Method for preparing MSTN gene editing bovine cells by using CRISPR / Cas12i
Accurate editing of the bovine MSTN genes through the CRISPR/Cas12i system solves the problems of off-target effects and low editing efficiency in the existing technology, achieves efficient and accurate gene editing, and improves the effectiveness of beef cattle breeding and cell cloning.
Patent Information
- Application Number
- CN202510454798.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-07-11
AI Technical Summary
Existing gene editing technologies such as CRISPR/Cas9 have problems with off-target effects, cytotoxicity and low editing efficiency in MSTN gene editing, which is difficult to meet the needs of modern animal breeding for efficient and accurate gene editing.
Using the CRISPR/Cas12i system, efficient editing of the bovine MSTN gene was performed by designing a specific sgRNA to target the first exon of the bovine MSTN gene, combining the Cas12i expression vector and the sgRNA expression vector, and highly efficient editing cells were screened through fluorescent labeling and restriction enzyme identification.
It realizes efficient and precise editing of MSTN genes, reduces off-target effects, and improves editing efficiency by 3%-5%, provides new strategies for beef cattle breeding, simplifies the operation process, and improves the efficiency of cell cloning and embryo editing.
Smart Images

Figure CN120290630A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for preparing MSTN gene-edited bovine cells by using CRISPR / Cas12i. Background Art
[0002] Myostatin (MSTN) gene belongs to the transforming growth factor-β (TGF-β) superfamily and plays a key negative regulatory role in the growth and development of skeletal muscle. The MSTN precursor protein consists of a signal peptide, an N-terminal propeptide, and a C-terminal mature peptide. The signal peptide guides the MSTN protein to cross the endoplasmic reticulum, the N-terminal propeptide acts as an inhibitor to prevent MSTN from binding to the receptor, and the C-terminal mature peptide has biological activity. MSTN restricts muscle growth by inhibiting the proliferation and differentiation of myoblasts. The deletion or reduced expression of the MSTN gene leads to muscle hypertrophy, forming a "double-muscled" phenomenon, thereby increasing the meat production rate. Therefore, the MSTN gene has become an important biotechnology target for improving the meat production of livestock.
[0003] Although the MSTN gene has important value in livestock breeding, existing gene editing technologies still have some limitations. Traditional gene editing technologies, such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), although showing certain potential in specific applications, are limited by their complex design and construction processes, as well as relatively low editing efficiency, and it is difficult to meet the requirements of modern animal breeding for efficient and precise gene editing. The CRISPR / Cas9 editing system has been widely used in the field of animal gene editing rapidly due to its high efficiency and easy operation. However, there are still problems such as off-target effects and cytotoxicity in the practical application of the CRISPR / Cas9 system. In addition, problems such as low editing efficiency, large size of the editing tool vector, and difficulty in the design and construction of gRNA limit the further application of the CRISPR / Cas9 system in the editing of the MSTN gene. CRISPR / Cas12i is a new type of gene editing tool and belongs to a subtype of the CRISPR / Cas system. Compared with the traditional CRISPR / Cas9 system, CRISPR / Cas12i has some unique advantages, such as a smaller molecular weight, high delivery efficiency, and loose requirements for the PAM (protospacer adjacent motif) sequence. These characteristics make CRISPR / Cas12i have a broader application prospect in the field of gene editing. Although CRISPR / Cas12i shows certain specificity in gene editing, in the editing of the MSTN gene, the off-target effect is still a problem that is difficult to completely avoid, and the editing efficiency is still affected by various factors, such as the design of sgRNA, the expression level of Cas protein, cell type, etc. The CRISPR / Cas12i system cannot completely avoid interacting with non-target DNA sequences during the gene editing process, resulting in toxicity to cells, and there is no literature and patent report on the application of the CRISPR / Cas12i system in the editing of the MSTN gene. Summary of the Invention
[0004] Aiming at the problems of low editing efficiency and large off-target effect existing in existing gene editing tools, the present invention aims to provide a method for preparing MSTN gene-edited bovine cells using CRISPR / Cas12i. By using the CRISPR / Cas12i system to prepare MSTN gene-edited bovine cells, sequencing the gene-edited cells, screening out the sg with the highest knockout efficiency on the first exon of MSTN, and generating gRNA by in vitro transcription, then microinjection can be carried out. The higher the editing efficiency of the screened sg on bovine fetal fibroblasts, the higher the editing efficiency of the embryo during later microinjection will be.
[0005] To achieve the above object, the present invention adopts the following technical solutions to be realized:
[0006] The present invention provides a CRISPR / Cas12i system for bovine MSTN gene editing, comprising a Cas12i expression vector and an sgRNA expression vector targeting the bovine MSTN gene. The sgRNA expression vector targeting the bovine MSTN gene expresses an sgRNA as shown in SEQ ID NO.2, and its target site is located at the base sequence of positions 140 - 159 of the first exon of the MSTN gene.
[0007] Further, the sequence of the sgRNA is: ACACTACATCCTCAAGACTA (as shown in SEQ ID NO.2).
[0008] The sequence of the first exon of the MSTN gene is as shown in SEQ ID NO.1.
[0009] Further, the sequence of the first exon of the MSTN gene is as follows: ATGCAAAAACTGCAAATCTCTGTTTATATTTACCTATTTATGCTGATTGTTGCTGGCCCAGTGGATCTGAATGAGAACAGCGAGCAGAAGGAAAATGTGGAAAAAGAGGGGCTGTGTAATGCATGTTTGTGGAGGGAAAACACTACATCCTCAAGACTAGAAGCCATAAAAATCCAAATCCTCAGTAAACTTCGCCTGGAAACAGCTCCTAACATCAGCAAAGATGCTATCAGAC AACTTTTGCCCAAGGCTCCTCCACTCCTGGAACTGATTGATCAGTTCGATGTCCAGAGAGATGCCAGCAGTGACGGCTCCTTGGAAGACGATGACTACCACGCCAGGACGGAAACGGTCATTACCATGCCCACGGAGT.
[0010] The Cas12i expression vector is CBh-Cas12i16-CMV-mCherry-U6.
[0011] The sgRNA expression vector targeting the bovine MSTN gene is obtained by inserting the sgRNA into the Cas12i backbone.
[0012] The Cas12i backbone contains a U6 promoter and an sgRNA transcription termination signal.
[0013] The above-mentioned CRISPR / Cas12i system for bovine MSTN gene editing is used in the application of constructing bovine gene-edited cells with MSTN gene deletion.
[0014] The present invention provides a bovine gene-edited cell with MSTN gene deletion, which is obtained by co-transfecting primary bovine fibroblasts with the CRISPR / Cas12i system for bovine MSTN gene editing and verified.
[0015] The cells are verified by sequencing to have a deletion mutation at the 140-159th bases of the first exon of the MSTN gene.
[0016] The present invention provides a method for constructing the above-mentioned bovine gene-edited cell with MSTN gene deletion, including:
[0017] Step 1, constructing an sgRNA expression plasmid of the CRISPR / Cas12i system;
[0018] Step 2, transfecting the sgRNA expression plasmid of the CRISPR / Cas12i system into primary bovine fibroblasts;
[0019] Step 3, based on the transfected primary bovine fibroblasts, screening cells with a deletion at the 140-159th bases of the first exon of the MSTN gene through fluorescence labeling and restriction endonuclease identification to obtain a bovine gene-edited cell with MSTN gene deletion.
[0020] In Step 2, the co-transfection is carried out by liposome transfection or electroporation.
[0021] The present invention provides the application of the above-mentioned bovine gene-edited cell with MSTN gene deletion in the breeding of double-muscled beef cattle.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] The present invention provides a CRISPR / Cas12i system for bovine MSTN gene editing. By binding the Cas12i protein to the sgRNA targeting the bovine MSTN gene, it can accurately locate to the 140-159th bases of the first exon of the MSTN gene and induce Indel mutations in this region, and can precisely cut at the target site of the MSTN gene, thereby achieving deletion editing of the MSTN gene. The precise gene editing ability helps to study the function of the MSTN gene in bovine growth and muscle development, providing a new strategy for beef cattle breeding.
[0024] Application of the CRISPR / Cas12i system of the present invention in constructing recombinant cells of cattle with MSTN gene deletion. The application of the CRISPR / Cas12i system in constructing gene-edited cells of cattle with MSTN gene deletion demonstrates efficient and precise gene editing ability and simplified experimental procedures. Compared with other gene editing tools such as Cas9, the Cas12i system has higher specificity, reduces the editing of non-target gene loci, thereby reducing the risk of off-target effects, and the editing efficiency is increased by 3%-5%.
[0025] The gene-edited cells of cattle with MSTN gene deletion prepared by using the CRISPR / Cas12i editing tool vector of the present invention can be used in cloning technology to breed cloned cattle with extremely strong muscles, and can be used for gene editing of other livestock to improve their production performance or disease resistance. At the same time, the gene-edited cells and plasmids of these cattle can also be used for microinjection to prepare double-muscled beef cattle.
[0026] The method for constructing gene-edited cells of cattle with MSTN gene deletion provided by the present invention uses an advanced CRISPR / Cas12i gene editing vector, which not only simplifies the operation process, but also significantly improves the efficiency of gene editing, making the entire construction process smoother and more efficient. Combined with screening methods such as fluorescence labeling and restriction endonuclease identification, the obtained cell editing efficiency is stable and high, and can be used for somatic cell cloning to produce edited cattle or directly transcribe the constructed targeting site in vitro and perform microinjection to generate edited embryos. The first exon of the MSTN gene is knocked out, and the precise editing strategy effectively blocks the expression of the MSTN gene, providing the possibility for breeding cattle breeds with specific traits (such as increased muscle mass), and at the same time providing an important tool for gene function research and disease treatment model construction. It realizes efficient and specific editing of the MSTN gene and rapid and accurate screening of cell cloning, providing new ideas and methods for the fields of gene editing and cell engineering.
[0027] The application of the gene-edited cells of cattle with MSTN gene deletion provided by the present invention. The constructed gene-edited cells of cattle with MSTN gene deletion have broad application prospects. They can not only be used in somatic cell cloning technology to produce edited cattle, providing a new way for genetic improvement in the livestock industry, but also the constructed targeting site can be transcribed in vitro and directly generate edited embryos through microinjection technology, accelerating the application process of gene editing technology in the breeding field. Description of the Drawings
[0028] Figure 1 Schematic diagram of the position of the selected sg on the MSTN exon of the present invention;
[0029] Figure 2 Schematic diagram of the Cas12i plasmid backbone used in the present invention;
[0030] Figure 3 This is the sequencing result diagram after the construction of the sg primer and Cas12i plasmid backbone of the present invention;
[0031] Figure 4 This is the fluorescence expression photo of the sg transfection of bovine primary fibroblasts at different times of the present invention;
[0032] Figure 5 This is the sequencing result diagram of the PCR product of the flow-sorted positive cells of the present invention;
[0033] Figure 6 This is the enzyme digestion product diagram detected by T7E1 enzyme digestion gel electrophoresis of the present invention;
[0034] Figure 7 This is the second-generation sequencing result diagram of the present invention. Detailed implementation manners
[0035] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0036] I. Preparation of bovine fibroblast cell line
[0037] After fixing the cow, wet the ear with soapy water, clean it, and scrape off the hair on both sides of the ear reversely with a scraper as clean as possible. Disinfect the area with fewer ear nerves and blood vessels three times with 75% alcohol cotton balls. Cut off a tissue block about 1-2 cm 3 in size (each time a tissue block is cut off, the ear cutting pliers need to be disinfected with 75% alcohol), and stop bleeding with iodophor. First wash the removed tissue twice in 75% alcohol, and then wash it twice in DPBS containing 1% penicillin-streptomycin solution (PS). Bring the washed tissue block back to the laboratory at low temperature (4°C) in DPBS containing 1% PS. Wash the tissue block in DPBS containing PS, and remove the remaining hair, epidermal skin and brittle bones.
[0038] Cut the processed tissue block into small pieces (0.5-1 mm 3) Transfer the minced tissue into a 15 ml centrifuge tube, centrifuge at 1000 r / min for 1 min, and discard the supernatant. Add DMEM, 1% PS, and 0.25% trypsin, place it in an incubator at 37 °C and 5% CO2, shake it once every 5 min for a total of 20 min. After shaking, centrifuge at 1000 r / min for 5 min and discard the supernatant. Add 0.25% trypsin and collagenase II (3:1), seal it with a sealing film, and digest it on a shaker at 37 °C and 210 r / min until white transparent flocs appear (white transparent flocs will appear at about 1 h). Aspirate the flocs into a culture dish (60 mm) containing complete medium and culture it in an incubator at 37 °C and 5% CO2. Replace the complete medium once every 2 - 3 d. After operations such as passage and cryopreservation, a cell line can be established.
[0039] II. Plasmid Vector Construction and Preparation of CRISPR-Cas12i-MSTN Recombinant Plasmid
[0040] 1. Primer Design and PCR Amplification
[0041] Select all available PAM sequences on the first exon of the MSTN gene (the sequence is shown in SEQ ID NO.1), select a 20 bp spacer sequence, which is located upstream of the PAM sequence and is complementary to the target DNA, and design primers according to the selected PAM sequence and spacer sequence ( Figure 1 , Table 1); use the designed primers for PCR amplification to obtain a DNA fragment containing the spacer sequence.
[0042] Table 1: Primer Design
[0043]
[0044]
[0045] 2. Vector Cleavage and Ligation
[0046] Use the restriction endonucleases BpiI / bbsI (Thermo Fisher, FD1014) to cleave the Cas12i vector DNA ( Figure 2 ), and T4 DNA ligase (Thermo Fisher, EL0014) ligates the cleaved Cas12i vector DNA with the PCR product (the cleavage and ligation conditions are shown in Table 2 - 3). Insert the ligation product into the BbsI(269)-BbsI(291) position of the Cas12i vector, a total of 22 bases.
[0047] Table 2: Simultaneous Cleavage and Ligation System
[0048]
[0049] Table 3: Cutting and joining procedures
[0050]
[0051] 3. Transformation and screening of recombinant plasmids
[0052] (1) Conversion
[0053] Take the ligation product (10 μL, containing the recombinant plasmid) and add it to DH-5α competent cells (30 μL), and place it on ice for 30 minutes; place it in a 42°C water bath for 1 minute and 30 seconds, and immediately place it on ice for 5 minutes; add antibody-free culture medium (LB) to make up to 1 mL, and culture it at 37°C with shaking for 1.5 hours.
[0054] (2) Plate coating and culture
[0055] Centrifuge at 3000r / min for 1min, extract 400μL supernatant; inoculate 150-200μL of the remaining bacterial solution on a kanamycin-resistant LB plate; after leaving for 30min, invert the plate and culture at 37℃ for 12-16h.
[0056] (3) Monoclonal colony selection and identification
[0057] Pick a single clone colony, perform bacterial solution PCR, sequence, and select a successful sample. Compare the results with the map for sequence comparison ( Figure 3 ).
[0058] 4. Plasmid Extraction
[0059] (1) Collection of bacterial culture
[0060] Take 15 mL of the overnight bacterial solution in LB medium and centrifuge at 5000 g for 10 min at room temperature to collect the bacteria.
[0061] (2) Plasmid extraction
[0062] Add 500 μL of solution I / RNase A mixture and vortex to completely resuspend the cells.
[0063] Add 500μL of solution Ⅱ, gently invert upside down 8-10 times to mix; add 250μL of pre-cooled N3Buffer, gently invert the centrifuge tube 5-10 times to form a white flocculent precipitate; centrifuge at 13000g for 10 minutes at room temperature; carefully transfer the supernatant to a new centrifuge tube, add 0.1 times the volume of the supernatant ETR Solution, ice bath for 10 minutes; 42℃ water bath for 5 minutes, the lysate becomes turbid again. Centrifuge at 12,000xg for 3 minutes at 25℃; transfer the supernatant to a new test tube, add 0.5 times the volume of the supernatant anhydrous ethanol, gently invert the test tube 6-7 times, and let it stand at room temperature for 1-2 minutes; transfer the mixed solution to In the DNA Mini Column, centrifuge at 12,000 g for 1 min at room temperature and discard the filtrate; repeat the above steps until all the mixture binds to the column; add HBC Buffer and DNA Wash Buffer to wash the column; centrifuge at 12,000 g for 2 min at room temperature to dry the binding column matrix; add ddH2O to elute the DNA and store it at -20°C.
[0064] 5. Agarose Gel Recovery
[0065] (1) Gel Electrophoresis
[0066] Perform agarose gel electrophoresis on the PCR product to separate the desired DNA fragment.
[0067] (2) DNA Fragment Cutting and Recovery
[0068] Use a clean and sharp scalpel to cut out the desired DNA fragment; transfer the gel block to a centrifuge tube, weigh it and calculate the volume of solubilization solution to be added; add the solubilization solution and incubate at 50 - 55°C until the gel completely melts; transfer the DNA solubilization solution to DNA XS Column, centrifuge and discard the filtrate; repeat the above steps until all the DNA solubilization solution passes through the binding column; add XP5 Buffer and SPW Wash Buffer to wash the column; centrifuge at room temperature to dry the residual liquid of the binding column matrix; add Elution Buffer to elute the DNA to obtain the purified DNA fragment.
[0069] III. Transfection of Recombinant Plasmid into Cells and Detection of Cell Editing Efficiency
[0070] 1. Cell Recovery and Passage
[0071] (1) Cell Recovery
[0072] Take out the previously cryopreserved bovine ear margin fibroblasts from liquid nitrogen, quickly place them in a 37°C water bath to thaw and centrifuge, discard the cryopreservation solution, resuspend the cells with complete medium (10 mL FBS + 90 mL high-glucose medium + 1 mL double antibody), and transfer them to a culture dish.
[0073] (2) Cell Passage
[0074] Culture the cells in an incubator (37°C, 5% CO2) until the fifth or sixth passage; use a cell counting plate to count and adjust the cell concentration to 1.5×10 5 -1.5×10 6 cells / mL; plate the cells into a 12-well plate, adding 1 mL of cell suspension to each well.
[0075] 2. Cell Transfection
[0076] (1) Preparation of transfection complex
[0077] Tube A: 50 μL Opti-MEM TM + 3 μL lip3000, incubated at room temperature for 5 minutes; Tube B: 50 μL Opti-MEM TM + 1500 ng recombinant plasmid + 3 μL P3000, incubated at room temperature for 5 minutes; Mix Tube A and Tube B, and incubate at room temperature for 15 minutes to form the transfection complex;
[0078] (2) Cell transfection
[0079] Add 100 μL of the transfection complex to each well of a 12-well plate for transfection, and culture in an incubator after transfection (37 °C, 5% CO2).
[0080] (3) Observation after transfection
[0081] Observe and take pictures using a fluorescence microscope at 24 h and 48 h after transfection, and record the fluorescence expression. See the appendix for details Figure 4 as shown
[0082] (4) Sorting by flow cytometry
[0083] At 48 - 72 h after transfection, sort the fluorescent positive cells using flow cytometry, collect the sorted fluorescent positive cells into a centrifuge tube containing 100 μL of PBS for subsequent experiments.
[0084] 3. Detection of cell editing efficiency
[0085] (1) Lysis of flow-sorted positive cells
[0086] Lyse the flow-sorted positive cells (Table 4) to obtain the lysate.
[0087] Table 4: Cell lysis procedure
[0088]
[0089]
[0090] (2) PCR amplification and gel electrophoresis
[0091] Nested PCR was performed on the cell lysate. PCR primer design: Select primer sequences with a GC content of 58% - 60%; Outer primer sequences of the nested PCR primers: F: gaatcagctcacccttgactg (as shown in SEQ ID NO.29); R: cccaatcctttaccttggtagc (as shown in SEQ ID NO.30), Inner primer sequences: F: agattcactggtgtggcaag (as shown in SEQ ID NO.31); R: gcagctttcagtctcattggtc (as shown in SEQ ID NO.32). PCR reaction system: The PCR reaction system and amplification conditions are shown in Tables 5 - 8. Gel electrophoresis detection: By comparing the sequencing results and sequence alignment analysis, the verification results are shown in the appendix Figure 5 As shown, the results show that the transfected cells were successful.
[0092] Table 5: Nested PCR first-round system
[0093]
[0094] Table 6: Nested PCR first-round amplification program
[0095]
[0096] Table 7: Nested PCR second-round amplification system
[0097]
[0098] Table 8: Nested PCR second-round amplification program
[0099]
[0100] (3) T7E1 enzyme digestion verification
[0101] The nested PCR products were subjected to gel extraction and purification, and the purified products were digested with T7E1 (the digestion conditions are shown in Tables 9 - 10). The digested products were detected by gel electrophoresis to verify whether the plasmid construction was correct (see the appendix Figure 6 ), and the results showed successful digestion and correct plasmid construction.
[0102] Table 9: T7E1 enzyme digestion system
[0103]
[0104]
[0105] Table 10: Annealing program
[0106]
[0107] Note: Add 1 μL of T7 Endonucleasel to the annealing product and incubate at 37 °C for 15 min.
[0108] (4) Sequencing and result analysis
[0109] Design corresponding primer pairs for next-generation sequencing (NGS) (design primers for 100-200 bp regions upstream and downstream of the target site designed for each sgRNA, see Tables 11-13), perform PCR amplification on the cleavage products (amplification conditions see Tables 14-15), detect by electrophoresis, and detect the PCR products by gel electrophoresis; construct an NGS library for the PCR products and perform sequencing; analyze the AGS sequencing and data. Among all the designed sgs, the editing efficiency is as high as 75%. After subsequent in vitro transcription, edited embryos are obtained, and the positive rate is 80%. Select the sg with the highest editing efficiency, indicating successful transfection ( Figure 7 ).
[0110] Table 11: NGS round 1 primers
[0111]
[0112] Table 12: NGS round 2 upstream primers
[0113]
[0114] Table 13: NGS round 2 downstream primers
[0115]
[0116]
[0117] Table 14: NGS round 1 PCR program
[0118]
[0119] Table 15: NGS round 2 PCR program
[0120]
[0121] Through NGS primer design, library construction and bioinformatics analysis, combined with screening based on editing efficiency, the successful transfection of the CRISPR / Cas12i system can be clearly verified.
[0122] The above content is only to illustrate the technical idea of the present invention and cannot be used to limit the protection scope of the present invention. Any modification made on the basis of the technical solution according to the technical idea proposed by the present invention falls within the protection scope of the claims of the present invention.
Claims
1. A CRISPR / Cas12i system for bovine MSTN gene editing, characterized in that, It includes a Cas12i expression vector and an sgRNA expression vector targeting the bovine MSTN gene. The sgRNA expression vector targeting the bovine MSTN gene expresses the sgRNA shown in SEQ ID NO.2, and its target site is located at the 140-159th base sequence of the first exon of the MSTN gene.
2. The CRISPR / Cas12i system for bovine MSTN gene editing according to claim 1, wherein The sequence of the first exon of the MSTN gene is shown in SEQ ID NO.
1.
3. The CRISPR / Cas12i system for bovine MSTN gene editing according to claim 1, wherein The Cas12i expression vector is CBh-Cas12i16-CMV-mCherry-U6.
4. The CRISPR / Cas12i system for bovine MSTN gene editing according to claim 1, wherein The sgRNA expression vector targeting the bovine MSTN gene is obtained by inserting sgRNA into the Cas12i backbone, and the Cas12i backbone contains a U6 promoter and an sgRNA transcription termination signal.
5. Use of the CRISPR / Cas12i system for bovine MSTN gene editing according to any one of claims 1 to 4 in constructing bovine gene-edited cells with MSTN gene deletion.
6. A bovine gene-edited cell with MSTN gene deletion, characterized in that, It is obtained by co-transfecting bovine primary fibroblasts with the CRISPR / Cas12i system for bovine MSTN gene editing according to any one of claims 1 to 2 and verified.
7. The bovine gene-edited cell with MSTN gene deletion according to claim 6, wherein The cells are verified by sequencing to have a deletion mutation at the 140-159th base of the first exon of the MSTN gene.
8. The method for constructing a bovine gene-edited cell with MSTN gene deletion according to any one of claims 6 to 7, characterized in that, It includes: Step 1, constructing an sgRNA expression plasmid of the CRISPR / Cas12i system; Step 2, co-transfecting bovine primary fibroblasts with the sgRNA expression plasmid of the CRISPR / Cas12i system and the Cas12i protein expression plasmid; Step 3, based on the transfected bovine primary fibroblasts, screening cell clones with a deletion at the 140-159th base of the first exon of the MSTN gene by fluorescence labeling and restriction endonuclease identification to obtain bovine gene-edited cells with MSTN gene deletion.
9. The method for constructing a bovine gene-edited cell with MSTN gene deletion according to claim 8, wherein In step 2, the co-transfection is carried out by the liposome transfection method or the electroporation method.
10. Use of a bovine gene-edited cell with MSTN gene deletion according to any one of claims 6 to 7 in double-muscled beef cattle breeding.
Citation Information
Cited By
System for MSTN / IGF2 double-gene editing and preparation method and application thereof
CN121472221A