Construction method and application of WARS2 point mutation mouse model

Abstract

The invention provides a construction method and application of a WARS2 point mutation mouse model. A part of gene segments of a sixth exon of an endogenous WARS2 gene in a homologous chromosome of a mouse are humanized, and WARS2 c.799Ggt, WARS2 c.799Ggt, WARS2 c.799Ggt, WARS2 c.799Ggt, WARS2. And the C (p.Ala267Pro) site is subjected to point mutation. The construction method disclosed by the invention provides convenience for obtaining a mouse model which is similar to human WARS2 gene p.Ala267Pro pathogenic mutation, and provides a basis for researching related factors of human WARS2 A267P / A267P mutation and diagnosing and treating the human WARS2 gene p.Ala267Pro pathogenic mutation. Therefore, researchers can deeply analyze the biological function of the WARS2 gene, an effective research way and method are provided for exploring the internal relation between the WARS2 gene function and the PD pathogenesis, and a foundation is laid for related application.

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical technology, relates to the treatment of Parkinson's disease, and specifically relates to a method for constructing a WARS2 point mutation mouse model and related applications. Background Art

[0002] Parkinson's disease (PD) is the second most common neurodegenerative disease after Alzheimer's disease. Clinically, it is mainly characterized by movement disorders such as bradykinesia, tremors, and postural instability. Its typical pathological feature is the loss of dopaminergic neurons in the substantia nigra of the midbrain, manifested as a decrease in tyrosine hydroxylase (TH)-positive neurons in the substantia nigra. The onset of PD is closely related to genes and the mechanism is complex. In familial PD, some patients carry clear pathogenic gene mutations. For example, mutations in the SNCA gene are more likely to cause the aggregation of α-synuclein to form Lewy bodies; mutations in genes related to autosomal recessive inheritance such as PARK2, PINK1, and DJ-1 will respectively disrupt intracellular protein quality control, etc., significantly increasing the risk of onset and the onset age may be earlier. Although sporadic PD is affected by the combined action of environment and genetic susceptibility, some gene polymorphisms such as single nucleotide polymorphisms in the MAPT gene will also increase the likelihood of onset. Therefore, in-depth study of the genetic factors of PD helps to fundamentally understand the pathogenesis of PD.

[0003] Tryptophanyl-tRNA synthetase 2 (WARS2) is a crucial mitochondrial enzyme and plays an indispensable role in the process of protein biosynthesis. It is mainly responsible for catalyzing the binding of tryptophan to the corresponding transfer RNA (tRNA) to form aminoacyl-tRNA, thereby accurately transporting amino acids to ribosomes and participating in protein synthesis. Mitochondria, as the "power plant" of cells, undertake the key tasks of cell respiration and energy metabolism. The normal function of WARS2 in mitochondria is crucial for maintaining the synthesis of mitochondrial proteins, the structural and functional integrity of mitochondria. The correct synthesis of mitochondrial proteins is decisive for the assembly and activity maintenance of mitochondrial respiratory chain complexes, and the normal function of respiratory chain complexes is the basis for cell energy production. In addition, WARS2 may also be involved in multiple biological processes such as the regulation of mitochondrial gene expression and mitochondrial quality control, and is closely related to physiological activities such as cell growth, differentiation, and apoptosis.

[0004] Recently, our research team found a specific abnormal mutation (c.799G>C) in the WARS2 gene in a clinical PD family. However, the specific molecular mechanism and pathophysiological process by which WARS2 gene mutations cause PD have not been fully clarified, and there is still a lack of a suitable animal model to deeply explore this pathophysiological process and develop effective treatment methods.

[0005] Traditional animal models have certain limitations in simulating human diseases. Although there have been research reports on the V117L mouse model of WARS2, due to the complexity of the genetic background of the WARS2 gene, some pathogenic sites in clinical patients are relatively rare, and there is a situation where the sequences between humans and mice are not conserved, making the existing mouse models difficult to be effectively applied to PD research. Summary of the Invention

[0006] Based on the above problems, the present invention provides a method for constructing a WARS2 point mutation mouse model and its application. The research process is as follows: A specific abnormal mutation (c.799G>C) of the WARS2 gene was found in a clinical PD family. However, this mutation site is not conserved between humans and mice, and a matching mouse model cannot be constructed to study the pathogenic mechanism of the point mutation at the in vivo level. Therefore, a partial gene fragment of the 6th exon of the C57 mouse WARS2 gene was replaced with a partial gene fragment of the human 6th exon, and the WARS2 (c.799G>C) site was subjected to point mutation using CRISPR / Cas9. Based on this, the present invention established a new type of Parkinson's disease mouse model with high stability and good repeatability, which is expected to deeply study the damage mechanism of the disease, so as to find new methods for preventing and alleviating the occurrence and development of Parkinson's disease.

[0007] To achieve the above object, the technical solution of the present invention is as follows:

[0008] In the first aspect of the present invention, a method for constructing a WARS2 point mutation mouse model is provided, in which a partial gene fragment of the 6th exon of the endogenous WARS2 gene in the homologous chromosomes of the mouse is replaced with a partial gene fragment of the human 6th exon, and the WARS2 c.799G>C (p.Ala267Pro) site is subjected to point mutation by gene editing technology.

[0009] Preferably, the present invention uses CRISPR / Cas9 for point mutation, and replaces the mouse sequence with the human mutated sequence as follows:

[0010] Original mouse sequence:

[0011] ACGTCAGAGGTCACCTACGAGCCGGACAGCAGAGCTGGTGTTTCCAAC (SEQ ID NO.1);

[0012] Humanized mutated sequence:

[0013] ACCTCGGAGGTCACCTATGACCCGCCTGGCCGCGCTGGCGTGTCCAAC (SEQ ID NO.2).

[0014] When specifically performing the operation, search for a suitable target sequence in the coding sequence of the target gene (usually select 20 bp in the coding region, and its 3' end ends with NGG). For the convenience of later genotype identification, select and design two targets for injection simultaneously to prepare Cas9 mRNA. The specific steps are as follows:

[0015] 1. Target construction

[0016] Use the CRISPR / Cas9 technology to construct a partial humanized point mutation of mouse WARS2 p.D267P (GAC>CCT). The mutation is located in exon6, and design a target at the pre-mutation position.

[0017] The guide RNA of CRISPR / Cas9 includes sgRNA1 and sgRNA2, and replace the original sequence with the target sequence shown in SEQ ID NO.3.

[0018] Target sequence (40 bp):

[0019] ;

[0020] WARS2 (A267P)-sgRNA1: (SEQ ID NO.4);

[0021] WARS2 (A267P)-sgRNA2: (SEQ ID NO.5).

[0022] 2. Microinjection and embryo transfer

[0023] (1) Superovulation of embryo donor mice (C57BL / 6): Screen C57BL / 6J female mice at 3 - 4 weeks old, and treat the donor female mice with pregnant mare serum

[0024] gonadotropin (PMSG). After 46 - 48 hours, inject human chorionic gonadotropin (HCG), and cage them with adult fertile male mice for mating;

[0025] (2)Collect the fertilized eggs the next day for microinjection: ① Prepare the ribonucleoprotein (RNP) complex: First, artificially synthesize crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). The crRNA will bind to the tracrRNA to form the sgRNA sequence. Then, add crRNA to RNase-free water, followed by adding tracrRNA and mixing well for incubation. After that, add Cas9 protein and mix well for incubation to obtain a mixture, which is then mixed with the plasmid (i.e., the targeting vector) to obtain the RNP injection complex. ② Use a microinjector to inject the RNP injection complex prepared in the above steps into the nucleus of the mouse fertilized egg. Transfer the injected fertilized eggs to the culture medium and place them in an incubator. After culturing for 0.5 - 1 h, perform transplantation; or culture until the 2-cell stage and perform transplantation the next day;

[0026] (3)Embryo transfer: Select fertile female mice of appropriate age and male mice sterilized by vasectomy to mate to obtain pseudopregnant female mice, which serve as surrogate mice after the fertilized eggs are transgenic; transfer the fertilized eggs injected with foreign genes into the fallopian tubes of the surrogate female mice; after successful fallopian tube transplantation, wait for the female mice to give birth to F0 and perform PCR identification for gene typing.

[0027] 3. Identification of mouse genotypes:

[0028] ① Identification of Founder mice: The mice from embryo transfer will be born about 19 days after the operation. About 7 days after the mice are born, cut the tail (or toes) to extract DNA and perform PCR identification; ② Identification of F1 mice: When the male Founder mice reach 7 weeks of age and the female mice reach 4 weeks of age, they can be mated with wild-type opposite-sex mice respectively. PCR identification is performed 20 days after the mice are born. If positive mice are born, it indicates that the transgene has been integrated into the germ cells, marking the successful establishment of the strain.

[0029] In the third aspect of the present invention, a WARS2 point mutant mouse model constructed by the above method is provided. This partially humanized WARS2 mouse model can be used as a disease animal model carrying such mutant sites (such as a Parkinson's disease animal model) for in-depth study of the injury mechanism of the disease, so as to find new methods for preventing and alleviating the occurrence and development of the disease.

[0030] In the fourth aspect of the present invention, an application of the constructed WARS2 point mutant mouse model is provided, such as its application in screening or developing drugs for the treatment of Parkinson's disease.

[0031] The innovation points of the present invention are as follows:

[0032] When studying diseases related to WARS2 gene mutations, traditional animal models often fail to accurately reproduce the symptoms and pathological characteristics of human patients. For example, in some gene knockout mouse models, the complete absence of WARS2 gene expression may lead to embryonic lethality or phenotypes that do not fully match human diseases, thus unable to provide effective support for in-depth research on disease mechanisms and the development of treatment methods. In addition, the differences in gene sequences and physiological functions between different species also pose certain limitations to traditional animal models in drug research and development and the evaluation of treatment effects. We introduced partial human gene fragments into the mouse genome through gene editing technology, enabling mice to have the expression and functional characteristics of human genes. This model can more accurately simulate the occurrence and development process of human diseases, providing a more ideal platform for studying the mechanisms of human diseases and developing effective treatment methods. In the study of diseases related to WARS2 gene mutations, we established a mouse model with WARS2 gene mutations using the CRISPR / Cas9 method. This method is fast and accurate and is currently a new generation of means for constructing point mutant and transgenic mice. The mouse model established by this method can reproduce and grow stably, obtaining a large number of models of Parkinson's disease that we need. At the same time, we deeply studied the mechanism of action of the WARS2 gene mutation site in the occurrence and development process of Parkinson's disease through this model, thus providing its application.

[0033] Compared with the prior art, the present invention has the following remarkable advantages:

[0034] (1) The present invention provides a method for constructing a mouse model with WARS2 gene point mutations. The mouse model constructed by applying this method can be stably passed on, providing a convenient, reliable and economical means for studying the relationship between WARS2 gene mutations and Parkinson's disease and its pathogenic mechanism.

[0035] (2) In the case where it is difficult to obtain research materials from human patients and is restricted by medical ethics, the mouse model provided by the present invention will become an important tool in the research of Parkinson's disease related to WARS2 A267P / A267P mutations.

[0036] (3) The construction method of the present invention facilitates the acquisition of a mouse model similar to the pathogenic mutation p.Ala267Pro of the human WARS2 gene, providing a basis for studying the related factors, diagnosis and treatment of WARS2 A267P / A267P mutations in humans. This not only helps researchers deeply analyze the biological functions of the WARS2 gene, provides an effective research approach and method for exploring the internal relationship between the functions of the WARS2 gene and the pathogenesis of PD, but also lays a foundation for related applications. Brief Description of the Drawings

[0037] Figure 1 Shows an information diagram of the WARS2 gene;

[0038] Figure 2 Shows a comparison map of the non-conserved human and murine WARS2 c.799G>C gene loci;

[0039] Figure 3 Shows a schematic diagram of the construction strategy for generating a partially humanized WARS2 A267P / A267P point mutation mouse model using CRISPR / Cas9 gene targeting technology. Detailed implementation methods

[0040] The following examples and experimental examples further illustrate the present invention and should not be construed as limiting the present invention. The examples do not include detailed descriptions of traditional methods, which are well known to those of ordinary skill in the art and have been described in many publications.

[0041] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the present invention, and the preferred implementation methods and materials described in the detailed implementation methods are for illustrative purposes only.

[0042] The method for constructing the WARS2 point mutation mouse model provided by the present invention is outlined as follows: replacing a partial sequence of the endogenous WARS2 gene in the homologous chromosomes of the animal with a homologous sequence of the human WARS2 gene; the WARS2 gene fragment is the human WARS2 gene with a c.799G>C (p.Ala267Pro) site variation. Search for a suitable target sequence in the coding sequence of the target gene (usually select 20bp in the coding region, and its 3' end ends with NGG), and for convenient genotype identification in the later stage, select and design two target sites for injection simultaneously to prepare Cas9 mRNA.

[0043] For the construction strategy of the WARS2 point mutation mouse model, see Figure 3 , and the specific steps are as follows:

[0044] 1. Target site construction

[0045] (1) Gene information:

[0046] See Figure 1 , according to bioinformatics analysis: WARS2 gene has multiple transcripts for protein coding. All subsequent designs are based on transcript 201 as the template.

[0047] (2) Guide RNA target sequence design:

[0048] Construction of partial humanized point mutation of mouse WARS2 p.D267P (GAC>CCT) using CRISPR / Cas9 technology. The mutation is located in exon6, and targets are designed at the pre-mutation position.

[0049] Figure 2 The homology alignment results of mouse and human WARS2 genes are shown as follows:

[0050] Original mouse sequence:

[0051] (SEQ ID NO.1);

[0052] Sequence after humanized mutation:

[0053] (SEQ ID NO.2).

[0054] guideRNA information:

[0055] WARS2(A267P)-sgRNA1: (SEQ ID NO.4);

[0056] WARS2(A267P)-sgRNA2: (SEQ ID NO.5);

[0057] The oligo replacement sequence of WARS2(A267P) is 40bp:

[0058] .

[0059] In mice, the gene sequence containing the coding region (black uppercase) and non-coding region (lowercase) before replacement is as follows:

[0060] .

[0061] 2. Microinjection of fertilized eggs and embryo transfer:

[0062] (1) Superovulation of embryo donor mice (C57BL / 6): Select C57BL / 6J female mice at 3-4 weeks old, treat the donor female mice with pregnant mare serum (PMSG), inject human chorionic gonadotropin (HCG) 46-48 hours later, and cage them with adult fertile male mice for mating;

[0063] (2)Retrieve the fertilized eggs the next day for microinjection: ① Prepare the ribonucleoprotein (RNP) complex: First, artificially synthesize crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). The crRNA will bind to tracrRNA to form the sgRNA sequence. Then, add crRNA to RNase-free water, followed by adding tracrRNA and mixing well for incubation. After that, add Cas9 protein and mix well for incubation to obtain a mixture, which is then mixed with the plasmid (i.e., the targeting vector) to obtain the RNP injection complex. ② Use a microinjector to inject the RNP injection complex prepared in the above steps into the nucleus of the mouse fertilized egg. Transfer the injected fertilized eggs to the culture medium and place them in an incubator. After culturing for 0.5 - 1 h, perform transplantation; or culture until the 2-cell stage and perform transplantation the next day.

[0064] (3)Embryo transfer: Select fertile female mice of appropriate age to mate with vasectomized male mice to obtain pseudopregnant female mice as surrogate mothers after the fertilized eggs are transgenic; transfer the fertilized eggs injected with the foreign gene into the fallopian tube of the surrogate mother mouse; after successful fallopian tube transplantation, wait for the mother mouse to give birth to F0 and perform PCR identification for gene typing.

[0065] 3. Mouse genotype identification: ① Founder mouse identification: The mice from embryo transfer will be born about 19 days after the operation. About 7 days after the mice are born, cut the tail (or toes) to extract DNA and perform PCR identification. ② F1 mouse identification: When the male Founder mice reach 7 weeks of age and the female mice reach 4 weeks of age, they can be mated with wild-type opposite-sex mice respectively. Perform PCR identification 20 days after the mice are born. If positive mice are born, it indicates that the transgene has been integrated into the germ cells, marking the successful establishment of the strain.

[0066] We use the CRISPR / Cas9 method to establish a mouse model with WARS2 gene mutation. This method is fast and accurate and is a new generation of means for constructing point mutation and transgenic mice. The mouse model established by this method can reproduce and grow stably, and a large number of models of Parkinson's disease we need can be obtained. At the same time, we deeply study the mechanism of action of the WARS2 gene mutation site in the occurrence and development of Parkinson's disease through this model, and thus provide its application.

[0067] The construction method of the present invention facilitates the obtaining of a mouse model similar to the pathogenic mutation p.Ala267Pro of the human WARS2 gene, and provides a basis for studying the related factors and diagnosis and treatment of the A267P / A267P mutation of WARS2 in humans.

[0068] Statement: The technology of this invention comes from the National Key Research and Development Program, with the project number 2022YFF1202800 and the project name "Adult Brain Magnetism System with Helmet-Type Large Channels Based on SQUID".

[0069] The parts not described in this invention are the same as or implemented by the prior art. The applicant declares that this invention illustrates the detailed method of this invention through the above embodiments, but this invention is not limited to the above detailed method, that is, it does not mean that this invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvement of this invention, the equivalent substitution of each raw material of the product of this invention, the addition of auxiliary components, the selection of specific methods, etc., all fall within the protection scope and the disclosure scope of this invention.

Claims

1. A method for constructing a WARS2 point mutation mouse model, characterized in that, Part of the gene fragment of exon 6 of the mouse WARS2 gene was replaced with part of the human exon 6 gene fragment, and site-directed mutagenesis was performed on the WARS2 (c.799G>C) locus by gene editing technology.

2. The construction method according to claim 1, characterized in that Site-directed mutagenesis was carried out using CRISPR / Cas9, and the mouse sequence shown in SEQ ID NO.1 was replaced with the humanized mutant sequence shown in SEQ ID NO.

2.

3. The construction method according to claim 2, characterized in that, The guide RNA of the CRISPR / Cas9 includes sgRNA1 and sgRNA2, and the target sequence shown in SEQ ID NO.3 was replaced with the original sequence. Among them, the nucleic acid sequences of sgRNA1 and sgRNA2 are shown in SEQ ID NO.4 and 5 respectively.

4. The construction method according to claim 3, wherein After the target site design, the method for constructing a mouse model includes the following steps: (1) After superovulation of the embryo donor female mouse, it was caged and mated with an adult fertile male mouse. (2) The next day, after obtaining the fertilized eggs, the ribonucleoprotein complex containing the guide RNA, Cas9 protein, and the recombinant expression vector of the target sequence was injected into the nucleus of the fertilized eggs and cultured. (3) The fertilized eggs injected with the foreign gene were transplanted into the body of the surrogate mother mouse. After giving birth, the F0 generation mice were obtained and PCR was used for genotyping identification. (4) The positive F0 generation mice were mated with wild-type opposite-sex mice to screen positive F1 generation mice, indicating the successful establishment of the strain.

5. The construction method according to claim 4, characterized in that: Among them, In step (1), the method for superovulation of the embryo donor mouse is as follows: C57BL / 6J female mice at 3-4 weeks were screened, and the donor female mice were treated with pregnant mare serum PMSG. After 46-48 hours, human chorionic gonadotropin HCG was injected, and then they were caged and mated with adult fertile male mice.

6. The construction method according to claim 4, characterized in that: Among them, In step (2), the preparation method of the ribonucleoprotein complex is as follows: First, crRNA and tracrRNA that can bind to form the sgRNA sequence were artificially synthesized; then crRNA was added to RNase-free water, and then tracrRNA was added and mixed and incubated. After that, Cas9 protein was added and mixed and incubated to obtain a mixture, which was then mixed with the target sequence plasmid as the targeting vector to obtain the RNP injection complex. After the injection of the fertilized eggs was completed, they were transferred to the culture medium and placed in an incubator. After culturing for 0.5-1 h, transplantation was carried out; or cultured to the 2-cell stage and transplanted the next day.

7. A WARS2 point mutant mouse model, characterized in that, It was constructed by using the method described in any one of claims 1-6.

8. Application of the WARS2 site-directed mutagenesis mouse model according to claim 7 in screening or developing therapeutic drugs for Parkinson's disease.

Images