 5: 5'-TCAGACATCAGTTGGAAGTTCCAAC-3'.

[0058]

[0059] The PCR program was set as follows: 98 °C pre-denaturation for 1 min; 98 °C denaturation for 10 s; 60 °C annealing for 5 s; 72 °C extension for 30 s; 36 cycles; 72 °C extension for 1 min; 12 °C storage.

[0060] (4) Recovery of products from agarose gel electrophoresis

[0061] Prepare a 1.5% agarose gel and perform electrophoresis on the above PCR products. The program is set to 105 V voltage and 300 mA current. After 25 min, the gel is cut and recovered using the RTP2201-02 agarose gel DNA recovery kit from Zhongke Ruitai (Beijing) Biotechnology Co., Ltd.

[0062] 2. LrPR1A Gene-transformed E. coli

[0063] (1) Target gene ligated into T vector

[0064] The recovered electrophoresis products were ligated to the T vector in a PCR instrument at 16 °C overnight. The prepared mixture is shown in Table 3. The T vector was obtained from TaRaKa's pMD™19-T Vector Cloning Kit.

[0065]

[0066] (2) Heat shock method for transforming Escherichia coli

[0067] The recombinant T vector was transformed into Escherichia coli DH5α competent cells using the heat shock method. Single colonies were picked and cultured in liquid LB medium at 37°C and 180 rpm for 3 h, followed by bacterial PCR detection. The primers used for bacterial PCR detection were M13F (SEQ ID NO. 6) and M13R (SEQ ID NO. 7), and the specific reaction system is shown in Table 4.

[0068] SEQ ID NO. 6: 5'-TGTAAAACGAGCGGCCAGT-3'.

[0069] SEQ ID NO.7: 5'-CAGGAAACAGCTATGAC-3'.

[0070]

[0071] The bacterial culture PCR program was set as follows: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 30 s, 58 ℃ annealing for 30 s, 72 ℃ extension for 1 min, for 36 cycles; 72 ℃ extension for 10 min; storage at 12 ℃. Successfully detected cDNA was stored at -20 ℃ for later use.

[0072] PCR products were detected by electrophoresis using a 1% agarose gel and observed using a gel imaging system. Products with single, correctly positioned bands were selected and sent to Tianjin Genewiz Biotechnology Co., Ltd. for sequencing. Successfully sequenced bacterial solutions were then added to an equal volume of 50% glycerol, mixed thoroughly, and stored at -80 °C.

[0073] 3. Construction of overexpression vectors and repressor expression vectors

[0074] (1) Primer design for overexpression vector

[0075] Using pRI101-AN as the original vector, according to LrPR1A Gene CDS sequence and vector sequence characteristics, selection Kpn I and Eco The RI double restriction sites were designed for the OEF primer shown in SEQ ID NO.8 and the OER primer shown in SEQ ID NO.9 used in the construction of the overexpression vector.

[0076] SEQ ID NO. 8: 5'-CGGGTACCATGGGATTCTCCAATGTCTT-3'.

[0077] SEQ ID NO.9: 5'-GGGAATTCTCAGACATCAGTTGGAAGTT-3'.

[0078] (2) Design of shRNA

[0079] Using pRNAi-E as the original vector, according to LrPR1A Gene CDS sequence characteristics were analyzed, and shRNA was predicted using the online website https: / / rnaidesigner.thermofisher.com / rnaiexpress / . Based on the prediction results, a 214 bp gene sequence containing shRNA was selected as the vector to construct the positive strand. The nucleotide sequence of the positive strand is shown in SEQ ID NO. 16. Xba I and Sma I. Double restriction enzyme sites were used to design primers TY-ZF and TY-ZR to inhibit homologous recombination of the positive strand of the expression vector. The nucleotide sequence of the TY-ZF primer is shown in SEQ ID NO.10, and the nucleotide sequence of the TY-ZR primer is shown in SEQ ID NO.11. The original pRNAi-E vector was published in the following journal: Song Mengru, Chen Keqin, Guo Yunna, et al. 2017. Construction of a new RNAi vector for plant gene silencing [J]. Journal of Shenyang Agricultural University. 48(6):719–724.

[0080] An antisense strand was constructed using the inverse complementary sequence of the above gene sequence as a vector. The nucleotide sequence of the antisense strand is shown in SEQ ID NO.17. Kpn I and EcoPrimers TY-FF and TY-FR, designed with RI double restriction sites to inhibit homologous recombination of the antisense strand of the expression vector, were used. The nucleotide sequence of the TY-FF primer is shown in SEQ ID NO.12, and the nucleotide sequence of the TY-FR primer is shown in SEQ ID NO.13.

[0081] SEQ ID NO.10:

[0082] 5'-GGAGAGAACACGGGGGACTCTAGATCAGACATCAGTTGGAA-3'.

[0083] SEQ ID NO.11:

[0084] 5'-CTTACCAATTGGGGTTCCCCCGGGTTGTCGAGCCGGTAAAG-3'.

[0085] SEQ ID NO.12:

[0086] 5'-GCTGGGTTCGAAATCGATGGTACCTTGTCGAGCCGGTAAAG-3'.

[0087] SEQ ID NO.13:

[0088] 5'-GGAGAGAACACGGGGGACTCTAGATCAGACATCAGTTGGAA-3'.

[0089] SEQ ID NO.16:

[0090] 5'-TCAGACATCAGTTGGAAGTTCCAACTTAGAATCGAAGGCCGGCTGTTCTTCAAGATCACCGTAAGGACGTTGTCCTCCAGTTACCTGGTGGATCATAATTGCAAGTTATAAAATACCACCCGTTGTTGCACCGAACCCTAGCACAACCAAGACGTACTGAATTACGCCAGACCACCTGAGTATAGTGTCCGCATACTTTACCGGCTCGACAA-3'.

[0091] SEQ ID NO.17:

[0092] 5'-TTGTCGAGCCGGTAAAGTATGCGGACACTATACTCAGGTGGTCTGGCGTAATTCAGTACGTCTTGGTTGTGCTAGGGTTCGGTGCAACAACGGGTGGTATTTTATAACTTGCAATTATGATCCACCAGGTAACTGGAGAGGACAACGTCCTTACGGTGATCTTGAAGAACAGCCGGCCTTCGATTCTAAGTTGGAACTTCCAACTGATGTCTGA-3'.

[0093] (3) LrPR1A Target fragment cloning and recovery

[0094] Using the aforementioned preparation containing links LrPR1A Plasmids were extracted from bacterial culture containing the T-vector of the gene. These plasmids served as templates for cloning the full-length target fragment using primers OEF and OER. The sense strand fragment was amplified using primers TY-ZF and TY-ZR. The antisense strand fragment was amplified using primers TY-FF and TY-FR. The PCR reaction systems are shown in Table 5.

[0095]

[0096] The PCR program was set as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 30 s, for 36 cycles; 72 °C extension for 10 min; and storage at 12 °C.

[0097] The electrophoresis results were observed using a gel imaging system, and the correct bands were selected for agarose gel recovery.

[0098] (4) Enzyme digestion and ligation of the target fragment and the vector

[0099] use Kpn I and Eco RI restriction endonucleases on pRI101-AN vector and LrPR1A The full-length gene was double-digested to obtain LrPR1A Gene fragments and linearized pRI101-AN vector. The reaction system is shown in Table 6.

[0100]

[0101] After mixing the above components, the mixture was incubated in a water bath at 37 ℃ for 80 min. A 1 μL sample was then subjected to electrophoresis. After successful enzyme digestion, the DNA was purified and recovered using a Kangwei Century DNA rapid recovery kit to obtain the digested target fragment and linear plasmid. The recovered product was stored at -20 ℃.

[0102] The enzyme-digested product was processed using T4 DNA Ligase. LrPR1A The gene fragments were ligated into the linearized pRI101-AN vector, and the ligation system is shown in Table 7.

[0103]

[0104] After thoroughly mixing the above components, ligation was performed at 16 °C for 14 h to obtain the overexpression recombinant vector, named pRI101- LrPR1A .

[0105] use Xba I and Sma The pRNAi-E vector was double-digested with restriction endonuclease I, and the reaction system is shown in Table 8 to obtain the linearized pRNAi-E vector.

[0106]

[0107] After mixing the above components, incubate at 37°C for 80 min, and take 2 μL of the mixture for electrophoresis detection. The linearized pRNAi-E vector was recovered using the agarose gel DNA rapid recovery kit from Jiangsu Kangwei Century Biotechnology Co., Ltd., and stored at -20°C.

[0108] The linearized pRNAi-E vector and the sense strand were ligated using a homologous recombination kit to obtain the recombinant vector pRNAi-PR1Z. The ligation system is shown in Table 9.

[0109]

[0110] Extract pRNAi-PR1Z plasmid and use Kpn I and Eco The pRNAi-PR1Z plasmid was double-digested with RI restriction endonuclease. The digestion and ligation systems were the same as those in Tables 8 and 9. Both the sense and antisense strands were constructed into the pRNAi-E plasmid to obtain the recombinant vector pRNAi- LrPR1A .

[0111] 4. Transformation of Escherichia coli using recombinant vectors

[0112] The recombinant plasmid pRI101- obtained from the above construction was used LrPR1A pRNAi- PR1Z pRNAi- LrPR1ATransformed into *E. coli* DH5α competent cells, following the transformation procedure outlined in the ANGYUBIO manual. The PCR program for the bacterial culture was set as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 30 s, for 36 cycles; 72 °C extension for 10 min; and storage at 12 °C. For overexpression vector detection, primers M13F and M13R were used, with an extension time of 2 min. For detection of the sense strand fragment of the inhibited expression vector, primers SF and TY-ZR (shown in SEQ ID NO. 14) were used; for detection of the antisense strand fragment, primers TY-FF and M13R were used. The correctly detected bacterial cultures were mixed with 50% glycerol at a 1:1 ratio and stored at -80 °C.

[0113] SEQ ID NO. 14: 5'-GACGCACAATCCCACTATCC-3'.

[0114] 5. Plasmid transformation of Agrobacterium

[0115] The plasmid from the correctly sequenced bacterial culture, extracted from the recombinant vector and transformed into *E. coli*, was then transformed into *Agrobacterium* LBA4404. The specific steps are as follows:

[0116] ① Take Agrobacterium LBA4404 competent cells out of the -80 ℃ freezer and place them on ice. After thawing for 1 hour, add plasmids not more than 1 / 10 of the competent cell volume in a sterile operating table, gently tap to mix, and then let stand on ice for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, and stand on ice for 5 min in sequence.

[0117] ② Add 900 μL of antibiotic-free liquid YEP medium to a clean bench and incubate at 28 ℃ and 180 rpm for 4 h.

[0118] ④ Centrifuge the cultured bacterial solution at 5,000 rpm for 5 min, discard the supernatant, and resuspend the remaining approximately 100 μL of supernatant with the bacterial culture.

[0119] ⑤ Spread the resuspended bacterial solution onto solid YEP medium supplemented with 50 mg / L Kan and 100 mg / L Rif, and incubate upside down at 28°C for 48 h.

[0120] Single clones were picked and cultured in liquid YEP medium at 28°C and 180 rpm for 3 hours, followed by bacterial PCR detection.

[0121] 6. Construction LrPR1A Stable overexpression and inhibition of black goji berry expression

[0122] The plasmid pRI101- contains the overexpression plasmid LrPR1A Agrobacterium bacterial culture and pRNAi containing inhibitory expression plasmids LrPR1A Agrobacterium bacterial culture was activated and cultured to OD. 600 After centrifugation at 0.6 and 5,000 rpm for 1 min, the bacterial cells were resuspended in liquid MS medium supplemented with 100 μmol / L AS to prepare an infection solution, which was then incubated at 4°C in the dark for 1 h for later use.

[0123] Select healthy 40-day black goji berry tissue culture seedlings, cut off the leaf tips, and inoculate them with the underside of the leaves facing up onto solid MS medium without any plant growth regulators. Culture in tissue culture for 5 days.

[0124] The pre-cultured leaf tip explants were placed in the infection solution for 10 min. After infection, the bacterial solution on the leaf surface was blotted dry with filter paper, and the leaf was inoculated with the underside facing up in solid MS medium supplemented with 100 μmol / L AS and cultured in the dark at 25 ℃ for 2 days.

[0125] After dark culture, the materials were sterilized by washing with sterile water supplemented with 500 mg / L Cef, repeated 6 times. After washing, the surface liquid was dried, and the leaves were inoculated with the undersides facing up onto solid MS medium supplemented with 3 mg / L Kan and 300 mg / L Cef for selection culture. The medium was changed every 9 days. After the leaf tip explants rooted, the solid MS medium was replaced with 1 / 2 MS medium, while the antibiotic conditions remained unchanged.

[0126] When the resistant seedlings in the selection medium grew to 6 cm, 3 cm stems of the resistant plants were cut and transferred to a rooting medium. At this time, 5 mg / L Kan and 300 mg / L Cef were added to the medium. After the resistant stems rooted and developed into seedlings, stem cuttings were continued for propagation. When a sufficient number of resistant plants were obtained, DNA and RNA were extracted and identified.

[0127] 7. DNA and RNA level identification

[0128] DNA level identification: Total genomic DNA was extracted from untransformed wild-type WT and transgenic resistant plants of *Lycium barbarum* using a DNA extraction kit (RTG2404-01) from Zhongke Ruitai (Beijing) Biotechnology Co., Ltd. DNA levels in overexpressing resistant seedlings were detected using vector primers SF and M13R, with pRI101- LrPR1A The recombinant vector served as a positive control, while WT tissue culture seedling DNA and water served as negative controls. Inhibition of resistant seedling expression was performed using primers SF and TY-ZR for sense strand detection, and TY-FF and T1R (shown in SEQ ID NO. 15) for antisense strand detection, using pRNAi- LrPR1A The recombinant vector served as a positive control, and WT tissue culture seedling DNA served as a negative control. PCR products were verified by 1% agarose gel electrophoresis.

[0129] SEQ ID NO. 15: 5'-CTCACTCATTAGGCACCC-3'.

[0130] RNA level identification: RNA levels were detected in overexpression and suppression-expression resistant seedlings that had been successfully identified at the DNA level. Total RNA was extracted from transgenic resistant seedlings and wild-type WT seedlings that were propagated at the same time and had stems reaching 5 cm in length, and reverse transcribed into cDNA using the same method as before. Black goji berries were used as an example. GAPDH The gene is an internal reference gene, and detection is performed using qRT-PCR. LrPR1A The relative expression level of the gene in the transgenic lines was determined by three biological replicates.

[0131] 8. LrPR1A Phenotypic determination of plants with overexpression and suppressed expression

[0132] Select tissue culture bottles containing healthy plants that are growing at the same stage. LrPR1A Transgenic lines were transplanted along with wild-type WT. The pre-transplantation growing environment for the tissue-cultured seedlings was: a 12-hour light / 12-hour dark photoperiod and a temperature of 25±2℃. Seven days before transplanting, the seedlings underwent hardening-off treatment to improve their adaptability to the external environment and transplant survival rate. First, closed-bottle hardening-off was performed: when the stems of the seedlings reached 6 cm in length, the culture bottles were moved to a natural light environment and cultured for 4 days. After the closed-bottle hardening-off period, the culture bottle caps were opened, and the seedlings were cultured in the same environment for another 4 days to further enhance their adaptability.

[0133] At transplanting, add a 2000-fold dilution of carbendazim solution to the soil substrate and mix thoroughly until the soil moisture is uniform. Carefully remove the tissue culture seedlings from the culture medium and transfer them into the soil substrate, covering them with breathable, transparent plastic cups to allow them to recover. Simultaneously, apply bifenthrin-thiamethoxam to control soil pests. Approximately 30 days after transplanting, remove the plastic cups and place the plants in a seedling room for normal cultivation under the following conditions: a 14-hour light / 10-hour dark photoperiod and a temperature of 25±2℃. Water every 4 days to maintain soil field capacity at 75%.

[0134] After about 90 days of growth following transplanting, select healthy plants with normal growth. LrPR1A Statistical analyses were performed on gene-overexpressing lines, gene-suppressed lines, and untransformed wild-type WT lines for spiny number, spiny rate, spiny length, spiny base diameter, new stem length, new stem midpoint thickness, leaf length, leaf width, number of new stem nodes, number of new leaves, and number of leaves per new stem cluster. The experiment was conducted with three biological replicates, each with at least five different black goji berry plants. One-way ANOVA was performed on the phenotypic data using SPSS 23.0.

[0135] III. Test Results

[0136] 1. Construction of overexpression vectors

[0137] pRI101- successfully extracted and sequenced LrPR1A E. coli plasmids were transformed into Agrobacterium. Single colonies were picked from plates for culture, and PCR verification was performed using vector primers M13F and M13R. Electrophoresis results are shown below. Figure 1 As shown, pRI101- LrPR1A The overexpression vector was successfully constructed.

[0138] 2. Construction of expression suppression vector

[0139] pRNAi extracted and sequenced successfully LrPR1A E. coli plasmids were transformed into Agrobacterium. The sense strand of the repressed expression vector was validated using primers SF and TY-ZR, and the antisense strand was validated using primers TY-FF and M13R. The results are as follows: Figure 2 As shown, both the forward and reverse fragments have been successfully ligated into the pRNAi-E vector, completing the pRNAi-E process. LrPR1A Construction of suppression expression vectors.

[0140] 3. Screening and identification of resistant plants by overexpression and suppression

[0141] DNA was extracted from eight overexpressing resistant plants for PCR detection. Electrophoresis results are shown below. Figure 3 As shown, the PCR products using water and wild-type WT as templates showed no bands. The PCR products of the four resistant plants had the correct length and were consistent with the positive control, which preliminarily proved that the four overexpressing resistant plants were successfully transformed and named OE4, OE5, OE6 and OE8, respectively.

[0142] DNA was extracted from eight plants that inhibited the expression of resistance, and PCR detection of the sense and antisense strands was performed. Electrophoresis results are shown below. Figure 4 As shown, the PCR products using WT as a template had no bands. The PCR products of the 308 bp sense strand and the 675 bp antisense strand of the 7 resistant plants were of the correct length and consistent with the positive control, proving that the 7 resistant plants were successfully transformed and named R4, R5, R8, R9, R12, R15 and R16, respectively.

[0143] 4. Detection of RNA levels in overexpressed and suppressed resistant plants

[0144] Quantitative PCR results as follows Figure 5 As shown, compared with wild-type WT, the four overexpressing positive plants LrPR1A Expression levels were significantly upregulated, with OE6 showing the highest relative expression level, 6.56 times that of the control. Figure 6 As shown, 7 plants with suppressed expression LrPR1A Expression levels were significantly downregulated, with R4 showing the lowest relative expression level, which was 0.18 times that of the control. DNA and RNA level detection results confirmed that we successfully obtained 4 overexpression transgenic lines and 7 repressed expression transgenic lines.

[0145] 5. Phenotypic changes in transgenic lines with overexpression and suppressed expression

[0146]

[0147] Transplanted at the same time LrPR1A The most significantly upregulated expression strain was OE6. LrPR1A Phenotypic analysis was performed on the most significantly downregulated expression line R4 and the untransformed WT. Results are as follows: Figure 7 As shown in Figure 1 and Table 10, the overexpression line OE6 had significantly fewer spines, a lower spine rate, spine length, and spine base diameter than the WT line, while the length of new stems, the thickness of the midpoint of new stems, the leaf length, and the leaf width were all significantly greater than those of the WT line. In contrast, the suppressed expression line R4, compared to the WT line, showed a significantly increased length of new stems and a significantly decreased leaf length and width.

[0148] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0149] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A kind LrPR1A The application of genes in inhibiting the occurrence and growth of thorns in black wolfberry branches is characterized by, Through overexpression LrPR1A Genes inhibit the occurrence and growth of thorns on black wolfberry branches; the aforementioned LrPR1A The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. As described in claim 1 LrPR1A The application of genes in inhibiting the occurrence and growth of thorns in black wolfberry branches is characterized by, The LrPR1A Genes are used to reduce the number and length of thorns on black goji berry branches.

3. The application of a gene product in inhibiting the thorns of black wolfberry branches, characterized in that, The gene product is selected from any one of the overexpression recombinant vector, recombinant cells, and infection solution; The overexpression recombinant vector contains the aforementioned LrPR1A The gene, the recombinant cell containing the overexpression recombinant vector, and the infection solution containing the recombinant cell.

4. A kind LrPR1A The application of genes in promoting the growth and development of black goji berries is characterized by, Through overexpression LrPR1A Genes promote leaf length and width in black goji berries; LrPR1A The nucleotide sequence of the gene is shown in SEQ ID NO.3.

Images