Construction method of genetically modified vertebrate capable of simultaneously generating sex-specific sterility and fertility and application of genetically modified vertebrate in persistent population control

Abstract

The invention relates to the technical field of biology, in particular to a construction method of transgenic vertebrates with sex specific sterility and fertility simultaneously and application of the transgenic vertebrates in persistent population control. According to the construction method, a sex-specific sterile gene is taken as a target gene, and a transgenic technology is utilized to enable a targeted mutagenesis system to be continuously expressed and stably inherited in vertebrates, so that the sex-specific sterile gene function is inactivated, a sex-specific sterile phenotype and a fertile phenotype are generated at the same time, and then the sex-specific sterile phenotype and the fertile phenotype are applied to persistent population control. The invention creates a population inhibition method with stable inheritance (sustainable effect) and strong universality (especially applicable to vertebrates such as fish), so that the vertebrates can induce inheritable sex-specific sterility in a target population, thereby realizing continuous and specific population inhibition.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a method for constructing a transgenic vertebrate with simultaneous sex-specific sterility and fertility, and its application in sustainable population control. Background Art

[0002] Population control is an important requirement in fields such as agriculture and ecology. On the one hand, the safety of genetically modified crops and animals is an important monitoring index in the genetically modified breeding industry. It is crucial to ensure the controllable breeding of genetically modified species and prevent the large-scale accidental spread of genetically modified species through population control technology. This can not only protect the wild population gene pool from genetic pollution but also effectively protect the intellectual property rights of genetically modified species. On the other hand, the invasion of alien organisms has become one of the serious ecological problems. Traditional control methods, such as trapping and poisoning, are very limited in their effectiveness against target harmful species and can cause accidental injuries to non-target species. Currently, there is a serious lack of specific and effective population control / suppression technologies.

[0003] Invasive species are an increasingly serious problem worldwide, causing extensive damage to the ecological environment, economy, and health. With the improvement of people's living standards, the expansion of their activity ranges, and the increase in social interactions, invasive species are increasingly threatening people's normal lives. Among them, invasive fish can also cause economic and social damage. If important commercial fisheries are damaged, invasive fish will cause income losses to fishermen and other industries related to fisheries. Therefore, the harm of invasive fish should be taken seriously enough. Invasive fish may also affect the food security of communities that rely on fishing for a living, thus posing a further risk of social chaos.

[0004] Traditional methods for controlling invasive species are generally divided into two types: physical (barriers and traps) and chemical (poisons). For invasive fish, dams are usually used to prevent the spread of invasive populations. Although dams are very beneficial for power generation and flood control, they may have various huge negative impacts on the downstream ecology. Dams and other physical barriers are not selective and affect both invasive fish and native fish; the reproduction of some native fish requires migration, and dams may have a devastating impact on these fish. Chemical control, such as repellents and poisons, may be effective in some cases, such as the control of lampreys in the Great Lakes of the United States by chemical poisons. However, chemical poisons generally lack a high degree of specificity and thus also cause damage to many native species. In comparison, biological control methods for invasive species can target specific species without affecting others, so they are a very promising class of methods.

[0005] The biological control methods for invasive species reported so far are very limited. The Sterile Male Release Technique (SMRT), also known as the Sterile Insect Technique (SIT), is one of the relatively mature techniques and has been widely used in the targeted control of agricultural pests. The SMRT technique disrupts the normal reproduction of a target insect population by releasing a large number of artificially sterilized insects into the population. These sterile insects compete with wild insects for breeding opportunities, thus reducing the number of successful reproduction events and leading to a decrease in the number of offspring in the population. Repeatedly releasing a large number of artificially sterilized insects into the population may eventually lead to population collapse and thus completely eliminate harmful insects. The SMRT technique has achieved several successful applications in the control of agricultural pests. However, this technique requires the preparation of a large number of sterilized organisms in multiple batches through radiation, so it is only applicable to relatively small insects and is difficult to apply to species that cannot be reared in large numbers in the laboratory and cannot be sterilized by irradiation. In addition, the effect of the sterilized individuals produced by the SMRT technique only lasts for one generation, and their sterile characteristics cannot be passed on to the offspring. Therefore, it is necessary to repeatedly release sterilized individuals into the target population to effectively control the size of the population. For species with a wide or complex and variable natural living environment, repeatedly releasing sterilized individuals into the same population is obviously a challenge and there is a great deal of uncertainty. For example, among vertebrates, the United States once tried to use the SMRT technique to control the sea lamprey invading the Great Lakes, but had to give up eventually because it was unable to produce a sufficient number of sterile sea lampreys.

[0006] Recently, a method for controlling mosquitoes through genetic modification, called self-sexing, has been reported. They utilized doublesex the property of sex-specific alternative splicing of genes to enable the cytotoxic gene to be expressed only in female offspring, thereby selectively killing all female offspring of transgenic male mosquitoes. Smidler et al. developed another transgenic-based confinable female lethal strategy, creating a gene femaleless with fle)(Mutations occur, resulting in only male offspring being able to survive, thereby controlling the mosquito population. They named this strategy Ifegenia (inherited female elimination by genetically encoded nucleases to interrupt alleles). However, both of these strategies require a gene with sex-specific alternative splicing and the other requires a sex-specific mutant lethal gene. These two genes have been studied more in insects and lack sufficient research in other species. Therefore, their applications are also limited to insects.)

[0007] In summary, there is still a lack of reports on population control technologies achieved through transgenic techniques in vertebrates.) Summary of the Invention

[0008] The present invention provides a method for constructing a transgenic vertebrate that simultaneously exhibits sex-specific sterility and fertility, comprising: using a sex-specific sterility gene as a target gene, and allowing a targeted mutagenesis system to continuously express and stably inherit in a vertebrate by means of transgenic technology, resulting in the inactivation of the sex-specific sterility gene function, and simultaneously producing a sex-specific sterility phenotype and a fertility phenotype.)

[0009] The targeted mutagenesis system of the present invention includes, but is not limited to, the CRISPR / Cas system, the TALEN system, or the ZFN system.)

[0010] In the CRISPR / Cas system, Cas includes, but is not limited to, Cas9 or Cas12.)

[0011] Preferably, the CRISPR / Cas system is the CRISPR / Cas9 system.)

[0012] Preferably, the construction method includes: designing a gRNA targeting the sex-specific sterility gene, and integrating the Cas9 / gRNA expression system into the genome of a vertebrate individual by means of transgenic technology, so as to utilize the Cas9 / gRNA system to continuously express and stably inherit in the vertebrate, resulting in the inactivation of the sex-specific sterility gene function, and simultaneously producing a sex-specific sterility phenotype and a fertility phenotype.)

[0013] Based on the CRSIPR / Cas transgenic system, the present invention targets a sex-specific sterility gene to achieve heritable sex-specific sterility in a target species, so as to achieve the purpose of population control.)

[0014] The inactivation of the present invention includes, but is not limited to, gene function inactivation caused by gene mutations.)

[0015] The mutations of the present invention include, but are not limited to, indel mutations.)

[0016] In the present invention, the sterile phenotype can result from sex-specific traits or abnormal gonadal development, or the inability to generate functional gametes, or the inability of the offspring to develop (e.g., maternal embryonic lethality).

[0017] In some embodiments, the sex-specific sterility gene is a female sterility gene, which results in a maternal embryonic lethality phenotype.

[0018] In some embodiments, the sex-specific sterility gene is a female sterility gene Nucleoplasmin 2b (npm2b) or Npm2 、 NMP2 whose inactivation leads to a maternal embryonic lethality phenotype.

[0019] Wherein, npm2b is a zebrafish female sterility gene, Npm2 or NMP2 is npm2b a homologous gene in other species, and the homologous gene and npm2b have the same gene function, that is, mutation / inactivation of both will result in a maternal embryonic lethality (female sterility) phenotype.

[0020] Since the gene names in different animals are slightly different, those skilled in the art should understand that genes with the same gene function represented by different gene names in all species are equivalent alternative embodiments and are all within the scope of protection required by the present invention.

[0021] This gene has a typical maternal effect. The npm2b gene expression products from oocytes are crucial for the development of zebrafish fertilized eggs and early embryos. Once these maternal gene expression products are absent, it will lead to the death of early embryos within 24 hours after fertilization.

[0022] In some embodiments, the target site sequence of the Cas9 / gRNA system is as shown in SEQ ID No.1 or its complementary sequence, and the PAM is TGG.

[0023] In the present invention, a Cas9 / gRNA target site that can efficiently generate mutations (~80% indel efficiency) was screened on the 4th exon, and the 20-bp target site sequence is: TTCAGGCGAAAGGTCACCGG, and the PAM is TGG. npm2b

[0024] In some embodiments, the nucleotide sequence of Cas9 mRNA is as shown in SEQ ID No.2; the nucleotide sequence of gRNA is as shown in SEQ ID No.3.

[0025] In some embodiments, a RNA polymerase II pan - expression promoter is utilized to drive the continuous expression of Cas9 endonuclease.

[0026] In some embodiments, a RNA polymerase III pan - expression promoter is utilized to drive the continuous expression of a gRNA targeting the sex - specific sterility gene.

[0027] Preferably, the RNA polymerase II pan - expression promoter is ACTB1 (actin, beta 1) ; and the RNA polymerase III pan - expression promoter is rnu6-32 (small nuclear RNA 32 U6, referred to as U6) .

[0028] In some embodiments, the specific steps of the construction method include: Construct a donor plasmid containing a promoter - driven pan - expression of Cas9 and a promoter - driven pan - expression of a gRNA expression cassette targeting the sex - specific sterility gene, introduce the donor plasmid into a vertebrate fertilized egg, and after screening, obtain transgenic vertebrates with stable inheritance of sex - specific sterility and fertility simultaneously.

[0029] In some embodiments, the specific steps of the construction method include: Construct a donor plasmid containing a promoter - driven pan - expression of Cas9 and a promoter - driven pan - expression of a gRNA expression cassette targeting the sex - specific sterility gene, introduce the donor plasmid into a vertebrate fertilized egg, and at the same time introduce Cas9 mRNA and a gRNA targeting the site - specific integration gene and the site for in - vivo linearization of the donor plasmid into the vertebrate fertilized egg, integrate the donor plasmid into the site - specific integration gene, and after screening, obtain transgenic vertebrates with stable inheritance of sex - specific sterility.

[0030] In some embodiments, the promoter driving Cas9 is actb1; the promoter driving the gRNA targeting the sex - specific sterility gene is rnu6 - 32.

[0031] Preferably, the sequence of the promoter actb1 is as shown in SEQ ID No.9; the sequence of the promoter rnu6 - 32 is as shown in SEQ ID No.10.

[0032] In some embodiments, the sequence of the donor plasmid is as shown in SEQ ID No.4.

[0033] When targeting gRNAs for different specific sterility genes, the gRNA sequence in the donor plasmid shown in SEQ ID No.4 can be replaced.

[0034] In some embodiments, the site - specific integration gene is tyr ( Tyrosinase ) gene.

[0035] In some embodiments, the site for in vivo linearization of the donor plasmid is hEMX1.

[0036] In some embodiments, the gene for targeted site-specific integration tyr and hEMX1 the sequences of the gRNAs are shown in SEQ ID No. 11 and SEQ ID No. 12, respectively.

[0037] In some embodiments, the introduction method includes but is not limited to microinjection.

[0038] In some embodiments, the sex-specific sterility is female sterility.

[0039] In some embodiments, the vertebrates include fish, amphibians, reptiles, birds, and mammals.

[0040] Preferably, the fish can be carp, mosquito fish; the amphibians can be bullfrogs; the reptiles can be red-eared turtles; the birds can be pigeons; the mammals can be mice, North American minks.

[0041] In some embodiments, the vertebrate is a fish, and more preferably a zebrafish.

[0042] Those skilled in the art can reasonably infer that all embodiments of the present invention are also equally applicable to other species except fish. The present invention selects zebrafish only as a commonly used model animal for illustration, and does not constitute a limitation to the core inventive concept of the present invention.

[0043] The construction method described in any of the above embodiments of the present invention does not involve the purpose of disease diagnosis or treatment.

[0044] In some embodiments, the construction method of the sex-specific sterile transgenic vertebrate can be used as a construction method for animal models.

[0045] Furthermore, the present invention provides the application of the construction method described in any of the above embodiments and the transgenic vertebrates constructed thereby in population control.

[0046] Furthermore, the present invention provides a continuous vertebrate-specific population control method, including: using the construction method described in any of the above embodiments to simultaneously obtain sex-specific sterile and fertile transgenic vertebrates, and then releasing them into the target population. The fertile transgenic vertebrates of the fertile sex can continuously transmit the transgenic system to the offspring, so that the sex-specific sterile phenotype can be continuously transmitted or spread in the target population.

[0047] Compared with the prior art, the beneficial effects of the present invention are as follows: Compared with the SMRT technology, the present invention effectively achieves heritable sex-specific sterility in species other than insects by constructing Cas9 / gRNA transgenic vertebrates that can sustainably express target sex-specific sterility genes, making the population suppression effect sustainable, without the need to repeatedly release sterile individuals into the target population as in the SMRT technology.

[0048] Compared with the two recently reported transgenic-based species suppression technologies, self-sexing and Ifegenia, the present invention selects sex-specific sterility genes with species conservation as target genes, overcoming the limitations in gene selection and species limitations of the above technologies. Therefore, the technology established by the present invention has universality and can be easily extended to other species. There is theoretically no species limitation, and it is most likely to become a general population control technology.

[0049] In addition, the target genes selected by the present invention are sex-specific sterility genes, rather than the sex-specific lethal genes selected by the self-sexing and Ifegenia technologies. The sex-specific lethal genes simply prevent sex-specific individuals from surviving, while the sex-specific transgenic individuals of the present invention, although sterile, can still survive and can still compete with wild-type fertile same-sex individuals for mating. In this way, they can not only fail to produce offspring, but also reduce the mating opportunities of wild-type same-sex individuals through mating competition, which is more conducive to achieving population control. Therefore, in terms of the efficiency of population control, the present invention is more superior to the self-sexing and Ifegenia technologies.

[0050] In summary, the present invention has created a population suppression method with stable inheritance (sustainable function) and strong universality (especially applicable to vertebrates such as fish), enabling vertebrates to induce heritable sex-specific sterility in the target population, thereby achieving continuous and specific population suppression. Brief Description of the Drawings

[0051] Figure 1 It is a schematic diagram of the heritable sex-specific reproductive blocking strategy (HMEL) provided by the present invention; among them, on the left: the donor plasmid carries actb1 the Cas9 driving pan-expression and U6 the gRNA driving pan-expression targeting the maternally lethal maternal effect gene (for example npm2b ), and the expression cassette is targeted and integrated into the zebrafish genome through the Cas9 / gRNA system. The Cas9 / gRNA- npm2b transgene (referred to as HMEL allele) is stably expressed in zebrafish and can effectively cause the target gene of maternal lethality ( npm2b ) mutations and inactivation; Right: Offspring produced by female fish (red) carrying HMEL the HMEL allele are non-viable, while male fish (yellow) have normal fertility and can pass on this allele to their offspring, enabling it to continue to function; WT: Wild type.

[0052] Figure 2 is the experimental result diagram showing that the HMEL transgene can efficiently induce mutations in the npm2b target gene and produce a heritable maternal lethal effect; Among them, A. A highly active CRISPR target site was identified in exon 4, the PAM was underlined, and the AgeI restriction enzyme site was indicated in bold; B. Somatic (caudal fin) mutations at the npm2b target site in F1 HMEL adult fish were identified by AgeI digestion, WT: Wild type; C. Fish carrying npmb2 the HMEL allele developed into npm2b chimeric mutants; D. Survival of offspring embryos from outcrossing of F1 HMEL heterozygotes; E. The upper figure shows the development of offspring at 24 hpf from outcrossing of HMEL heterozygous female fish (abnormal development); The lower figure shows normal development of offspring at 24 hpf from outcrossing of HMEL male fish, scale bar: 1 mm; F. Genotyping of single embryos (6 dpf) at the npm2b target site by AgeI digestion.

[0053] Figure 3 is the construction and phenotypic analysis of zebrafish npm2b mutants; A. The CRISPR target sequence is shown underlined in black in the WT npm2b sequence, and the AgeI site is marked with a red box. The black arrow in Mutant npm2b -1 indicates the deletion of 1 base (G), and this base deletion causes a frameshift mutation and the appearance of a premature stop codon, resulting in the npm2b mutant producing a non-functional truncated protein of only 102 aa; B. Genotyping of npm2b by AgeI digestion; C. npm2b Homozygous mutant female fish are sterile (unable to produce viable embryos).

[0054] Figure 4 is a schematic diagram of the tyr gene and the HMEL vector knock-in target site; Among them, the PAM sequence is underlined in the upper figure, and the interface PCR sequencing result in the lower figure proves that the HMEL vector has undergone the expected targeted integration at the tyr site.

[0055] Figure 5 is a comparison diagram of the HMEL strategy and SMRT of the present invention. Detailed implementation mode

[0056] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Apparently, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present invention without making creative efforts fall within the protection scope of the present invention. In the embodiments provided in this specification, for those without specific technical or conditions indicated, the techniques or conditions described in the literature in the art are followed, or the product specifications are followed. For reagents or instruments without the manufacturer indicated, they are all conventional products that can be obtained through regular channels of commercial suppliers.

[0057] Example 1. Identification of target genes with maternal embryonic lethal phenotypes In this example, zebrafish genes that can cause maternal embryonic lethal phenotypes after gene mutation are selected npm2b For the gene, 3 target sites that meet the working conditions of Cas9 / gRNA are selected in the coding region of the npm2b gene. mRNA and the corresponding gRNA are synthesized by in vitro transcription, and then they are simultaneously microinjected into zebrafish fertilized eggs (single-cell stage zebrafish embryos). At 24 hpf (hours post-fertilization), genomic DNA is extracted to perform PCR amplification on the target site sequences and the indel mutagenesis efficiency is detected by Sanger sequencing. Finally, a Cas9 / gRNA target site that can efficiently generate indel mutations is screened on the 4th exon (with an indel efficiency of ~80%). The 20-bp target site sequence is: TTCAGGCGAAAGGTCACCGG (SEQ ID No.1), and the PAM is TGG ( Cas9 A). The gRNA designed for this target site sequence is shown in SEQ ID No.3, and the nucleotide sequence of Cas9 mRNA is shown in SEQ ID No.2. Further, the F0 embryos injected with this target site Cas9 / gRNA are raised, and a batch of npm2b F1 embryos carrying a 1-bp deletion mutation are screened from a single F0 male fish through outcrossing, thereby establishing an Figure 2 indel mutant fish line. Self-crossing of F1 heterozygotes yields F2 mutant homozygotes, all of which can survive normally. The homozygous mutant female fish ( npm2b -1 / -1 npm2b ), after outcrossing with wild-type male fish, the embryos produced all failed to survive when they developed to 24 hpf, proving that npm2b -1 / -1 inactivation can indeed lead to maternal embryonic lethal effects and female sterility phenotypes ( npm2b A, Figure 3 A, Figure 3 B and Figure 3 C), which is consistent with the expectation; npm2b The homozygous mutant male fish can reproduce normally. The above results indicate that npm2b is a suitable target gene that can cause female sterility phenotype and can be used to attempt the population suppression strategy of the present invention. In addition, the nucleoplasmin gene family has strong species conservation in vertebrates (including mammals). Selecting this gene can easily extend the strategy of the present invention to other species, highlighting the species generality of the strategy of the present invention.

[0058] Example 2. Construction of a heritable maternal embryonic lethal transgenic zebrafish line Subsequently, the present invention constructed a donor plasmid carrying actb1: Cas9 expression cassette and rnu6-32:gRNA-npm2b expression cassette by restriction enzyme digestion-ligation molecular cloning technology. The sequence of the donor plasmid is shown in SEQ ID No.4. It was introduced into zebrafish fertilized eggs by microinjection, and by co-injecting Cas9 mRNA and targeting tyr ( Tyrosinase ) and hEMX1 (for in vivo linearization of the donor plasmid) gRNAs (shown in SEQ ID No.11 and SEQ ID No.12 respectively), the plasmid was site-specifically integrated into the tyr gene through the non-homologous end joining (NHEJ) pathway, and then a stably heritable Cas9 / gRNA- npm2b transgenic fish line (HMEL fish line) was obtained through screening, and correct targeted insertion was confirmed by junction PCR and sequencing ( Figure 4 ). The primer sequences of junction PCR are shown in SEQ ID No.5 and SEQ ID No.6 respectively, 5’- GCGTCTCACTCTCCTCGACTCTTC -3’, (SEQ ID No.5), 5’- GCCCTCCCGTATCGTAGTTATC -3’ (SEQ ID No.6), and the PCR program is: 95℃, 5 min; (95℃, 30 s; 60℃, 30 s; 72℃, 30 s) x 32 cycles; 72℃, 5 min. The plasmid construction here all adopts standard molecular cloning techniques and common DNA sequences, so it is very beneficial to the popularization and use of the present invention.

[0059] Example 3. The HMEL fish line can efficiently induce npm2b mutations in the target gene To confirm the HMELThe activity of the transgene, generated in the outcross of F0 in this example HMEL In the heterozygous F1 adult fish, genomic DNA was extracted from the caudal fin tissue, and PCR amplification npm2b was performed at the locus and the PCR product was digested with AgeI enzyme (cutting npm2b the target site) to detect npm2b the mutation efficiency of the locus. Primer sequences: 5’-AACTGGAGGAACTGATGGACCAAG-3’ (SEQ ID No.7), 5’-TCTTAACAGGCGATTCTTCGATATCTTC-3’ (SEQ ID No.8); PCR program: 95°C, 5 min; (95°C, 30 s; 60°C, 30 s; 72°C, 30 s) x 32 cycles; 72°C, 5 min; AgeI digestion conditions: 1 μg of purified PCR product, 2 μL of CutSmart buffer (NEB), 1 μL of AgeI-HF enzyme (NEB); digestion volume was 20 μL, reaction at 37°C for 2 h.

[0060] The results showed that all 7 F1 HMEL heterozygotes npm2b showed high-efficiency indel mutations in somatic cells (average 95.0%, SD 5.6%) ( Figure 2 B). Since the fertilized eggs generated by outcrossing HMEL will at least obtain one wild-type npm2b allele from the wild-type parent (= the proportion of wild-type alleles in the initial fertilized eggs is at least 50%), and the npm2b mutation rates observed in the adult fish grown from the fertilized eggs in this example were all > 50% ( Figure 2 B), which indicates that during embryonic development, HMEL the allele can effectively induce npm2b mutations in zebrafish ( Figure 2 C). Theoretically HMEL the heterozygote can produce four different genotypes of gametes: carrying wild-type or mutant npm2b alleles, and carrying or not carrying HMEL the allele ( Figure 2 C). Therefore, HMEL after the heterozygote is crossed with the wild-type fish, four different genotypes of offspring can be produced: two non-inherited HMEL embryos, which have a stable genotype throughout development ( HMEL - / - npm2b + / + or HMEL - / - npm2b + / - ); Two embryos that have inherited HMEL (heterozygous) HMEL + / - ), and the sequences of the npm2b target sites in these embryos will undergo dynamic changes throughout development (the wild-type npm2b target sites will be induced to mutate by Cas9 / gRNA-npm2b expressed by the HEML allele), resulting in the whole embryo being npm2b mosaic for the Figure 2 gene (

[0061] Example 4. Mutations induced by HMEL npm2b can lead to a maternal embryonic lethal phenotype Although npm2b the Figure 2 gene was efficiently mutated in the somatic tissues of F1 HMEL adult fish ( HMEL B), these individuals were still mosaic mutants rather than homozygous mutants. Therefore, this example aimed to detect whether the inheritance of the npm2b allele would induce sufficient

[0062] mutations to result in the expected maternal embryonic lethal phenotype. Figure 2 In this example, the survival rate of embryos was measured by dividing the number of live embryos at 24 hpf by the total number of embryos collected at 2 hpf. The results are shown in p D, indicating that the survival rate of embryos produced by outcrossing HMEL female fish with wild-type male fish (0.21 ± 0.58%) was significantly lower than that of wild-type hybrid offspring (****: -7 ), while there was no significant difference in the survival rate of embryos produced by outcrossing HMEL male fish with wild-type female fish compared to wild-type hybrid offspring (n.s; p = 0.69); Figure 2 In

[0063] E, the upper panel shows the development of offspring at 24 hpf from outcrossing HMEL heterozygous female fish, indicating that most embryos had died and a small number of surviving embryos showed obvious developmental retardation. The lower panel shows normal development at 24 hpf of offspring from outcrossing HMEL male fish. Scale bar: 1 mm. Figure 2 D and Figure 2 E), indicating that almost all offspring embryos produced by outcrossing HMEL F1 female fish died (maternal lethality), while HMEL F1 male fish were normally fertile (

[0064] To prove npm2b The mutations and the maternal embryonic lethal phenotypes can be inherited in the target population. In this example, the outcrossed offspring of a single F1 HMEL heterozygous male fish were subjected to single-embryo (6 dpf) genotyping of the npm2b target site by AgeI digestion and npm2b mutation rate analysis.

[0065] The results showed that the F2 embryos inherited the HMEL alleles at the normal Mendelian ratio (theoretical value: 50%; measured value: 26 / 48, p = 0.5637); meanwhile, compared with the embryos that did not inherit the HMEL alleles, the mutation efficiency of the target site in the embryos that inherited the HMEL alleles was significantly increased ( npm2b < 10 p <10 -4 ), indicating that the HMEL allele has stable heritability and effective mutagenic ability ( Figure 2 F). Theoretically, the embryos that did not inherit the HMEL alleles are either homozygous wild-type for the npm2b target site or heterozygous with an HMEL indel mutation from the npm2b paternal parent. Interestingly, among the F2 embryos that did not inherit the HMEL alleles, 18 / 22 were heterozygous, while only 4 / 22 were wild-type. This result actually reflects the npm2b mutation frequency in the germ cells of the HMEL paternal parent. In the F2 embryos that inherited the HMEL alleles, two groups of npm2b mutation rates were observed, one group approaching 100% (97.4 ± 1.7%) and the other group being slightly lower (77.5 ± 4.2%), and the number of embryos was also smaller. Since the gametes from the HMEL heterozygous male parent can have 4 different genotypes, and there are two types of gametes carrying the HMEL alleles ( Figure 2 C), we speculate that the above two groups of F2 npm2b embryos with different HMEL mutation frequencies are likely the result of different paternal gamete genotypes. The latter group with a lower mutation rate (77.5 ± 4.2%) likely inherited the wild-type npm2b ( npm2b = 0% mutation rate at fertilization) from the paternal parent, while the former group of embryos (97.4 ± 1.7%) likely inherited a mutant npm2b allele from the HMEL male parent, so at the single-cell fertilized egg stage (the starting stage of embryonic development), its npm2bThe mutation rate has reached 50% (= heterozygotes). These two groups HMEL The distribution of embryos in terms of quantity has no significant difference from the distribution of the number of wild-type and heterozygous embryos in the F2 embryos without inherited HMEL alleles (= p 0.5048), and is also consistent with the somatic mutation rate of its male HMEL parent (83.8%, Figure 2 B).

[0066] In summary, npm2b The embryos produced after the (homozygous) mutant female fish is crossed with any male fish (due to the lack of npm2b the maternally expressed product of the gene) cannot survive (= the mutant female fish is sterile), while npm2b the homozygous mutation of the gene has no effect on the survival of the female fish itself, nor on the survival and fertility of the male fish. For the targeted npm2b Cas9 / gRNA transgenic fish line (Cas9 / gRNA- npm2b ), the Cas9 / gRNA- npm2b transgenic element can be continuously highly expressed in the fish body, and can gradually cause npm2b the gene to mutate (indel), so that a high-efficiency mutation of the npm2b gene can be detected in adult fish (more than 3 months after fertilization). In the oocytes of such Cas9 / gRNA- npm2b heterozygous transgenic female fish, the npm2b gene will also be highly mutated, and no functional npm2b maternally expressed product of the gene can be produced. Therefore, the embryos produced after this female fish is crossed with any male fish cannot survive (equivalent to this female fish showing a sterile phenotype), resulting in a decrease in the number of offspring in the entire population; while the Cas9 / gRNA- npm2b heterozygous transgenic male fish has normal fertility (producing viable offspring when crossed with wild-type female fish), so as to be able to continuously spread the Cas9 / gRNA- npm2b allele in the population, enabling the ability of the transgenic female fish to inhibit population reproduction to persist in the population (passed down from generation to generation). The present invention refers to the above population suppression strategy based on maternally embryonic lethal genes / maternal sterility as HMEL (Heritable Maternal effect EmbryoLethality), and the schematic diagram is as Figure 1 shown. In this way, on the one hand, population suppression can be caused by female sterility, and on the other hand, the transgenic element of this female sterility can be inherited by the male to the offspring, enabling it to continuously spread in the population, so that the population suppression ability is passed down from generation to generation until the population collapses. Since this Cas9 / gRNA- npm2bThe transgenic element causes female sterility in the heterozygous state, so homozygous HMEL transgenic fish cannot be produced.

[0067] In summary, the present invention creates a population control strategy based on the Cas9 / gRNA transgenic system targeting maternally embryonic lethal genes, and demonstrates the feasibility of this strategy in zebrafish npm2b as an example.

[0068] Compared with the male sterility release technology (SMRT), the HMEL strategy created by the present invention can achieve continuous population suppression. Specifically, as Figure 5 shown, in the left figure of the HMEL strategy, due to the heritable maternally embryonic lethal effect, releasing HMEL individuals (red and yellow) into the target population once, the population suppression effect can be continuously spread in the population through fertile HMEL males (yellow), thus continuously producing maternally lethal HMEL females (red), making the population suppression effect persist. If HMEL individuals are introduced again later, the frequency of HMEL alleles in the target population can be further increased, thereby further increasing the negative selection pressure on the population; while in the right figure of the SMRT technology, the sterile phenotype (red) is static and one-time, and the period when the population suppression takes effect is limited by the lifespan of the introduced sterile individuals. If new sterile individuals are not introduced in a timely and repeated manner, the target population may recover rapidly.

[0069] Therefore, compared with the short-term effect of SMRT that is only effective for one generation, the transgenic element generated by the strategy of the present invention can be stably transmitted in the target population for a long time; compared with the recently reported self-sexing and Ifegenia methods that are only applicable to special (limited to certain species) genes, the genes selected by the strategy of the present invention have species conservation, making the strategy of the present invention theoretically extendable to any species. In addition, the vector of the present invention is easy to construct and modify. The Cas9 expression cassette and the U6 promoter are common for fish. If the target gene needs to be replaced, only a 20 bp target sequence needs to be replaced. Therefore, the strategy of the present invention has obvious advantages compared with all existing technologies.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a transgenic vertebrate with simultaneous sex-specific sterility and fertility, characterized in that Comprising: Using a sex - specific sterility gene as a target gene, and by means of transgenic technology, enabling a targeted mutagenesis system to be continuously expressed and stably inherited in vertebrates, resulting in the inactivation of the sex - specific sterility gene function, and simultaneously generating a sex - specific sterility phenotype and a fertile phenotype.

2. The construction method according to claim 1, characterized in that, The targeted mutagenesis system includes a CRISPR / Cas system, a TALEN system or a ZFN system; Preferably, the CRISPR / Cas system is a CRISPR / Cas9 system.

3. The construction method according to claim 2, characterized in that, Comprising: Designing a gRNA targeting the sex - specific sterility gene, and integrating the Cas9 / gRNA expression system into the genome of an individual vertebrate by means of transgenic methods, so as to utilize the Cas9 / gRNA system to be continuously expressed and stably inherited in vertebrates, resulting in the inactivation of the sex - specific sterility gene function, and simultaneously generating a sex - specific sterility phenotype and a fertile phenotype.

4. The construction method according to claim 3, characterized in that, The sex-specific sterility gene is a female sterility gene nucleoplasmin 2b or Npm2, NMP2 whose functional inactivation results in a maternal embryonic lethal phenotype.

5. The construction method according to claim 4, wherein The target site sequence of the Cas9 / gRNA system is as shown in SEQ ID No.1 or its complementary sequence, and the PAM is TGG.

6. The construction method according to claim 5, characterized in that, The nucleotide sequence of Cas9 mRNA is as shown in SEQ ID No.2; the nucleotide sequence of the gRNA is as shown in SEQ ID No.

3.

7. The construction method according to claim 3, wherein Using an RNA polymerase II ubiquitous expression promoter to drive the continuous expression of Cas9 endonuclease; And / or, using an RNA polymerase III ubiquitous expression promoter to drive the continuous expression of the gRNA targeting the sex - specific sterility gene; Preferably, the RNA polymerase II pan-expression promoter is actb1 ; and the RNA polymerase III pan-expression promoter is rnu6 - 32 .

8. The construction method according to claim 3, characterized in that, The specific steps include: Constructing a donor plasmid containing an expression cassette of Cas9 driven by a promoter for ubiquitous expression and an expression cassette of a gRNA targeting the sex - specific sterility gene driven by a promoter for ubiquitous expression, introducing the donor plasmid into a vertebrate fertilized egg, and after screening, obtaining transgenic vertebrates with stable inheritance of sex - specific sterility and fertility simultaneously; Preferably, the sequence of the donor plasmid is as shown in SEQ ID No.

4.

9. The application of the construction method according to any one of claims 1 to 8 and the transgenic vertebrates obtained by the construction in population control; Preferably, the vertebrates include fish, amphibians, reptiles, birds, mammals.

10. A method for continuous vertebrate-specific population control, characterized in that, Comprising: Using the construction method according to any one of claims 1 to 8 to obtain transgenic vertebrates with sex - specific sterility and fertility simultaneously, and then releasing them into the target population. The transgenic vertebrates of the fertile sex can continuously transmit the transgenic system to the offspring, so that the sex - specific sterility phenotype can be continuously transmitted or spread in the target population.

Images