CRISPR / Cas9-mediated T-DNA fixed-point insertion method dependent on non-homologous recombination pathway and application of CRISPR / Cas9-mediated T-DNA fixed-point insertion method

Through the CRISPR/Cas9-mediated non-homologous recombination pathway, combined with the "two-step" transformation and the non-homologous end ligation of T-DNA, site-directed insertion of large fragments in the plant genome is achieved, solving the problem of inefficiency of traditional methods and is suitable for gene activation and male gamete-specific gene research.

CN120290619APending Publication Date: 2025-07-11SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510277694.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-10
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

In the prior art, site-specific DNA insertion efficiency of plant gene editing is low, especially in large fragment insertion and dicotyledon plants. The traditional homologous recombination repair pathway is inefficient. Prime editing technology cannot meet the needs of large fragment site-directed insertion, and seamless and precise connection is not necessary for all applications.

Method used

The non-homologous recombination pathway mediated by CRISPR/Cas9 was used to transform through the "two-step method". The Cas9 expression vector was first transformed into wild-type plants, and then transferred to sgRNA and corresponding fragments. CRISPR/Cas9 was used to generate site-pointed break points, and combined with the non-homologous end ligation mechanism of T-DNA, achieving site-directed insertion of large fragments of T-DNA.

Benefits of technology

It improves the efficiency of DNA site-directed insertion in the plant genome, breaks through the limitations of site-directed insertion fragment size, simplifies the genetic analysis of gene activation and reproductive-related mutation alleles, and is suitable for a variety of applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290619A_ABST
    Figure CN120290619A_ABST
Patent Text Reader

Abstract

The invention discloses a CRISPR / Cas9-mediated T-DNA fixed-point insertion method dependent on a non-homologous recombination pathway and application of the CRISPR / Cas9-mediated T-DNA fixed-point insertion method. A two-step method is utilized for transformation, firstly, a Cas9 expression vector is transformed into a wild type plant, and a Cas9 transgenic plant is obtained; then sgRNA and corresponding fragments are transferred, a fixed-point breaking point (DSB) is generated based on CRISPR / Cas9, and insertion of the T-DNA in the fixed-point DSB is realized by using a non-homologous end connection integration mechanism of the T-DNA. According to the method, T-DNA efficient fixed-point insertion is achieved by improving DSB cutting efficiency, and the problems that a plant homologous recombination repair approach is low in efficiency and a prime edging technology cannot meet the requirement of large-fragment fixed-point insertion are solved. The method can be used for gene activation and gamete specific gene marking, and has wide applicability under various conditions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing. Specifically, it relates to a method and application of T-DNA site-directed insertion mediated by CRISPR / Cas9 and dependent on the non-homologous recombination pathway. Background Art

[0002] Site-specific DNA insertion is a powerful tool in transgenic crop breeding and gene function analysis. It can insert functional genetic elements into specific genomic sites and avoid the expression effects caused by different chromosomal positions of transgenes. In the past few decades, through many efforts, site-specific DNA insertion in plants has been achieved, but its efficiency is still not satisfactory. Traditional site-specific DNA integration methods are based on the homology-directed repair (HDR) mechanism. However, the low activity of HDR in plant cells requires multiple generations and screening of a large number of transgenic plants, thus being inefficient.

[0003] Prime editing technology uses CRISPR / Cas technology to induce specific double-strand DNA breaks (DSBs), and a reverse transcriptase fused to the Cas protein introduces a DNA repair template by reverse transcription under the guidance of pegRNA. This technology is an important improvement in the field of gene editing, but it has defects in inserting large fragments of DNA. It has a higher efficiency below 50 bp, while the efficiency is very low when inserting 400 bp. In addition, prime editing has a lower efficiency in dicotyledonous plants. Therefore, efficient insertion of large fragments of DNA remains a bottleneck in plant gene editing.

[0004] Compared with the low efficiency of DNA insertion mediated by homologous recombination repair, Agrobacterium-mediated T-DNA insertion is highly efficient and is the main method for plant transgenesis. Agrobacterium tumefaciens carries a Ti plasmid, and the Ti plasmid synthesizes single-stranded T-DNA through a template between the right border (RB) and left border (LB) sequences. The virulence effector protein VirD2 of Agrobacterium cuts the RB site and covalently binds to the 5′ end of the T-DNA strand. The single-stranded T-DNA strand is transferred into the host plant cell through a type IV secretion system and finally integrated into the plant genome. T-DNA-mediated transgenesis has the following advantages: high efficiency, the ability to carry large fragments of DNA, a low number of inserted copies, and less damage to genomic DNA compared with the gene gun delivery method. T-DNA insertion depends on the non-homologous end joining (NHEJ) repair pathway, including classical NHEJ (cNHEJ) and alternative NHEJ (aNHEJ) mechanisms. In plant cells, the NHEJ-mediated repair pathway is more efficient than the homologous recombination repair (HDR) pathway. However, the insertion site of T-DNA in the plant genome is random, and base addition and deletion often occur at the terminal repair site. Generally speaking, DNA insertion mediated by HDR has been highly regarded because of its site-specificity and seamless and precise ligation characteristics. However, it is not reasonable to rely on the HDR pathway to achieve site-directed DNA insertion: on the one hand, the HDR activity of plant cells is low; on the other hand, although both insertion mediated by homologous recombination repair and prime editing can achieve seamless and precise ligation, seamless and precise ligation is not necessary for all relevant applications of site-directed insertion.

[0005] Therefore, if a method can be provided to induce double-strand breaks (DSBs) through CRISPR / Cas9 and develop a large-fragment T-DNA site-directed insertion (targeted T-DNA integration, TI) based on the NHEJ pathway and non-seamless ligation, it will have broad prospects for crop breeding and basic transgenic research. Summary of the Invention

[0006] The object of the present invention is to overcome the above-mentioned defects and deficiencies existing in the prior art and provide a method for site-directed insertion of T-DNA mediated by CRISPR / Cas9 and dependent on the non-homologous recombination pathway.

[0007] The second object of the present invention is to provide the application of the above method in gene activation or gamete-specific gene research.

[0008] The above objects of the present invention are achieved by the following technical solutions:

[0009] The present invention provides a method for site-directed insertion of T-DNA mediated by CRISPR / Cas9 and dependent on the non-homologous recombination pathway. The method comprises the following steps:

[0010] S1. Obtaining Cas9 transgenic plants: transforming a wild-type plant with a Cas9 expression vector, and screening to obtain a single-copy Cas9 transgenic plant; the Cas9 expression vector sequentially comprises, from the right border to the left border, a fluorescent reporter gene driven by a promoter, a Cas9 gene driven by an egg cell-specific promoter, and a resistance gene driven by a promoter; the structure of the vector is LB - resistance gene - promoter - Cas9 - egg cell-specific promoter - fluorescent reporter gene - promoter - RB;

[0011] S2. Obtaining T-DNA site-directed insertion plants: transforming the Cas9 transgenic plants with a pB2300EE vector, and screening to obtain T-DNA site-directed insertion plants; the pB2300EE vector comprises an sgRNA - target fragment for targeting a specific genomic locus driven by an sgRNA promoter and a resistance gene driven by a promoter; the target fragment is a marker gene or an enhanced promoter.

[0012] Since traditional site-specific DNA integration methods are based on the homologous recombination repair (HDR) mechanism, and the efficiency of the plant homologous recombination repair pathway is low, prime editing technology cannot meet the requirements of large fragment site-directed insertion and is inefficient in dicotyledonous plants. Although both homologous recombination repair-mediated insertion and prime editing can achieve seamless and precise ligation, not all applications require seamless ligation, and non-seamless ligation of T-DNA site-directed insertion has a wide range of applications. Therefore, the present invention provides a method for large fragment T-DNA site-directed insertion mediated by CRISPR / Cas9 that depends on the non-homologous recombination pathway and non-seamless ligation. It is assumed that CRISPR / Cas9-mediated T-DNA site-directed insertion (TI) requires the simultaneous presence of specific double-strand breaks (DSBs) and free T-DNA molecules in transformed cells. If the formation of DSBs is delayed, free T-DNA molecules may be inserted into other DSBs or degraded. Therefore, the formation time of DSBs and the dose of T-DNA may determine the frequency of TI occurrence. To enable the simultaneous presence of specific DSBs and free T-DNA molecules in transformed cells, the present invention uses a "two-step" transformation method. First, a Cas9 expression vector specifically expressed in egg cells is transformed into wild-type plants to obtain transgenic plants expressing Cas9 in egg cells (subsequently, during subsequent Agrobacterium transformation, site-directed insertion can be achieved in egg cells, and site-directed insertion candidate plants can be obtained more efficiently and quickly in the T1 generation, which is faster than other methods). By screening for single-copy Cas9 transgenic plants (heterozygous Cas9 transgenic plants), the genetic background of Cas9 transgenic plants can be ensured and it is convenient to obtain Cas9-free plants by segregation in the offspring; then, the sgRNA and the corresponding fragment (T-DNA) are introduced. Based on CRISPR / Cas9, site-specific cleavage points (DSBs) are generated, and the insertion of T-DNA into the site-specific DSBs is achieved by using the non-homologous end joining (NHEJ) integration mechanism of T-DNA. The "two-step" method increases the time window for the coexistence of DSB formation and free T-DNA in the transformed cells, that is, egg cells, and improves the DSB cleavage efficiency and the efficiency of T-DNA site-directed insertion (TI). The site-directed insertion of the present invention refers to the integration of DNA at specific sites, but there may be additions or deletions of bases at the insertion sites; while precise seamless insertion requires both site-directed and seamless and precise ligation at the insertion ends. The present invention distinguishes between the two, enabling the wide application of T-DNA site-directed insertion without being limited by the requirements of precise seamless ligation.

[0013] Further, in step S1, the egg cell-specific promoter is EC1.2 or the EC1.1-EC1.2 fusion promoter.

[0014] Further, in the step S1, the promoter in the promoter-driven fluorescent reporter gene is a pollen-specific expression promoter. The pollen-specific expression promoter sequence contains pollen-specific regulatory elements and can drive the gene to specifically express in the anther tissue.

[0015] Furthermore, the pollen-specific expression promoter is LAT52. LAT52 is a pollen-specific expression promoter. In the present invention, the pollen-specific pLAT52::GFP marker is added to the Cas9 vector to identify Cas9-free lines by fluorescence separation in pollen.

[0016] Further, in the step S2, the sgRNA promoter is the AtU6-26 or AtU3b promoter. The present invention further studies and finds that replacing the promoter of sgRNA with AtU6-26 or AtU3b can further improve the TI efficiency. The research results show that using the vector and method of the present invention, 30% of TI can be achieved in the resistant seedlings of Arabidopsis thaliana in the T1 generation, significantly improving the TI efficiency.

[0017] Further, the promoter in the promoter-driven resistance gene is the p35S promoter.

[0018] Furthermore, in the step S1, the promoter-driven resistance gene is the hygromycin resistance gene driven by the p35S promoter.

[0019] Further, the transformation method is the floral dip method.

[0020] The site-directed insertion method of long fragment DNA provided by the present invention can be used for: 1) ensuring the integration of transgenes at specific sites and avoiding the influence of chromosomal position on the expression of transgenes; 2) gene activation (gene activation tagging, AT): T-DNA site-directed insertion can be used to insert expression regulatory elements to regulate the spatial and temporal expression of genes. For example, setting the CaM35S promoter at the LB end of T-DNA can activate the expression of genes downstream of the insertion site; 3) male gamete-specific gene tagging (Malegermline-specific gene tagging, MT): Mutants of male gamete-specific genes can be obtained by DNA site-directed insertion, and the reporter gene carried by T-DNA is convenient for genetic analysis and in vivo tracking of specific cells. For example, setting a resistance reporter gene and a germ cell-specific expression fluorescent tag in T-DNA is used for genetic analysis of the insertion site and in vivo tracking of germ cells.

[0021] Therefore, the present invention also provides the application of the above method in gene activation or gamete-specific gene research.

[0022] Furthermore, when this method is used for gene activation, the sgRNA-target fragment is the sgRNA-enhanced promoter and is located inside the left border of the vector. T-DNA site-specific insertion can be used to insert expression regulatory elements to regulate the spatial and temporal expression of genes. To efficiently achieve gene activation, based on the characteristic that T-DNA tends to be connected to the plant genome at the LB end, by placing the CaM35S promoter inside the LB border of T-DNA, specific downstream genes can be activated, rather than the RB end in the traditional method, and gene activation plants can be obtained more efficiently. Using this method, the transcriptional expressions of FT and MYB26 were significantly activated, resulting in early flowering and changes in the secondary wall thickening pattern of the endothecium, respectively.

[0023] Furthermore, the enhanced promoter is the CaM35S promoter.

[0024] Furthermore, when this method is used for the study of gamete-specific genes, the sgRNA-target fragment is the sgRNA-marker gene, and the marker gene is a germ cell-specific expression fluorescent tag. A resistance reporter gene and a germ cell-specific expression fluorescent tag are set in T-DNA for genetic analysis of the insertion site and in vivo tracking of germ cells. For example: to achieve site-specific insertion of male gamete germ cell-specific genes, a kanamycin resistance screening marker for genetic analysis and a fluorescent protein marker for tracking male gametes are set inside T-DNA, and the two reporter genes NeoR and MGH3::mCherry are integrated into T-DNA. This design helps to obtain mutants of male gamete-specific genes, simplifies the genetic analysis of reproduction-related mutant alleles, and can track male gamete cells during fertilization. The method has been successfully applied to the mutant analysis and cytological study of the male gamete-specific gene GEX2. The results show that the method of T-DNA site-specific insertion mediated by CRISPR / Cas9 dependent on the non-homologous recombination pathway can rapidly and efficiently achieve site-specific insertion of large DNA fragments into the plant genome, making this method widely applicable in various applications.

[0025] Furthermore, the germ cell-specific expression fluorescent tag is a fluorescent reporter gene driven by a male gamete-specific gene.

[0026] Preferably, the germ cell-specific expression fluorescent tag is a fluorescent reporter gene driven by the male gamete-specific gene MGH3.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention provides a method and application of T-DNA site-directed insertion mediated by CRISPR / Cas9 and dependent on the non-homologous recombination pathway. By using the "two-step method" for transformation, first, the Cas9 expression vector is transformed into wild-type plants to obtain Cas9 transgenic plants; then, the sgRNA and the corresponding fragment (T-DNA) are introduced. Based on CRISPR / Cas9, site-directed breakpoints (DSBs) are generated to improve the DSB cleavage efficiency. The integration mechanism of non-homologous end joining of T-DNA is utilized to achieve the insertion of T-DNA into the site-directed DSB, thereby improving the efficiency of T-DNA site-directed insertion (TI). Since T-DNA can carry large fragments, the size limitation of the site-directed insertion fragment is overcome, solving the problems that traditional plant site-directed DNA insertion techniques rely on the inefficient homologous recombination repair pathway and that the prime editing technology cannot meet the need for large-fragment site-directed insertion. The present invention applies the above method to gene activation and male gamete-specific gene tagging. The results show that this method can rapidly and efficiently achieve site-specific insertion of large DNA fragments into the plant genome, activate downstream genes, and simplify the genetic analysis of reproductive-related mutant alleles. Therefore, the T-DNA site-directed insertion method mediated by CRISPR / Cas9 and dependent on the non-homologous recombination pathway provided by the present invention has wide applicability in various applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 To achieve CRISPR / Cas9-mediated T-DNA site-directed integration using the stepwise transformation method. Among them, Figure 1 A in is the construction of the Cas9 expression vector. The Cas9 gene is driven by the EC1.2 or EC1.1-EC1.2 fusion promoter to ensure its specific expression in egg cells. The vector contains a GFP marker driven by the LAT52 promoter to screen plants without Cas9 in subsequent generations, as well as a hygromycin resistance gene (HptR) for the first transformation screening; B is the construction of the pB2300EE vector, which contains a kanamycin resistance gene (NeoR) for the second transformation screening and an sgRNA expression cassette for targeting specific genomic sites; C is a schematic diagram of the stepwise transformation process. The pB2300EE vector is transformed into Cas9 transgenic plants. Cas9 binds to the sgRNA in egg cells (EC) to induce targeted DNA double-strand breaks (DSBs); GFP driven by the LAT52 promoter is expressed in pollen, which helps to identify Cas9 heterozygous transgenic plants and screen offspring without Cas9. Forward (F), reverse (R), and left border (Lb) primers are used to detect T-DNA site-directed integration.

[0030] Figure 2 is the map of the pEC1.1-1.2Cas9-LG vector. It is used to construct plants containing Cas9.

[0031] Figure 3 It is the map of the pEC1.2 Cas9-LG vector. It is used to construct plants containing Cas9.

[0032] Figure 4 It is the map of the pB2300EE vector. This vector is used for T-DNA site-directed insertion verification and can carry general target genes.

[0033] Figure 5 It is about the Cas9 transgenic lines and their integration in the Arabidopsis genome. Note: Three single-copy Cas9 transgenes are integrated on different chromosomes, and the transgene on chromosome 4 is truncated, lacking the pLAT52::GFP marker and the HptR gene.

[0034] Figure 6 It is the map of the pB2300EE-AT vector. This vector can be used for gene activation (activation tagging).

[0035] Figure 7 It is about gene activation achieved by T-DNA site-directed integration. Among them, Figure 7 A in it is the schematic diagram of the construction of the gene activation tag (AT), which contains the enhanced CaMV35S promoter located at LB, the sgRNA expression cassette, and the kanamycin resistance gene (NeoR). AT activates the target gene by inserting upstream of the open reading frame (ORF); B is the target sites designed for the FT and MYB26 genes; C shows that the AT plants for FT show an early flowering phenotype, and the randomly T-DNA integrated line #26 is used as a control, and lines #6, #15, #19, #23, #27, and #29 are AT plants; D is the statistical analysis of the number of rosette leaves of T2 generation plants. Among them, line #29 is sterile and no seeds are obtained; E-J are the anther non-dehiscence phenomenon, fluorescence, and electron microscope images of MYB26-T + / + plants, showing that the activation of MYB26 leads to abnormal thickening of the cell wall of the endothecium; E, F, and G show the wild type, and H, I, and J are MYB26-T + / + ; K is the real-time fluorescence quantitative PCR analysis of T2 generation plants, showing that compared with the wild type and the randomly inserted control #26, the expression levels of FT in the AT lines #15, #19, and #23 are significantly increased; L is the real-time fluorescence quantitative PCR analysis indicating that MYB26 is transcriptionally activated in AT plants, and the expression of its downstream target gene NST1 is up-regulated; #4 (LB direction is incorrect) and #23 (random T-DNA integration) are used as controls. Statistical significance analysis (calculated using Student's t-test): ns, no significance; ***P value ≤ 0.001; ****P value ≤ 0.0001.

[0036] Figure 8It is the map of the pB2300EE-MT vector. This vector is used to carry male germline-specific gene tagging.

[0037] Figure 9 It is for T-DNA site-directed insertion for male germline-specific gene tagging. Among them, Figure 9 In A, it is the schematic diagram of the construction of the male gametophyte-specific gene tag (MT), which contains the MGH3::mCherry reporter gene expressed in male gametophytes and the kanamycin resistance reporter gene (NeoR); B is the gene structure of GEX2, and T-DNA is directionally inserted into the fourth exon; C shows the GFP segregation in the pollen population of plant #17, indicating that this plant is a heterozygous Cas9 transgenic; D shows that the mCherry fluorescence segregation ratio in the pollen population is approximately 1:1 (652:673), indicating that line #17 contains a single-copy T-DNA integration at the GEX2 locus; E is the segregation ratio of the MT allele of GEX2 in self-crossed and hybrid offspring, and there is a significant difference between the expected value and the actual value when the MT transmission frequency is 100% (chi-square test, ****P value ≤ 0.001); F-G are semi-in vivo fertilization experiments showing sperm cells during pollen tube guidance and fertilization, and F and G show bright-field microscopy and mCherry fluorescence signals respectively; H-I are un-fused sperm cells 24 hours after pollination, MGH::mCherry fluorescence shows sperm cells (H), and pDD65::GFP expression fluorescence shows that the endosperm has divided; J is in the hybrid line, the heterozygous MT line (T + / - ) as the male parent and the randomly T-DNA inserted line (R + / - ) show a higher frequency of un-fused sperm cells compared. Data are from 3 or 4 siliques 24 hours after each cross pollination (**P value ≤ 0.01).

[0038] Figure 10 It is to identify T-DNA integration sites using discordant paired-end reads in the IGV software. Among them, Figure 5 In A, there is a discordance at the LB paired-end; B shows discordant paired-end reads at the GEX2 target site. Detailed implementation methods

[0039] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0040] Unless otherwise specified, the reagents and materials used in the following embodiments are all commercially available.

[0041] Example 1: Efficient Site-Specific Insertion of T-DNA into the Arabidopsis Genome Mediated by CRISPR / Cas9

[0042] I. Experimental Methods

[0043] 1. Construction of Vectors

[0044] (1) Construction of Cas9 Expression Vectors: The expression of Cas9 is driven by the fusion of the egg cell-specific promoter EC1.2 or EC1.1-1.2 to ensure its specific expression in egg cells. In addition, a pollen-specific pLAT52::GFP marker was added to the Cas9 vector to identify Cas9-free lines by fluorescence separation in pollen ( Figure 1 A, C). The construction method is as follows:

[0045] To obtain the Cas9 expression vector, the sgRNA cassette in the pHEE401E plasmid was removed, and a pLAT52::GFP reporter gene was introduced. The specific steps are as follows: First, the pHEE401E plasmid was digested with HindIII and SpeI, and the sgRNA cassette between these two sites was deleted and replaced with a multiple cloning site containing HindIII, KpnI, ApaI, NcoI, and SpeI, thus obtaining the PHEE401ED-M2 vector. Then, the pLAT52::GFP sequence was cloned into the HindIII and KpnI restriction sites to form the fCas9-LG vector (driven by the EC1.1-1.2 fusion promoter). The constructed vector map is as Figure 2 shown.

[0046] To obtain pEC1.2Cas9-LG, the EC1.1-1.2 fusion promoter of Cas9 in PHEE401ED-M2 was digested with KpnI and XbaI and replaced with the EC1.2 promoter to obtain the pEC1.2::Cas9 vector. Then, the pLAT52::GFP sequence was cloned into the SphI and KpnI restriction sites to obtain the pEC1.2::Cas9-LG vector. The constructed vector map is as Figure 3 shown.

[0047] (2) Construction of the pB2300EE Vector( Figure 1 B)

[0048] To construct pB2300EE, the BsaI site in the pCAMBIA2300 vector was first removed to generate the pB2300dB vector. Subsequently, the sgRNA cassette (primers M13-47 and A1205) was amplified from pHEE401E and cloned into the HindIII and PstI sites of pB2300dB, thereby generating the pB2300EE vector. The constructed vector map is shown in Figure 4 as follows.

[0049] (3) Modification of the sgRNA promoter

[0050] To explore the targeting effects of four promoters (AtU6-26, ATU6-1, AtU3b, and AtU3d) driving sgRNA, the promoters AtU6-1, AtU3b, and AtU3d, along with the sgRNA, were amplified by overlapping PCR and cloned into the HindIII and SpeI restriction sites of pB2300EE.

[0051] (4) Cloning of the target site into the pB2300EE vector

[0052] To clone the target sequence into the sgRNA cassette, the oligonucleotide pair of the target sequence was denatured at 95 °C for 5 minutes and then annealed at room temperature for at least 30 minutes. Subsequently, the annealed target oligonucleotide was cloned into the BsaI restriction site of the pB2300EE vector through the Golden Gate assembly system. The sequences used for cloning the CRY and GL2 target sites are as follows:

[0053] CRY-T-F: ATTGTGGAAGAAGAGGAGACTCA (SEQ ID No.1)

[0054] CRY-T-R: AAACTGAGTCTCCTCTTCTTCCA (SEQ ID No.2)

[0055] GL2-T-F: ATTGTCGGAGCATGAAGCCTGCA (SEQ ID No.3)

[0056] GL2-T-R: AAACTGCAGGCTTCATGCTCCGA (SEQ ID No.4)

[0057] 2. Floral dip method

[0058] The Agrobacterium tumefaciens strain GV3101 carrying the binary vector was cultured overnight with shaking at 28 °C in LB medium supplemented with antibiotics (50 μg / mL rifampicin and 50 μg / mL kanamycin). The Agrobacterium was collected by centrifugation at 4000 rpm for 8 minutes at room temperature and then resuspended in a solution containing 5% sucrose and 0.02% Silwet-77. The inflorescences of Arabidopsis thaliana were infiltrated with the Agrobacterium suspension and transformed again four days later. Wild-type Arabidopsis thaliana was used for the one-step transformation, and for the two-step transformation, the Cas9 expression vector was first transfected into wild-type Arabidopsis thaliana to obtain single-copy Cas9 transgenic Arabidopsis thaliana, and then the pB2300EE vector was transfected into the single-copy Cas9 transgenic Arabidopsis thaliana.

[0059] 3. Detection of Cas9 transgenic lines and TI efficiency

[0060] (1) The primers required for PCR detection of Cas9 transgenic lines are as follows:

[0061] site-1-LB: GGATCACTTAAGCGTCTTGC (SEQ ID No.5)

[0062] site-1-RB: AATTTCGGAATTTGGAGGCA (SEQ ID No.6)

[0063] For the C1b line (Cas9 inserted at AT4G02715)

[0064] site-2-LB: AGACTTTCAGGTTGTATCTG (SEQ ID No.7)

[0065] site-2-RB: GCATGTTAGTAATTTACCCG (SEQ ID No.8)

[0066] For the C1a line (Cas9 inserted at AT1G20450)

[0067] M1371-9 LP: TTTGGATTGATCATGTGTAAATGCCA (SEQ ID No.9)

[0068] M1371-9 RP: GGAAGAAACATTGCGCTGTAATC (SEQ ID No.10)

[0069] For the C2 line (Cas9 inserted at AT3G61500)

[0070] (2) The primers required for identifying single-copy Cas9 transgenic lines by SC-PCR are as follows:

[0071] HygR-qF: GACGTCTGTCGAGAAGTTTCTG (SEQ ID No.11)

[0072] HygR-qR: ACATATCCACGCCCTCCTAC (SEQ ID No.12)

[0073] R1-qF: TGATCAAGGGACGTTGCTTC (SEQ ID No.13)

[0074] R1-qR: TCGTCGGCCTATTAACACAATC (SEQ ID No.14)

[0075] R2-qF: ACCGACAACCACAGCTTCTATC (SEQ ID No.15)

[0076] R2-qR: ACCGAGACCATGTGAAGAGAAG (SEQ ID No.16)

[0077] (3) Detection of TI efficiency, the required primers are as follows:

[0078] CRY-TEST-F: CCACTGGTGCTTCTCAGATC (SEQ ID No.17)

[0079] CRY-TEST-R: CTGCGGTTCTTAGAGTATTCAAGC (SEQ ID No.18)

[0080] GL2-TEST-F: ACAGGCTATTCAAGAACGGCAC (SEQ ID No.19)

[0081] GL2-TEST-R: CGTCCATGAAACTCTGGGCAAG (SEQ ID No.20)

[0082] II. Experimental results

[0083] 1. The results are shown in Table 1. In the all-in-one transformation using the egg cell-specific promoter (EC1.2, EC1.1-1.2 fusion promoter) to drive Cas9, the TI efficiency was low, and no TI was found when driven by non-egg cell-specific promoters (CDC45, RBR1). It is speculated that the formation time of DNA double-strand breaks (DSBs) and the availability of free T-DNA are crucial for achieving targeted T-DNA integration (TI). It is speculated that during the all-in-one transformation of Arabidopsis using the floral dip method, the Cas9 and sgRNA genes are delivered simultaneously from the same binary vector. After multiple processes, including single-stranded T-DNA transfer, conversion of T-DNA into double-stranded, transcription, and translation, the Cas9 / sgRNA complex accumulates in the nucleus and begins to cleave the target sequence. A longer duration of these processes or a lower concentration of Cas9 / sgRNA may reduce the chance of coexistence of DSBs and free T-DNA, so the TI transformation efficiency of all-in-one transformation is low.

[0084] Table 1 Cas9 transgenic lines and TI efficiency

[0085]

[0086] Note: The numbers in parentheses in the table represent the number of Kan-resistant seedlings.

[0087] 2. To improve the TI efficiency, the two-step transformation method (sequential transformation) described by Miki et al. (2018, CRISPR / Cas9-mediated gene targeting in Arabidopsis using sequential transformation) was adopted. This method first obtains Cas9 transgenic lines, and then transfers the target sgRNA and target fragment into these Cas9 lines, where Cas9 expression is driven by the egg cell-specific promoter EC1.2 or EC1.1-1.2 fusion Figure 1 ). A pollen-specific pLAT52::GFP marker was added to the Cas9 vector to identify Cas9-free lines by fluorescence separation in pollen (the schematic flow chart is as shown in Figure 1 C). This strategy allows the pre-existence of Cas9 endonuclease when T-DNA enters the nucleus.

[0088] To simplify the genetic background of Cas9 transgenic lines, several single-copy transgenic Cas9 lines were identified using sandwich Ct real-time PCR (SC-PCR).

[0089] The sgRNA vectors targeting the CRY gene target sites were transformed into these lines, and it was found that two lines showed the highest TI efficiency in T1 plants, 27.6% and 17.2% respectively (Table 2), and these lines were named C1 and C2 respectively.

[0090] Table 2 Cas9 transgenic lines and TI efficiency

[0091]

[0092]

[0093] By adapter ligation-mediated PCR cloning of the flanking sequences, it was found that the Cas9 transgenes in lines C1 and C2 were located at AT1G20450 and AT3G61500 respectively ( Figure 5 ). To confirm the insertion sites of the Cas9 transgene in C1 plants, genome resequencing was performed, and the results showed that there were two insertion sites in line C1: one was located at AT1G20450, with a complete T-DNA copy, consistent with the AL-PCR identification; the other was located at AT4G02715, with a truncated T-DNA containing only the Cas9 gene ( Figure 5 ). Subsequently, these two insertion sites were separated and named C1a (inserted at AT1G20450) and C1b (inserted at AT4G02715) respectively. The different chromosomal locations of the Cas9 transgene helped to separate the target sites from the Cas9 gene, thus facilitating the selection of Cas9-free TI plants ( Figure 5 ).

[0094] For the target genes GL2 and CRY, the TI efficiencies of the one-step transformation (transforming wild-type plants) and the two-step transformation (transforming the above-mentioned C1 plants) methods were compared (while conducting the transformation experiments separately again), and the results are shown in Table 3. The two-step transformation using line C1 significantly improved the TI efficiencies of the two target sites.

[0095] Table 3 Stepwise transformation improves TI efficiency

[0096]

[0097] Note: The numbers in parentheses in the table represent the number of Kan-resistant seedlings.

[0098] To investigate whether the expression pattern of sgRNA in oocytes also affects the efficiency of DSB induction and thus the TI efficiency, the effects of four promoters (AtU6-26, ATU6-1, AtU3b, and AtU3d) driving sgRNA targeting CRY were compared. As shown in Table 4, different TI efficiencies were found, and the highest TI efficiencies were observed when using the AtU6-26 and AtU3b promoters. In summary, it was demonstrated that CRISPR / Cas9-mediated TI can be achieved rapidly and efficiently in T1 Arabidopsis thaliana, which may be used for a variety of applications.

[0099] Table 4 TI efficiencies of transformation with different sgRNA promoter sequences

[0100]

[0101] Note: The numbers in parentheses in the table represent the number of Kan-resistant seedlings.

[0102] Example 2 CRISPR / Cas9-mediated T-DNA targeted insertion for gene activation

[0103] I. Experimental methods

[0104] 1. Construction of the pB2300EE-AT vector

[0105] To construct pB2300EE-AT, the NeoR coding sequence downstream of the enhanced CaMV35S promoter in pB2300EE was deleted by replacing the truncated fragment located between the SacII and XhoI restriction sites, so that the enhanced CaMV35S promoter was directly adjacent to the LB sequence. Then, the antibiotic resistance reporter gene pNos::NeoR was amplified by overlapping PCR and cloned into the HindIII restriction site. The constructed vector map is as Figure 6 shown.

[0106] Target site annealing cloning sequences:

[0107] AT-MYB26-T-F: ATTGTCTAGAGAGAGAGAGAGGAT (SEQ ID No.21)

[0108] AT-MYB26-T-R: AAACATCCTCTCTCTCTCTCTAGA (SEQ ID No.22)

[0109] AT-FT-T1-F: ATTGTGTATTAGTGTGGTGGGTT (SEQ ID No.23)

[0110] AT-FT-T1-R: AAACAACCCACCACACTAATACA (SEQ ID No.24)

[0111] Detection target site insertion primer:

[0112] AT-MYB26-TEST-F: CACTCTCGTCTTCAGTGTGC (SEQ ID No.25)

[0113] AT-MYB26-TEST-R: CTTTCCACATCTCTGCAAAC (SEQ ID No.26)

[0114] AT-FT-TEST-F: TAAACTTGGCGGTACCCTAC (SEQ ID No.27)

[0115] AT-FT-TEST-R: GAAGGCCTTAGATCCAAGCC (SEQ ID No.28)

[0116] 2. Observation of cell wall and endothecium cells

[0117] To detect the secondary cell wall thickening in the MYB26 activation tag, anthers at stage 12 that had not flowered were observed under an epifluorescence microscope (RX50, Sunny Optical) using a DAPI filter. For electron microscopy observation, anthers were fixed in 4% glutaraldehyde and 2% paraformaldehyde (PFA) for 4 hours, then fixed overnight at 4 °C, and then fixed overnight at 4 °C with 1% osmium tetroxide. The fixed samples were dehydrated with ethanol and then embedded in Embed812 resin. Ultra-thin sections of 70 nm were stained with 3% uranyl acetate and lead citrate, and then observed and imaged using a transmission electron microscope (Talos L120C, Thermo Fisher Scientific) at 120 kV.

[0118] 3. Primers for qPCR detection of FT, MYB26 and NST1

[0119] FT-qPCR-R: GCGAGTGTTGAAGTTCTGGC (SEQ ID No.29)

[0120] FT-qPCR-F: TGGAACAACCTTTGGCAATGAG (SEQ ID No.30)

[0121] MYB26-qPCR-F: GAGGGCTTTGGTCACCTGAAG (SEQ ID No.31)

[0122] MYB26-qPCR-R: ACATCTCTGCAAACCTGCATG (SEQ ID No.32)

[0123] NST1-qPCR-F: TACAGCCGTCAATGAGAGCC (SEQ ID No.33)

[0124] NST1-qPCR-R: TTAAACCGGCGTGGTACGAA (SEQ ID No.34)

[0125] II. Experimental Results

[0126] Regulatory elements (such as promoters or enhancers) located at the T-DNA termini can significantly affect the expression patterns of genes adjacent to the insertion sites, and this principle forms the basis of gene activation tagging (AT). Gene activation tagging based on random T-DNA insertions aims to transcriptionally activate neighboring genes, thereby identifying candidate genes involved in specific developmental or signaling pathways.

[0127] Traditionally, gene activation tagging was to place multiple CaMV35S enhancers at the right border (RB) of the T-DNA. However, it has been reported that T-DNA insertions tend to ligate to plant genomic sequences at the left border (LB). A vector pB2300EE-AT was constructed with the CaMV35S promoter placed at the LB end ( Figure 7 A). In addition to the CaMV35S promoter, other promoters can also be used to regulate the expression of neighboring genes. In this study, the activation effects of TI on FT and MYB26 were verified.

[0128] FLOWERING LOCUS T (FT) encodes a key factor promoting flowering. A target site was designed 142 bp upstream of its start codon ( Figure 7 B). Six TI plants (20%) were obtained from 30 T1 transformants, and the T-DNA insertions at both ends of all plants were LB. Three of these plants (#15, #19, and #23) showed significantly increased FT expression levels ( Figure 7 K) and early flowering phenotypes ( Figure 7 C, D). No large fragment deletions were detected at the junction between the LB and the FT sequence, verifying the feasibility of placing the CaMV35S promoter at the LB end (plant sequences are as follows, with the T-DNA indicated by double underlines; the filler DNA by parentheses; the remaining LB and target site sequences by underlines; the microhomology highlighted by wavy lines; the start codon ATG in bold and italic; the deletion size provided in parentheses).

[0129] Wild-type FT sequence (including the target site and the start codon):

[0130] TTTGGAATATTTCCA GTGTATTAGTGTGGTGGGTTTGG aataccacaaacagaaat aaaaagaaagaaaaatatgaaataagacgacaatgtgtgatgtacgtagaatcagttttagattctagtacatcaatagacaa gaaaaagattgtggttatgatttcaccgacccgagttaATGCAA(SEQ ID No.35)

[0131] #15 sequence:

[0132]

[0133] #19 sequence:

[0134]

[0135] #23 sequence:

[0136]

[0137] MYB26 is a key transcription factor in the anther dehiscence pathway, regulating the secondary cell wall synthesis of the endothecium. Two target sites were designed upstream of the start codon ( Figure 7 B). For target site Ta, only one TI plant (3.3%) was obtained from 30 transgenic T1 plants. For target site Tb, 9 TI plants (30.0%) were obtained from 30 transgenic plants. Among them, the two ends of the T-DNA insertion in 6 plants were LB, while the LB insertion direction of the remaining 3 plants was away from the MYB26 coding region. Since target site Tb is close to the start codon, deletions occurred at the start codon in four TI plants, leaving only plants #6 and #24 with a complete start codon (the plant sequences are as follows, the T-DNA is represented by double underlines; the filler DNA is represented by parentheses; the remaining LB and target site sequences are represented by underlines; the start codon ATG is shown in bold and italic; the deletion size is provided in parentheses).

[0138] Wild-type MYB26 sequence (including the target site and the start codon):

[0139] aacattcttagagagagactaagagagcgatagaga tctagagagagagagaggATGGGTCATCACTCATGCTGCAACAAGCAAAAGGTGAAGAGAGGGCTTTGGTCACCTG(SEQ ID No.39)

[0140] #6 sequence:

[0141]

[0142] #24 sequence:

[0143]

[0144] In these two plants, the expression of MYB26 in leaves was significantly up-regulated ( Figure 7 L). MYB26 is involved in the secondary wall thickening of the endothecium by regulating the expression of NST1. Correspondingly, NST1 in the leaves of these two plants was also up-regulated, confirming the relationship between MYB26 and NST1 ( Figure 7 L). From the T2 progeny, homozygous TI plants (Myb26-T + / + ) were isolated, and unexpectedly, it was found that the anthers of these plants did not dehisce, resulting in sterility ( Figure 7 E, H). In the endothecium of Myb26-T + / + plants, the pattern of cell wall thickening was different from that of the wild type ( Figure 7 F, I). Transmission electron microscopy further showed that the cell walls of some endothecium cells were invaginated, while some cells showed a collapsed cell wall structure ( Figure 7 G, J). These phenotypes indicate that the secondary cell wall thickening of the endothecium in wild-type Arabidopsis is finely regulated by MYB26. Inserting the CaMV35S promoter upstream of the MYB26 coding region changed its expression pattern, resulting in a change in the pattern of cell wall thickening.

[0145] These results indicate that targeted insertion of T-DNA can be achieved quickly and efficiently in Arabidopsis T1 transformants and can be used to regulate gene expression patterns.

[0146] Example 3 CRISPR / Cas9-Mediated T-DNA Site-Specific Insertion for Male Germline-Specific Gene Marking

[0147] I. Experimental Methods

[0148] 1. Construction of the pB2300EE-MT Vector

[0149] To construct pB2300EE-MT(X1374), overlap PCR was used to fuse MGH3 (AT1G19890) and the mCherry gene to obtain the MGH3::mCherry sequence, which was then cloned into the EcoRI restriction site of pB2300EE using the In-Fusion cloning method (TOLOBIO, #24308). The constructed vector map is as shown in Figure 8 shown below.

[0150] Target site cloning sequence:

[0151] MT-GEX2-T2-F: ATTGTTACACCAGAAAGATCGCTT (SEQ ID No.42)

[0152] MT-GEX2-T2-R: AAACAAGCGATCTTTCTGGTGTAA (SEQ ID No.43)

[0153] T-DNA site-directed insertion detection primers:

[0154] MT-GEX2-TEST-F: TTCCGAAGGATGCATTCGGG (SEQ ID No.44)

[0155] MT-GEX2-TEST-F: GAGAAGCCAAGAGACTCCCC (SEQ ID No.45)

[0156] 2. In planta or in style fertilization experiments

[0157] The in planta fertilization test was carried out as follows: A pollen germination medium (0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4, 18% sucrose and 1% low melting point agarose) was prepared in a 35-mm confocal dish (MatTek, USA). Arabidopsis thaliana flowers were emasculated one day before the experiment. The stigmas of the flowers were cut off and placed on the medium. Several mature but unfertilized ovules were dissected out and transferred to the medium about 500 μm away from the stigma. Approximately 20 mature pollen grains were placed on the stigma, and then the samples were placed in the dark at 23 °C. Pollen tubes grew out from the cut ends of the stigmas within 2 to 3 hours and penetrated the micropyle about 4 hours after artificial pollination. For the in vivo fertilization experiment, emasculation was carried out in the same way, and the ovules were dissected and observed 24 hours after pollination.

[0158] II. Experimental results

[0159] Identifying gamete-specific genes is crucial for understanding sexual reproduction in flowering plants. Using T-DNA-directed insertion to achieve male germline-specific gene tagging (MT), inserting T-DNA carrying the kanamycin resistance gene (NeoR) and the MGH3::mCherry reporter gene into male germline-specific genes to create site-specific insertion mutations helps simplify the genetic analysis of mutant alleles and can be used for visual tracking of male germline cells during fertilization. Its vector map is as shown in Figure 9 Figure A. For this purpose, this technique requires isolating Cas9-free heterozygous TI lines (T + / - ), where one allele of these lines contains TI while the wild-type allele is retained in the other allele, as shown in Figure 9 Figure B.

[0160] Heterozygous C1a plants were transformed with the GEX2 gene, which encodes a sperm cell-specific membrane protein involved in the recognition of sperm cells with egg cells or central cells. From 30 T1 plants, two MT plants, #8 and #17, were obtained, accounting for 6.67% (the plant sequences are as follows, the T-DNA is represented by double underlines; the filler DNA is represented by parentheses; while the remaining LB and target site sequences are represented by underlines; the microhomology is highlighted by wavy lines; the deletion size is provided in parentheses).

[0161] Wild-type GEX2 sequence (including the target site):

[0162] TAAGCACATGGCAGATATTTTCCAAAATGGAGATCTTG TTACACCAGA AAGATCGCTTGGG GAACATTGTTTC (SEQ ID No.46)

[0163] #8 sequence:

[0164]

[0165] #17 sequence:

[0166]

[0167] #17 was determined to be a Cas9 heterozygous plant by the segregation of pollen pLAT52::GFP fluorescence ( Figure 9 Figure C). PCR and Sanger sequencing showed that the #17 line was a heterozygous plant with TI insertion, containing one gex2 allele with T-DNA insertion and one wild-type GEX2 allele. Then, Cas9-free heterozygous TI plants (gex2-T were selected from the T2 offspring of the #17 line+ / - )。gex2-T + / - The mCherry fluorescence in the pollen of the plant was as Figure 9 shown in D, and the segregation ratio was 1:1 (652:673), indicating that there might be only one T-DNA integration site in its genome. Genome resequencing further confirmed that there were no other T-DNA integration sites except GEX2 ( Figure 10 ).

[0168] To study the genetic transmission mode of the gex2-T + / - allele, the gex2-T + / - plants were self-crossed, and the gex2-T + / - and wild-type Col-0 plants were reciprocally crossed. As Figure 9 shown in E, the self-crossed progeny showed a skewed segregation ratio of kanamycin resistance (1.25:1), rather than the expected 3:1. In the reciprocal cross, the gex2-T+ allele could not be inherited by the progeny through paternal pollen, while maternal inheritance was not affected. This skewed segregation ratio indicates that the gex2-T+ allele causes abnormal male gametophyte function. Through the MGH3::mCherry reporter gene carried by the MT plants, the dynamic process of male gametes during fertilization can be observed. Through semi-in vivo ( Figure 9 F, G) or in-style fertilization experiments ( Figure 9 H, I) observations, although the gex2-T+ pollen has a normal sperm cell morphology, there are defects in the fusion of sperm cells with egg cells or central cells, manifested as an increase in the proportion of unfused sperm cells 24 hours after pollination ( Figure 9 J).

[0169] Therefore, the MT technology simultaneously achieves targeted insertional mutagenesis, simplifies genetic analysis, and tracks germline cells in vivo, providing a valuable tool for understanding the mechanisms of male gametophyte-specific genes.

Claims

1. A method for site-directed insertion of T-DNA mediated by CRISPR / Cas9 and dependent on the non-homologous recombination pathway, characterized in that, The method comprises the following steps: S1. Obtaining Cas9 transgenic plants: transforming a wild-type plant with a Cas9 expression vector and screening to obtain single-copy Cas9 transgenic plants; the Cas9 expression vector sequentially comprises, from the right border to the left border, a fluorescent reporter gene driven by a promoter, a Cas9 gene driven by an egg cell-specific promoter, and a resistance gene driven by a promoter; the structure of the vector is LB - resistance gene - promoter - Cas9 - egg cell-specific promoter - fluorescent reporter gene - promoter - RB; S2. Obtaining T-DNA site-directed insertion plants: transforming the Cas9 transgenic plants with a pB2300EE vector and screening to obtain T-DNA site-directed insertion plants; the pB2300EE vector comprises an sgRNA - target fragment for targeting a specific genomic locus driven by an sgRNA promoter and a resistance gene driven by a promoter; the target fragment is a marker gene or an enhanced promoter.

2. The method according to claim 1, wherein In step S1, the egg cell-specific promoter is EC1.2 or an EC1.1 - EC1.2 fusion promoter.

3. The method according to claim 1, characterized in that, In step S1, the promoter in the fluorescent reporter gene driven by a promoter is a pollen-specific expression promoter.

4. The method according to claim 1, wherein In step S2, the sgRNA promoter is the AtU6-26 or AtU3b promoter.

5. The method according to claim 1, characterized in that, In steps S1 and S2, the promoter in the resistance gene driven by a promoter is the p35S promoter.

6. The method according to claim 1, wherein The transformation method is the floral dip method.

7. Use of the method according to any one of claims 1 to 6 in gene activation or gamete-specific gene research.

8. The application according to claim 7, wherein When the use is for gene activation, the enhanced promoter is located inside the left border of the vector.

9. The application according to claim 7, wherein When researching gamete-specific genes, the marker gene is a germ cell-specific expression fluorescent tag.

10. The method according to claim 8, wherein The germ cell-specific expression fluorescent tag is a fluorescent reporter gene driven by a male gamete-specific gene.