Pest control method based on transgenosis

Abstract

The invention relates to the technical field of pest control, and particularly discloses a pest control method based on transgenosis, two pairs of toxin / antitoxin genes are crossed and combined in a transgenosis mode and then are respectively inserted into the same site of a pair of homologous chromosomes (two chromosomes) of a pest, and the obtained two homologous chromosomes cannot be separated; if the two homologous chromosomes are separated, the polypide is dead. Male and female transgenic pests comate, half offspring survives, but the offspring dies when the transgenic pests comate with wild pests, so that the purpose of limiting breeding of the pests or replacing wild populations is achieved. The pest control method provided by the invention does not depend on compounds such as tetracycline and the like, is environment-friendly, and improves the fatality rate of offspring of pests, limits the reproduction of the pests, or reduces the carrying and propagation of pathogenic microorganisms and reduces direct or indirect harm caused by the pests in a manner of releasing transgenic pests.

Description

Technical Field

[0001] The present invention relates to the technical field of pest control, and in particular to a pest control method based on transgenic technology. Background Art

[0002] Harmful insects severely damage crops and vegetation, resulting in significant economic losses each year. While current pest control methods offer high efficacy, they also have limitations, such as increasing pest resistance and causing environmental damage. Therefore, developing new, environmentally friendly pest control methods is crucial.

[0003] Traditional pest control technologies include physical control, chemical control, and biological control. Physical control is labor-intensive, inefficient, requires specific instruments and facilities, is inconvenient, and has limited field operations, making it more suitable for dealing with stored-grain pests. While chemical control methods kill harmful organisms, they also harm beneficial organisms, disrupting the ecological balance. Pesticide residues can easily cause secondary pollution, and long-term use can easily lead to pesticide resistance in pests, kill natural enemies, and disrupt the ecological balance. Biological control methods are usually slow to take effect, and may not be able to be effectively controlled after a large-scale outbreak of pests. They are unstable, have a narrow scope of application, are affected by natural environmental conditions, and are difficult to implement overall population management.

[0004] The concept of the sterile insect technique (SIT) was first proposed in the 1930s and 1940s. Typically, sterile male insects are released into wild populations. These males compete with wild females for mating, and the females are unable to produce offspring. This leads to a continuous decline in the target pest population, ultimately leading to extinction or control at a desired density. However, traditional SIT uses radiation or chemicals to induce sterility in insect germ cells, significantly reducing the insects' viability and competitiveness. Therefore, a new approach to pest control is needed. Summary of the Invention

[0005] To develop a new pest control method, this invention provides a transgenic-based pest control method. Compared to mainstream genetic pest control methods, this pest control method does not rely on compounds such as tetracycline, is environmentally friendly, lacks the influence of potential resistance alleles, and has a low ecological risk. Furthermore, its lethality mechanism is conservative.

[0006] The present invention provides a transgenic-based pest control method, in which two pairs of toxin / antitoxin genes are cross-combined by transgenic means and then respectively inserted into the same site of a pair of homologous chromosomes (two chromosomes) of the pest, so that the pair of homologous chromosomes cannot be separated, thereby obtaining a transgenic mandarin duck chromosome pest strain, and pest control is achieved by releasing the transgenic mandarin duck chromosome pest strain into the environment.

[0007] The present invention uses transgenic technology to cross-combine two pairs of toxin / antitoxin genes and insert them into the same site on a pair of homologous chromosomes (two chromosomes) of the pest. This prevents the homologous chromosomes from separating, which would ultimately be lethal to the offspring, thereby limiting the pest's reproduction and achieving pest control. When releasing transgenic males, the offspring mortality rate reaches 99.62% to 99.67%, demonstrating a high lethality effect on the pest's offspring. When releasing both males and females together, the wild-type population can be replaced, preventing the spread of pathogenic microorganisms without affecting the population of the carrier insect itself.

[0008] Furthermore, the two pairs of toxin / antitoxin genes are selected from any two groups of the following toxin / antitoxin genes:

[0009] MazF / MazE, RelE / RelB, YafQ / DinJ, HigB / HigA and KiD / KiS.

[0010] The MazF gene sequence in the MazF / MazE system is shown in SEQ ID NO. 1, and the MazE gene sequence is shown in SEQ ID NO. 2. The ReelE gene sequence in the RelE / RelB system is shown in SEQ ID NO. 3, and the RelB gene sequence is shown in SEQ ID NO. 4. The YafQ gene sequence in the YafQ / DinJ system is shown in SEQ ID NO. 52, and the DinJ gene sequence is shown in SEQ ID NO. 53. The HigB gene sequence in the HigB / HigA system is shown in SEQ ID NO. 54, and the HigA gene sequence is shown in SEQ ID NO. 55. The KiD gene sequence in the KiD / KiS system is shown in SEQ ID NO. 56, and the KiS gene sequence is shown in SEQ ID NO. 57.

[0011] It should be noted that the two pairs of toxin / antitoxin genes can also be selected from other existing toxin / antitoxin genes, as long as the two pairs of toxin / antitoxin genes are different toxin / antitoxin genes.

[0012] Furthermore, the process of constructing a transgenic mandarin duck chromosome pest strain is as follows: constructing a first recombinant plasmid containing toxin A / antitoxin B genes and a marker gene, and constructing a second recombinant plasmid containing toxin B / antitoxin A genes and a marker gene; the toxin A and toxin B respectively represent different toxins, the antitoxin A gene is an antitoxin gene encoding a neutralizing toxin A, and the antitoxin B gene is an antitoxin gene encoding a neutralizing toxin B; the marker genes contained in the first recombinant vector and the second recombinant vector are different genes;

[0013] Early embryos of target pests are collected, and the first and second recombinant plasmids are injected into the pest embryos to complete site-specific insertion, thereby obtaining two transgenic positive pest strains;

[0014] Two transgenic positive pest strains are hybridized with wild-type pests to obtain offspring containing different screening marker genes, and then the two offspring containing different marker genes are hybridized to obtain mandarin duck chromosome pest strains.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] This invention establishes a new pest control method. Compared with mainstream genetic pest control methods, it does not rely on compounds such as tetracycline and is environmentally friendly. It also lacks the influence of potential resistance alleles, reducing ecological risks. Its lethal mechanism is conservative, with a mortality rate of 99.62% to 99.67%, and it effectively kills the offspring of the pest, making it difficult for the pest to reproduce and survive. It can subsequently be applied to a variety of organisms.

[0017] The present invention uses transgenic methods to cross-combine two pairs of toxin / antitoxin genes and insert them into the same site of a pair of homologous chromosomes (two chromosomes) of the pest. The resulting homologous chromosomes F and M cannot be separated. If F and M are separated, the insect body will die. When the resulting transgenic pests mate with males and females, half of the offspring survive, but when mating with wild-type pests, the offspring die, thereby achieving the purpose of limiting the reproduction of pests or replacing wild-type populations. The pest control method provided by the present invention does not rely on compounds such as tetracycline and is environmentally friendly. If the method of releasing male insects is adopted, the mortality rate is as high as 99.62% to 99.67%, and the lethal effect on the offspring of the pests is good; if the method of releasing males and females together is adopted, the wild-type population can be replaced to prevent the spread of pathogenic microorganisms, but the population size of the carrier insect itself is not affected. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 This is a diagram of the basic principles of mandarin duck chromosomes. In the figure, A is a normal cell containing mandarin duck chromosomes, which are a pair of homologous chromosomes consisting of F chromosomes and M chromosomes. B is the separation of mandarin duck chromosomes, F: chromosome from the father of the mandarin duck chromosome; M: chromosome from the mother of the mandarin duck chromosome; promoter: promoter; antitoxin: antitoxin; toxin: toxin.

[0020] Figure 2 The reproduction and lethality mechanisms of the Mandarin Duck chromosome Drosophila strain are shown in Figure A. A schematic diagram of the Mandarin Duck chromosome Drosophila strain is shown in Figure B. The reproduction mechanism of the Mandarin Duck chromosome Drosophila strain is shown in Figure C. One-quarter of the offspring have the genotypes FF and MM and are unable to survive, while one-half have the genotype FM and are able to survive and be reproduced and released. The lethality mechanism of the Mandarin Duck chromosome Drosophila strain is shown in Figure C. In the wild, when the Mandarin Duck chromosome strain is crossed with the wild type, the offspring die due to chromosome segregation and lack of the corresponding antitoxin to neutralize the toxin. F: Chromosome from the Mandarin Duck chromosome father; M: Chromosome from the Mandarin Duck chromosome mother; W: Chromosome from the wild type; Promoter: promoter; Antitoxin: antitoxin; Toxin: toxin.

[0021] Figure 3 Schematic diagram of the structure of the pYYCP expression vector; in the figure, Promoter: promoter for expressing antitoxin and toxin genes; FRT: FRT site; miniwhite: marker gene, expressing white eye gene; yellow: marker gene, expressing luteal gene; antitotxin: antitoxin gene; toxin: toxin gene; t2a: t2a connecting peptide; terminate: tailing signal; attB: attB site.

[0022] Figure 4 This is the process of constructing mandarin duck chromosome Drosophila strains; in the figure, A represents the use of phi C31 integrase site-specific recombination system to achieve DNA site-specific insertion to obtain transgenic Drosophila strains; B is the hybridization flow chart of transgenic Drosophila strains; C is the FRT site recombination principle; FRT: FRT site; miniwhite: marker gene, expressing white eye gene; yellow: marker gene, expressing yellow gene; antitotxin: antitoxin gene; toxin: toxin gene; attB: attB site; attP: attP site; attR: attR arm; attL: attL arm; +: wild-type genotype; Antitoxin-Toxin: antitoxin-toxin gene not expressed; Antitoxin-Toxin”: antitoxin-toxin gene expressed in some cells; Antitoxin-Toxin': normally expressed antitoxin-toxin gene.

[0023] Figure 5 Statistical chart of the number of offspring after hybridization between a mandarin duck chromosome Drosophila strain and a wild-type strain; WT: wild-type Drosophila strain; YYCP: mandarin duck chromosome Drosophila strain. *** indicates extremely significant difference: ***P < 0.001. DETAILED DESCRIPTION

[0024] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0025] The present invention provides a pest control method based on transgenic technology, which relates to the proposal of Yuanyang Chromosome Pair (YYCP).

[0026] The present invention proposes a novel concept: the Yuanyang Chromosome Pair (YYCP), a pair of homologous chromosomes F and M that are interdependent and mutually balancing. When both homologous chromosomes F and M coexist, the insect survives, while when the two chromosomes separate, the insect dies, similar to the inseparable pairing of mandarin ducks in ancient Chinese literature.

[0027] The principle of the present invention is shown in Figure 1 , Figure 1 The A in the figure represents a normal cell containing mandarin duck chromosomes, which consist of a pair of homologous chromosomes, the F chromosome and the M chromosome. Chromosome F contains toxin A and antitoxin B, while chromosome M contains toxin B and antitoxin A. Because both chromosomes exist simultaneously, toxin A can be neutralized by antitoxin A, and toxin B can be neutralized by antitoxin A, allowing the cell to grow and reproduce normally.

[0028] Figure 1 The "B" indicates that the B chromosomes are segregated in the mandarin ducks, with only one of the chromosomes, M, being passed down to the offspring. Due to the lack of antitoxin B, toxin B cleaves the target sequence through its nuclease mechanism, causing cell death. F comes from the chromosome of the mandarin duck's father; M comes from the chromosome of the mandarin duck's mother.

[0029] like Figure 2 As shown, when homologous chromosomes are present, the two toxins are neutralized by the corresponding antitoxins, and the insects survive. In the laboratory or factory, when the mandarin duck chromosome strains are self-fertilized, 1 / 4 of the offspring have the genotype FF and MM and cannot survive, while 1 / 2 of the offspring have the genotype FM and can survive and be used for reproduction and release ( Figure 2 B). In the wild, when a mandarin duck chromosome strain is crossed with a wild type, due to chromosome separation, all the offspring die due to lack of the corresponding antitoxin to neutralize the toxin ( Figure 2 C), to achieve the effect of genetic control of pests.

[0030] This invention pioneers the application of the Mandarin Duck chromosome concept in Drosophila melanogaster, constructing a Mandarin Duck chromosome transgenic fruit fly strain and providing a novel genetic pest control method. This method involves cloning toxin-resistant genes from Escherichia coli K-12 substr. MG1655 (E. coli) and Streptococcus pneumonia TIGR4 (S. pneumonia), designing and synthesizing corresponding expression vectors, and injecting the plasmids into Drosophila melanogaster embryos via microinjection. DNA insertion is then performed using the phi C31 integrase site-specific recombination system to create a transgenic fruit fly strain. Using different marker genes as selection markers, the relevant genes are then transferred to individual fruit flies through hybridization. FLP recombinase is then used to induce DNA recombination between FRT sites, thereby activating toxin gene expression and generating the Mandarin Duck chromosome fruit fly strain. When the Mandarin Duck chromosome strain is hybridized with a wild-type strain, the number of offspring is significantly reduced compared to a control group.

[0031] The present invention provides a pest control method based on transgenic plants, which comprises the following steps:

[0032] The present invention designs a vector for expressing transgene, which mainly contains toxin and antitoxin genes, promoter, marker gene and attB site, etc. Its structure is as follows Figure 3 shown.

[0033] The present invention designs a hybridization and induction process of transgenic Drosophila strains, which mainly includes the inheritance and separation of genes related to three Drosophila strains, and uses heat shock to express FLP recombinase to achieve FRT site recombination and express toxin genes to obtain mandarin duck chromosome Drosophila strains. The specific process is as follows: Figure 4 shown.

[0034] The invention establishes a mandarin duck chromosome fruit fly strain, and the number of offspring of the mandarin duck chromosome fruit fly strain hybridized with a wild type is significantly reduced.

[0035] Example 1: A method for controlling fruit flies based on transgenic technology.

[0036] 1. Experimental Methods

[0037] 1. Plasmid construction

[0038] Escherichia coli k-12 substr. MG1655 DNA was used as a template to clone the toxinA gene shown in SEQ ID NO.1 and the antitoxinA gene shown in SEQ ID NO.2. Streptococcus pneumoniae TIGR4 DNA was used as a template to clone the toxinB gene shown in SEQ ID NO.3 and the antitoxinB gene shown in SEQ ID NO.4. Drosophila genomic DNA was used as a template to clone the Drosophila phtm promoter, miniwhite marker gene (expressing the white eye gene), and yellow marker gene (expressing the corpus luteum gene) listed in Table 1. Other molecular elements in Table 1: T2A was amplified using the pxlbacII-WSSVIE1-Csy4-T2A-NeoR-HsvtPolyA plasmid template, Terminate (SV40 PolyA signal) was amplified using the pFastBac-Dual plasmid template, attB was amplified using the pEasyBlunt-attB plasmid template, and FRT3 and FRT5 were amplified using the pet-2p-FRT3-EGFP and pet-2p-FRT5-mCherry plasmid templates, respectively. The corresponding primer information is shown in Table 1.

[0039] SEQ ID NO.1:

[0040] ATGGTAAGCCGATACGTACCCGATATGGGCGATCTGATTTGGGTTGATTTTGACCCGACAAAAGGTAGCGAGCAAGCCGGACATCGTCCGGCTGTTGTCCTGAGTCCGTTCATGTACAACAAAACAGGTATGTGTCTGTGTGTTCCTTGTACAACGCAATCAAAA GGATATCCGTTCGAAGTTGTTTTATCCGGTCAGGAACGTGATGGCGTAGCGTTAGCTGATCAGGTAAAAAGTATCGCCTGGCGGGCAAGAGGAGCAACGAAGAAAGGAACGGTTGCCCCAGAGGAATTACAACTCATTAAAGCCAAAATTAACGTACTGATTGGGTAG.

[0041] SEQ ID NO.2:

[0042] ATGATCCACAGTAGCGTAAAGCGTTGGGGAAATTCACCGGCGGTGCGGATCCCGGCTACGTTAATGCAGGCGCTCAATCTGAATATTGATGATGAAGTGAAGATTGACCTGGTGGATGGCAAATTAATTATTGAGCCAGTGCGTAAAGAGCCCGTATTTACGCTTGCTGAACTGGTCAACGACATCACGCCGGAAAACCTCCACGAGAATATCGACTGGGGAGAGCCGAAAGATAAGGAAGTCTGGTAA。

[0043] SEQ ID NO.3:

[0044] ATGTATAAATTAGTTCCAACAAGACGTTTTATCAAGCAATTGAAAAAATTGGACCGTTATACGCAGAAGCTAATTACAAACTATTTACAAACCAATGTTTTGGAAGACCCAAGACGACACGGAAAGGCTTTGGTTGGTAATCGCGTTGGTCAATGGCGCTATAGAATTGGTAATTATCGAGTTATCGTACAAATTGTAGATGATGAATTAGTCGTTGCTACTCTAGAAGTTGGTCATCGGAGAGATATTTATTGA。

[0045] SEQ ID NO.4:

[0046] ATGACTGAACACCTAAAAAGTAATACAATGGTGTTACCATTAAAAAAGGGAGCACAAAAGATGACTACTATTACATTAAAAGTTTCTGAAGCTGATAAAACATTTATGAAAGCAATGGCTAAGTTTGAAGGAGTTTCCCTTTCGGAACTTATTCGCACCAAAACTCTTGAAGCCCTAGAAGATGAATACGATGCTCGTGTGGCAGATTTAGCCTATCAAGAGTATTTAGAAGACTTGGAAAAAGGAGTTGAACCCATTACTTGGGAAGAAATGATGCATGATTTAGGCTTGAAGGATGAATAA。

[0047] Table 1 Primer information required for cloning of each molecular element

[0048]

[0049]

[0050] The PCR system was prepared according to the instructions for Ex Taq enzyme from Takara, Japan. The PCR system consisted of: 50 μL, 10 ng template, 1 μL upstream primer, 1 μL downstream primer, 0.25 μL TakaRa Ex Taq, 5 μL 10X Ex Taq Buffer, 4 μL dNTP Mixture, and sterile water to 50 μL.

[0051] PCR reaction conditions: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and annealing at 72°C for 1 min; extension at 72°C for 10 min, and storage at 4°C. PCR products were detected by 1% agarose gel electrophoresis and stained with ethidium bromide (EB). Electrophoresis results were observed under UV light. Correct fragments were detected by gel excision and purified using the AxyGen DNA Gel Extraction Kit.

[0052] The basic plasmid pYYCP-basic was constructed in the laboratory and contains the Terminate (Sv40 PolyA signal) and attB sites. The nucleotide sequence of the basic plasmid pYYCP-basic is shown in SEQ ID NO. 29.

[0053] The antitoxinB, T2A, and toxinA fragments were spliced by fusion PCR and digested with the restriction enzymes XbaI and KpnI. The purified digestion product was ligated into pYYCP-basic to generate the pYYCP-antitoxinB-T2A-toxinA recombinant vector. The FRT3 and miniwhite fragments were spliced by fusion PCR and digested with the restriction enzymes KpnI and NotI. The purified digestion product was ligated into the pYYCP-antitoxinB-T2A-toxinA recombinant vector pYYCP-antitoxinB-T2A-toxinA-FRT3-miniwhite recombinant vector. The FRT3 and phtm promoter fragments were spliced by fusion PCR and then digested with restriction endonucleases NotI and SpeI. The purified digestion product was ligated into pYYCP-antitoxinB-T2A-toxinA-FRT3-miniwhite to obtain the pYYCP-antitoxinB-T2A-toxinA-FRT3-miniwhite-FRT3-phtm recombinant plasmid, referred to as the first pYYCP recombinant plasmid.

[0054] The antitoxinA, T2A, and toxinB fragments were spliced by fusion PCR and digested with the restriction enzymes XbaI and BstEII. The purified digestion product was ligated into pYYCP-basic to generate the pYYCP-antitoxinA-T2A-toxinB recombinant vector. The FRT5 and yellow fragments were spliced by fusion PCR and digested with the restriction enzymes BstEII and NotI. The purified digestion product was ligated into the pYYCP-antitoxinA-T2A-toxinB recombinant vector to generate the recombinant vector pYYCP-antitoxinA-T2A-toxinB-FRT5-yellow. The fragments FRT5, phtm and attB were spliced by fusion PCR and then digested with restriction endonucleases NotI and SacI. The purified digestion products were ligated to pYYCP-antitoxinA-T2A-toxinB-FRT5-yellow-FRT5-phtm-attB to obtain the pYYCP-antitoxinA-T2A-toxinB-FRT5-yellow-FRT5-phtm recombinant plasmid, referred to as the pYYCP second recombinant plasmid.

[0055] The vector maps of the pYYCP-antitoxinB-T2A-toxinA-FRT3-miniwhite-FRT3-phtm recombinant plasmid and the pYYCP-antitoxinA-T2A-toxinB-FRT5-yellow-FRT5-phtm recombinant plasmid are as follows Figure 3 As shown in the figure, antitoxin represents antitoxinB or antitoxinA, toxin represents toxinA or toxinB, and FRT represents FRT3 or FRT5.

[0056] The pYYCP-antitoxinB-T2A-toxinA-FRT3-miniwhite-FRT3-phtm recombinant plasmid and the pYYCP-antitoxinA-T2A-toxinB-FRT5-yellow-FRT5-phtm recombinant plasmid were transformed into Beijing Gold T1 competent cells and cultured overnight in ampicillin-resistant LB medium. After overnight culture, eight positive clones were selected for PCR verification (system and conditions were the same as above). Fresh bacterial culture of clones that showed positive results from PCR amplification of colonies was sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. After sequence verification, the relevant plasmids were extracted.

[0057] 2. Drosophila Embryo Microinjection

[0058] The Drosophila strain used for microinjection is BDSC:24749 (y1 M{vas-int.Dm}ZH-2A w*; M{3xP3-RFP.attP}ZH-86Fb), which contains the phi C31 integrase and an attP site. This strain is from the Bloomington Drosophila Stock Center (BDSC) and was purchased from the Shanghai Drosophila Resource and Technology Platform. The phi C31 integrase automatically recognizes the attB site in the plasmid and the attP site in the fruit fly during microinjection, enabling site-specific insertion.

[0059] Pre-lay the flies for microinjection in advance to ensure a sufficient number of embryos are collected. The day before microinjection, collect the fruit flies and place them on a grape juice medium (recipe: 100 mL of water, 2.2 g of sucrose, 1.4 g of agar, and 0.5 mL of glacial acetic acid). Apply yeast paste to the center of the grape juice medium and keep it dark-proof. Change the grape juice medium every hour to adjust the fruit flies' circadian rhythm and acclimate them to daytime egg laying. If the number of embryos is sufficient, proceed with microinjection. Before injection, rinse the eggs with sodium hypochlorite solution to remove the hard outer layer. Collect the embryos from the juice medium every hour and place them on an embryo strainer. Rinse the strainer with pure water to remove yeast and other impurities. Then soak the strainer in sodium hypochlorite solution for 45 seconds, rinse with water for 1 minute, and then rinse with pure water for 30 seconds. After rinsing, arrange the embryos on a glass slide covered with double-sided tape and keep them in a cool environment to slow embryonic development. After the embryos are arranged, apply a layer of mineral oil to moisturize them.

[0060] The specific steps for microinjection are as follows: Microinjection is performed at 18°C and a humidity level of at least 60%. The glass slide with the embryo is placed under the microscope of the microinjection instrument. The micromanipulation stage is moved to adjust the glass capillary needle to the appropriate position. The focus is adjusted so that the needle tip and the embryo are in contact. The injection solution is then injected into the posterior end of the embryo.

[0061] Mix the pYYCP-antitoxinB-T2A-toxinA-FRT3-miniwhite-FRT3-phtm and pYYCP-antitoxinA-T2A-toxinB-FRT5-yellow-FRT5-phtm recombinant plasmids with microinjection buffer to a final concentration of 800 ng / μL. Microinjection buffer: 5 mmol / L KOH, 0.5 mmol / L NaH2PO4, 0.1 mol / L NaOH, adjusted to pH 7.2, and filter-sterilized. Centrifuge the mixture at 14,000 x g for 10 minutes, and remove 17 μL of the supernatant for microinjection. Each plasmid mixture was injected into 400 embryos to obtain the corresponding transgenic lines.

[0062] The microinjected embryos were cultured on corn culture medium at 18°C. The corn culture medium formula was as follows: 1000 mL of water, 6 g of agar, 40 g of sucrose, 41 g of maltose, 9.6 g of soybean powder, 66 g of corn flour, 25 g of yeast, and 10 mL of propionic acid.

[0063] 3. Identification and screening of positive fruit flies

[0064] Larvae that hatched 72 hours after injection were transferred to corn culture medium and cultured at 25°C for 5 days. Male and virgin flies of the G0 generation were promptly selected and crossed with virgin and male flies of the ywR13s strain, respectively. After crossing, the flies were cultured at 25°C, and G1 generations were observed approximately 10 days later. Expression of the miniwhite marker gene causes the fly's compound eyes to turn red; expression of the yellow marker gene causes the fly's body color to turn black. Flies expressing the corresponding traits of each marker gene on the plasmid were selected to preliminarily determine whether they were transgenic flies.

[0065] Drosophila carrying the marker gene trait and a balancer strain (ywR13S:yw; sp / Cyo; MKRS / TM2) were hybridized, and the G2 generation of offspring was screened for heterozygous flies that carried both the marker gene and the balancer trait on chromosome 3. The G2 generation was self-pollinated, and flies carrying only the marker gene were selected from the progeny to form the homozygous G3 generation. Stable homozygous transgenic lines were obtained by self-pollination of the G3 generation. Genomic DNA was then extracted from the flies, and the relevant inserted gene was identified by PCR.

[0066] 4. Construction of Drosophila strains with mandarin duck chromosomes

[0067] Hybridization process see Figure 4 The B and F1 generations are the transgenic fruit fly strains and the fruit fly strains carrying the FLP gene BDSC:6934 (y 1 w * ;P{70FLP}11P{70I-SceI}2B sna Sco / CyO,S 2 ) hybridization, according to the positive marker (miniwhite / yellow) and balancer (sna Sco ) trait screening of the next generation. The F2 generation is a fruit fly carrying the AntitoxinB-ToxinA genotype and a fruit fly carrying the AntitoxinA-ToxinB genotype. The positive marker (miniwhite / yellow) and the balancer (sna Sco ) traits to screen the F3 generation of fruit flies. The F3 generation fruit flies are self-pollinated AntitoxinB-ToxinA / AntitoxinA-ToxinB fruit flies. The parents are removed 3 days after mating, and the 2nd instar larvae are heat-shocked in a 37°C water bath for 30 minutes to induce recombination between FRT sites, which lasts for 4 days. After the offspring emerge, their traits are observed, and the chimeric fruit flies are selected as the F4 generation. The F4 generation fruit flies are chimeric fruit flies, that is, a part of the cells develop into a recombinant fruit fly strain, and the genotype is marked as AntitoxinB-ToxinA" / AntitoxinA-ToxinB". The F4 generation fruit flies are self-pollinated, and according to the traits (y 1 w * ) Select the offspring fruit flies as the F5 generation. The F5 generation fruit flies are the offspring of the F4 generation fruit flies' germ cells recombined. At this point, all cells developed from the germ cells have undergone recombination, and the genotype is marked as AntitoxinB-ToxinA' / AntitoxinA-ToxinB', which is the Mandarin Duck chromosome fruit fly strain.

[0068] 5. Release and application of mandarin duck chromosome Drosophila strain

[0069] The mandarin duck chromosome fruit fly strain is hybridized with the wild-type fruit fly strain to reduce the number of hybrid offspring, thereby achieving control of fruit fly pests.

[0070] Mandarin duck chromosome fruit fly strains and wild-type fruit fly strains were placed in 24mm*95mm fruit fly breeding tubes for hybridization, with 3 female fruit flies and 3 male fruit flies in each tube. After mating for 5 days, the number of adults in each tube was counted within 15 days.

[0071] The control group consisted of 3 wild-type females and 3 wild-type males, treatment group 1 consisted of 3 female mandarin duck chromosome fruit flies and 3 wild-type males, and treatment group 2 consisted of 3 wild-type female fruit flies and 3 wild-type males.

[0072] The results are as follows Figure 5As shown, compared with the control group, the number of offspring in the treated groups was almost zero, with a lethality rate of 99.62% in Treatment 1 and 99.67% in Treatment 2. This indicates that the mandarin duck chromosome fruit fly strain can significantly suppress the offspring population through hybridization with wild-type fruit flies, and the toxin in its genome has a lethal effect on the offspring.

[0073] Example 2: A transgenic-based method for controlling Aedes aegypti.

[0074] 1. Experimental Methods

[0075] The attP site was introduced into the mosquito genome using the piggybac transposon to construct a transgenic mosquito strain containing the attP site. The mosquito species was Aedes aegypti. The steps for constructing a transgenic mosquito strain containing the attP site are described in the public document "High efficiency site-specific genetic engineering of the mosquito genome. Insect Mol Biol. doi: 10.1111 / j.1365-2583.2006.00615.x". The marker genes of the two recombinant plasmids in Example 1 were replaced with fluorescent marker genes, and the promoter was changed to the promoter of Aedes aegypti. This example constructs the mandarin duck chromosome Aedes aegypti strain based on the attP strain of Aedes aegypti. The specific method is as follows:

[0076] 1. Plasmid Construction

[0077] The Aedes aegypti phtm promoter, shown in SEQ ID NO. 30, was cloned using Aedes aegypti genomic DNA as a template. Other molecular components listed in Table 2: Terminate (HSV TK PolyA signal) shown in SEQ ID NO. 31, mCherry shown in SEQ ID NO. 32, and acie1 shown in SEQ ID NO. 33 were amplified using the pXLJ-BacII-acie1-mCherry-HSV TKPolyA plasmid template; EGFP shown in SEQ ID NO. 34 was amplified using the pXLJ-BacII-Acie1-EGFP-HSV TKPolyA plasmid template. The corresponding primer information is shown in Table 2.

[0078] SEQ ID NO. 31: GAACAAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATTGCCG.

[0079] SEQ ID NO.32:

[0080] ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAAACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGG CGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTGA。

[0081] SEQ ID NO.33:

[0082] GATGTCTTTGTGATGCGCGCGACATTTTTGTAGGTTATTGATAAAATGAACGGATACGTTGCCCGACATTATCATTAAATCCTTGGCGTAGAATTTGTCGGGTCCATTGTCCGTGTGCGCTAGCATGCCCGTAACGGACCTCGTACTTTTGGCTTCAAAGGTTTTGCGCACAGACAAAATGTGCCACACTTGCAGCTCTGCATGTGTGCGCGTTACCACAAATCCCAACGGCGCAGTGTACTTGTTGTATGCAAATAAATCTCGATAAAGGCGCGGCGCGCGAATGCAGCTGATCACGTACGCTCCTCGTGTTCCGTTCAAGGACGGTGTTATCGACCTCAGATTAATGTTTATCGGCCGACTGTTTTCGTATCCGCTCACCAAACGCGTTTTTGCATTAACATTGTATGTCGGCGGATGTTCTATATCTAATTTGAATAAATAAACGATAACCGCGTTGGTTTTAGAGGGCATAATAAAAGAAATATTGTTATCGTGTTCGCCATTAGGGCAGTATAAATTGACGTTCATGTTGGATATTGTTTCAGTTGCAAGTTGACACTGGCGGCGACAAGATCGTGAACAACCAAGTGACTATTACGCAAATTAATTTTAACGCG。

[0083] SEQ ID NO.34:

[0084] .

[0085] Table 2 Primer information required for cloning each molecular element

[0086]

[0087] The PCR system was prepared according to the instructions for Ex Taq enzyme from Takara, Japan. The PCR system consisted of: 50 μL, 10 ng template, 1 μL upstream primer, 1 μL downstream primer, 0.25 μL TakaRa Ex Taq, 5 μL 10X Ex Taq Buffer, 4 μL dNTP Mixture, and sterile water to 50 μL.

[0088] PCR reaction conditions: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and annealing at 72°C for 1 min; extension at 72°C for 10 min, and storage at 4°C. PCR products were detected by 1% agarose gel electrophoresis and stained with ethidium bromide (EB). Electrophoresis results were observed under UV light. Correct fragments were detected by gel excision and purified using the AxyGen DNA Gel Extraction Kit.

[0089] The pYYCP-antitoxinB-T2A-toxinA-FRT3-mCherry-FRT3-phtm recombinant plasmid and the pYYCP-antitoxinA-T2A-toxinB-FRT5-EGFP-FRT5-phtm recombinant plasmid were constructed and preserved according to the method in Example 1.

[0090] The fragments FRT5, HSV TK PolyA signal-EGFP-Acie1 and phtm (A.aegypti) were synthesized by fusion PCR and then digested with restriction endonucleases KpnI and NotI. The purified digestion products were ligated to the pYYCP-antitoxinA-T2A-toxinB-FRT5-EGFP-FRT5-phtm recombinant plasmid to obtain the pYYCP-antitoxinA-T2A-toxinB-FRT5-HSVTK PolyA signal-EGFP-Acie1-FRT5-phtm (A.aegypti) recombinant plasmid, referred to as the pYYCP third recombinant plasmid.

[0091] The fragments FRT3, HSV TK PolyA signal-mCherry-Acie1 and phtm (A.aegypti) were synthesized by fusion PCR and then digested with restriction endonucleases KpnI and NotI. The purified digestion products were ligated to the pYYCP-antitoxinB-T2A-toxinA-FRT3-mCherry-FRT3-phtm recombinant plasmid to obtain the pYYCP-antitoxinB-T2A-toxinA-FRT3-HSV TK PolyA signal-mCherry-Acie1-FRT3-phtm (A.aegypti) recombinant plasmid, referred to as the pYYCP fourth recombinant plasmid.

[0092] See the vector maps of the third recombinant plasmid pYYCP and the fourth recombinant plasmid pYYCP for details. Figure 3 Only the promoter and marker gene are replaced, and the positions of the relevant originals are the same Figure 3 consistent.

[0093] The pYYCP3 and pYYCP4 recombinant plasmids were transformed into Beijing Gold competent cells T1 and cultured overnight in ampicillin-resistant LB medium. After overnight culture, eight positive clones were selected for PCR verification (using the same system and conditions as above). Fresh bacterial culture was sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing after the sequences were verified.

[0094] 2. Mosquito Embryo Microinjection

[0095] For example, the Aedes aegypti mosquito strain used for microinjection was the previously constructed strain containing the attP site. The transfection was performed using the Message Machine kit (Ambion, Austin, TX) from pET11phiC31 poly(A). After DNase treatment, the transfection was purified using MegaClear (Ambion) and dissolved in 15 μL of enzyme-free water. The phiC31 integrase enzyme automatically recognizes the attB site in the plasmid and the attP site in the A. aegypti mosquito during microinjection, completing the site-specific insertion.

[0096] Use a sucker to collect 10 blood-fed female mosquitoes, transfer them to a fruit fly feeding tube, and allow them to lay eggs in a dark environment for 1 hour and 15 minutes. Subsequently, remove the filter paper with the embryos and prepare for embryo arrangement. Under a dissecting microscope, select healthy gray to dark gray embryos and arrange them on moistened filter paper using fine tweezers or a paintbrush, ensuring that the posterior pole of all embryos is facing the same direction. Use dry filter paper to gently absorb water and allow the embryos to dry slightly (about 1 minute), then cover with mineral oil to prevent over-drying. Inject the DNA solution (1.5μL, 400ng / μL) into a glass capillary needle, use a horizontal needle insertion method, puncture the embryo at the posterior pole, and inject 0.3nL of solution (about 3% of the embryo volume). Simultaneously inject 150ng / μL of phiC31mRNA. After injection, the embryo should return to a plump state. After the injection is completed, use fine tweezers to transfer the injected embryo to a plastic beaker with moistened filter paper, cover with a paper towel and secure with a rubber band, and place it in an insect culture room for 4 days. After four days, the embryo paper (embryo side down) was placed in a large plastic box filled with water and allowed to hatch for five weeks, with regular observation during this period. The offspring of Aedes aegypti carrying the marker gene trait were selected and hybridized with wild-type mosquitoes. The offspring were screened for those containing the marker gene (green or red fluorescence) as the G1 generation. The G1 generation was self-pollinated to obtain the G2 generation. Homozygotes and heterozygotes were identified based on PCR genotyping, and stably inherited homozygous G3 offspring were obtained. Aedes aegypti with the AntitoxinB-ToxinA and AntitoxinA-ToxinB genotypes were mated. Since the parents were homozygous, the offspring would inevitably inherit two chromosomes containing the AntitoxinB-ToxinA and AntitoxinA-ToxinB genes, respectively. Embryos were collected according to the above method and injected with FLP recombinase according to the corresponding procedures. Eighteen hours after injection, the injected embryos were heat-shocked in a 37°C water bath for one hour to induce recombination between the FRT sites. After the offspring mature, their traits are observed, and genotyping is performed using PCR to identify chimeric Aedes aegypti. A chimeric Aedes aegypti is a strain in which a portion of its cells have undergone recombination, with the genotype marker AntitoxinB-ToxinA” / AntitoxinA-ToxinB. These chimeric Aedes aegypti are self-pollinated, and the offspring are selected based on their traits. The offspring without the marker gene represent germ cell recombination in Aedes aegypti, where all cells developing from the germ cells have undergone recombination, with the genotype marker AntitoxinB-ToxinA' / AntitoxinA-ToxinB', indicating a strain with Mandarin Duck chromosomes.

[0097] The subsequent control plan is the same as that for fruit flies in the embodiment, by releasing the Aedes aegypti strain containing mandarin duck chromosomes and hybridizing with the wild type to reduce the number of offspring, thereby achieving control of the Aedes aegypti vector insects.

[0098] aegypti were reared under standard insectary conditions at 27°C and 80% relative humidity. Larvae were fed fish diet, and adults were fed 0.2 μm-filtered 10% glucose and 14 U / mL penicillin / 14 μg / mL streptomycin.

[0099] The above method can also be used for other mosquito vector insects, such as Anopheles gambiae and Aedes albopictus. Different mosquito species only have operational differences based on the requirements when constructing transgenic strains. For example, the embryo injection of Anopheles gambiae requires 15° injection, and the embryo must be kept moist throughout the process.

[0100] Example 3: A method for controlling Chilo suppressalis based on transgenics.

[0101] Other agricultural pests currently lack background strains containing the attP site, so it is necessary to first construct a transgenic Chilo suppressalis strain containing the attP site. The attP site can be introduced into the Chilo suppressalis genome using the piggybac transposon.

[0102] The plasmid p3E1.2-3XP3-EYFP-HSVTKPOLYA-attP containing attP in this example was constructed in the laboratory. The nucleotide sequence of p3E1.2-3XP3-EYFP-HSVTKPOLYA-attP is shown in SEQ ID NO.45.

[0103] 2. Construction of Chilo suppressalis strains containing attP sites

[0104] Chilo suppressalis (Chilo suppressalis) were maintained in glass tubes containing artificial diet, the tubes sealed with black cloth. Thirty individuals were housed in each tube. Egg masses laid on rice leaves were removed, treated with a diluted 84 disinfectant (84 disinfectant: water ratio of 1:1 by volume) for 30 minutes, and then rinsed thoroughly with distilled water. Eggs were then laid on solid agar under a microscope, arranged with slight gaps between them. The eggs were then attached to a coverslip with double-sided tape, dried for 20 minutes, and covered with mineral oil. The p3E1.2-3XP3-EYFP-HSVTKPOLYA-attP plasmid was mixed with microinjection buffer. The injection solution was drawn into a glass capillary needle and injected using a microinjector. Microinjected eggs were placed in a test tube containing diet and incubated in an incubator at 28 ± 1°C with a 16 h:8 h light:dark cycle. After the embryos develop into adults, the presence of the yellow fluorescent EYFP marker gene in their eyes can be observed to determine if the attP site has been transferred. After mating the adults with wild-type insects, the F1 generation is screened for individuals containing the marker gene, identifying them as stable heterozygotes. After self-pollinating the F1 heterozygotes, homozygous F2 lines are selected based on PCR, resulting in transgenic lines containing the attP site that are stably inherited. These lines can be used as a basis for constructing mandarin duck chromosome-derived Chilo suppressalis lines.

[0105] 3. Plasmid Construction

[0106] Except that the promoter for expressing toxin and antitoxin was the Chilo suppressalis phtm gene promoter, the rest of the plasmid structure was the same as that used in constructing the mandarin duck chromosomal transgenic mosquito strain in Example 2. The Chilo suppressalis phtm promoter shown in SEQ ID NO. 46 was cloned using Chilo suppressalis genomic DNA as a template.

[0107] SEQ ID NO.46:

[0108]

[0109] Table 4 Primer information required for cloning each molecular element

[0110] molecular elements Upstream primer (5'-3') Downstream primer (5'-3') Chilo suppressalis phtm promoter SEQ ID NO.47: aaaaaacagcacaaagagga SEQ ID NO.48:gtgctcctacctctctgaat

[0111] The PCR system was prepared according to the instructions for Ex Taq enzyme from Takara, Japan. The PCR system consisted of: 50 μL, 10 ng template, 1 μL upstream primer, 1 μL downstream primer, 0.25 μL TakaRa Ex Taq, 5 μL 10X Ex Taq Buffer, 4 μL dNTP Mixture, and sterile water to 50 μL.

[0112] PCR reaction conditions: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and annealing at 72°C for 1 min; extension at 72°C for 10 min, and storage at 4°C. PCR products were detected by 1% agarose gel electrophoresis and stained with ethidium bromide (EB). Electrophoresis results were observed under UV light. Correct fragments were detected by gel excision and purified using the AxyGen DNA Gel Extraction Kit.

[0113] The fragment phtm ( C. suppressalis ) was digested with restriction enzymes BspTI and BcuI, and the digestion products were purified and ligated into pYYCP-antitoxinB-T2A-toxinA-FRT3-HSV TK PolyA signal-mCherry-Acie1-FRT3-phtm ( A. aegypti ) and pYYCP-antitoxinA-T2A-toxinB-FRT5-HSV TK PolyAsignal-EGFP-Acie1-FRT5-phtm ( A. aegypti ), respectively, to obtain the pYYCP-antitoxinB-T2A-toxinA-FRT3-HSV TK PolyA signal-mCherry-Acie1-FRT3-phtm ( C. suppressalis ) recombinant plasmids, referred to as pYYCP fifth and pYYCP-antitoxinA-T2A-toxinB-FRT5-HSV TK PolyA signal-EGFP-Acie1-FRT5-phtm ( A. aegypti ). signal-EGFP-Acie1-FRT5-phtm (C. suppressalis) recombinant plasmid, abbreviated as pYYCP sixth recombinant plasmid.

[0114] 4. Construction of Mandarin Duck Chromosome Chilo suppressalis Line

[0115] The microinjection method is described in Section 2 of this example. The subsequent mating screening protocol is similar to the mosquito screening process in Example 2, so the detailed description of the experimental steps will not be repeated here.

[0116] Example 4: Construction of mandarin duck chromosome transgenic brown planthopper based on the mandarin duck chromosome concept.

[0117] The overall process of this example is the same as that of Example 3. First, a transgenic brown planthopper (Nilaparvata lugens) containing an attP site was constructed. The mandarin duck chromosomal transgenic brown planthopper (Nilaparvata lugens) was then site-specifically inserted into the N. lugens genome using the phic31 recombinase. Subsequently, a mandarin duck chromosomal transgenic brown planthopper line was constructed using the same screening process as Example 3. The promoter that exclusively expresses the toxin-antitoxin was replaced with the promoter of the N. lugens phtm gene. The phtm (N. lugens) promoter shown in SEQ ID NO. 49 was cloned using N. lugens DNA as a template. The corresponding primer information is shown in Table 5.

[0118] SEQ ID NO.49:

[0119]

[0120] Table 5 Primer information required for cloning each molecular element

[0121] molecular elements Upstream primer (5'-3') Downstream primer (5'-3') brown planthopper phtm promoter SEQ ID NO.50: aacataaaagtaggaagagg SEQ ID NO.51: aatctaactaaccttgtatt

[0122] The remaining plasmid construction steps were the same as in Example 3, and finally the pYYCP-antitoxinB-T2A-toxinA-FRT3-HSV TK PolyA signal-mCherry-Acie1-FRT3-phtm (N. lugens) recombinant plasmid, referred to as the seventh pYYCP recombinant plasmid, and the pYYCP-antitoxinA-T2A-toxinB-FRT5-HSV TK PolyA signal-EGFP-Acie1-FRT5-phtm (N. lugens) recombinant plasmid, referred to as the eighth pYYCP recombinant plasmid, were obtained.

[0123] The construction of the mandarin duck chromosome brown planthopper strain followed the same core design principles as Example 2 (mosquito model), with only slight differences in the microinjection procedure.

[0124] The brown planthopper (NLP) microinjection procedure is as follows: embryos within 5 hours of egg laying are carefully removed from rice stems and placed on moist filter paper. The injection plasmid is mixed with microinjection buffer and injected into the NLP embryos using a microinjector. After injection, the embryos are transferred to a humid environment and incubated for 6 days until eyespot pigmentation develops. Positive NLP strains are subsequently screened using marker genes and PCR.

[0125] The mandarin duck chromosome pest control method established by the present invention can be used for a variety of pest management, further enriching the technology of pest genetic control. Based on the application of the above embodiment, the concept of mandarin duck chromosomes can theoretically be extended to all pests or insect vectors suitable for embryo microinjection. In addition, by replacing different toxin expression promoters, spatiotemporal specific regulation can be achieved, such as targeting specific insect ages (such as larval stages) or tissues (such as flight muscles), thereby establishing a precise genetic control strategy.

[0126] Although preferred embodiments of the present invention have been described, additional changes and modifications to these embodiments may occur to those skilled in the art once the basic inventive concepts become known.

[0127] Obviously, those skilled in the art may make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if such modifications and variations fall within the scope of the claims and their equivalents, the present invention is intended to include such modifications and variations.

Claims

1. A transgenic pest control method, characterized in that: Through genetic modification, two pairs of toxin / antitoxin genes are cross-combined and inserted into the same site of a pair of homologous chromosomes of the pest, making the pair of homologous chromosomes unable to separate, thereby obtaining a transgenic mandarin duck chromosome pest strain. Pest control is achieved by releasing the transgenic mandarin duck chromosome pest strain into the environment.

2. The transgenic pest control method according to claim 1, characterized in that: The two pairs of toxin / antitoxin genes are selected from any two groups of the following toxin / antitoxin genes: MazF / MazE, RelE / RelB, YafQ / DinJ, HigB / HigA and KiD / KiS.

3. The transgenic pest control method according to claim 1, characterized in that: The process of constructing a transgenic mandarin duck chromosome pest strain is as follows: constructing a first recombinant plasmid containing toxin A / antitoxin B genes and a marker gene, and constructing a second recombinant plasmid containing toxin B / antitoxin A genes and a marker gene; the toxin A and toxin B respectively represent different toxins, the antitoxin A gene is an antitoxin gene encoding a neutralizing toxin A, and the antitoxin B gene is an antitoxin gene encoding a neutralizing toxin B; the marker genes contained in the first recombinant vector and the second recombinant vector are different genes; Early embryos of target pests are collected, and the first and second recombinant plasmids are injected into the pest embryos to complete site-specific insertion, thereby obtaining two transgenic positive pest strains; Two transgenic positive pest strains are hybridized with wild-type pests to obtain offspring containing different screening marker genes, and then the two offspring containing different marker genes are hybridized to obtain mandarin duck chromosome pest strains.

4. The transgenic pest control method according to claim 3, characterized in that: The first recombinant plasmid is constructed by cloning the toxin A gene, the antitoxin B gene, the marker gene, and the pest promoter, respectively, and then connecting the toxin A gene, the antitoxin B gene, the marker gene, and the pest promoter to the pYYCP-basic basic plasmid shown in SEQ ID NO. 29 to obtain the first recombinant plasmid; The construction process of the second recombinant plasmid is: cloning the toxin B gene, antitoxin A gene, marker gene and pest promoter respectively, and then connecting the toxin B gene, antitoxin A gene, marker gene and pest promoter to the pYYCP-basic basic plasmid shown in SEQ ID NO.29 to obtain the second recombinant plasmid.

5. The transgenic pest control method according to claim 3, characterized in that: The toxin A gene is the MazF gene with a nucleotide sequence as shown in SEQ ID NO.1, the antitoxin A gene is the MazE gene with a nucleotide sequence as shown in SEQ ID NO.2, the toxin B gene is the RelE gene with a nucleotide sequence as shown in SEQ ID NO.3, and the antitoxin B gene with a nucleotide sequence as shown in SEQ ID NO.

4.

6. The transgenic pest control method according to claim 3, characterized in that: The first recombinant vector and the second recombinant vector are injected into the pest embryo by microinjection to complete the site-specific insertion.

7. The transgenic pest control method according to claim 3, characterized in that: The marker gene is a fluorescent gene or a body color gene.

8. The transgenic pest control method according to claim 3, characterized in that: After hybridization of offspring containing different marker genes, the offspring containing the marker gene are screened for self-pollination, and homozygous pests carrying only the marker gene are screened. The FLP recombinase is heat-shocked to express to achieve FRT site recombination, express the toxin gene, and obtain the mandarin duck chromosome fruit fly strain.

9. The transgenic pest control method according to claim 1, characterized in that: After releasing the transgenic mandarin duck chromosome pest strain into the environment, the mandarin duck chromosome fruit fly strain is hybridized with the wild-type fruit fly strain, causing the homologous chromosomes to separate and resulting in the death of the offspring, thereby achieving pest control.

10. The transgenic pest control method according to any one of claims 1 to 9, characterized in that: The pest is any one of locusts, termites, mosquitoes, flies, fruit flies, borers, armyworms, plant hoppers, fall armyworms, beet armyworms, diamondback moths, fruit flies and cockroaches.

Images