Application of paeonol in preparation of medicine for improving colorectal cancer tumor microenvironment and colorectal cancer treatment medicine comprising paeonol and doxycycline
Paeonol and doxorubicin combination therapy targets tumor-associated macrophages to regulate the NF-κB-CCL-22 axis, improving CRC treatment outcomes by reducing drug resistance and metastasis, and providing liver protection.
Patent Information
- Application Number
- CN202510542523.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-27
- Publication Date
- 2025-07-15
AI Technical Summary
Existing methods for the treatment of colorectal cancer are difficult to effectively target the tumor microenvironment, resulting in drug resistance and significant side effects. Traditional drugs such as doxycycline cannot effectively inhibit the immunosuppression of tumor-associated macrophages.
The combination of dansperm and doxycycline is used to regulate the NF-κB signaling pathway in tumor-associated macrophages, inhibit the secretion of CCL-22 protein, reverse macrophage polarization, reshape the tumor microenvironment, and enhance the anti-cancer effect.
It significantly inhibits the proliferation and metastasis of colorectal cancer cells, reduces immune escape, improves therapeutic effect, reduces drug resistance, and provides liver protection.
Smart Images

Figure CN120305233A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of traditional Chinese medicine applications, and particularly relates to the application of paeonol in the preparation of drugs for improving the tumor microenvironment of colorectal cancer, and a colorectal cancer treatment drug comprising paeonol combined with doxycycline. Background Art
[0002] Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths globally, and liver metastasis is the most common and lethal form of CRC progression. Although traditional therapies such as chemotherapy (e.g., 5-fluorouracil, oxaliplatin) and targeted drugs provide some clinical benefits, the prognosis of metastatic CRC remains poor due to treatment resistance and the highly metastatic nature of CRC cells. A key challenge is that existing therapies fail to effectively target the tumor microenvironment (TME), which plays an important role in supporting tumor progression and immune escape. In addition, these therapies often cause significant systemic side effects, highlighting the need for more effective and targeted treatment strategies.
[0003] The complexity of the TME is an important cause of CRC treatment resistance. Among its various cell components, tumor-associated macrophages (TAMs) - mainly polarized to the M2 phenotype - are key mediators of CRC metastasis. These macrophages secrete pro-tumor factors, including CCL-22, which binds to the CCR4 receptor on CRC cells, promoting cell migration, invasion, and immune escape. Notably, the NF-κB signaling pathway plays a crucial role in regulating CCL-22 expression in TAMs, and its activation can enhance the secretion of CCL-22, thereby accelerating CRC metastasis. Despite these insights, treatment strategies targeting the NF-κB-CCL-22 axis in TAMs have not been fully studied, which is a key gap in CRC metastasis research.
[0004] Doxycycline (Dox), an antibiotic with anticancer properties, has been studied for inhibiting matrix metalloproteinases (MMPs) and regulating the NF-κB signaling pathway in various cancers, including breast cancer, prostate cancer, and CRC. However, using Dox alone has some limitations, including the inability to effectively target the immunosuppressive TME and moderate antitumor effects, and it cannot significantly inhibit CRC metastasis. Therefore, new treatment strategies are urgently needed to enhance the anti-metastatic effect of Dox.
[0005] Paeonol (Pae) is a bioactive compound extracted from peonies and has been shown to have significant anti-inflammatory and anticancer activities. However, it is not clear whether Pae directly reduces the expression of CCL-22 in TAMs, so its potential role in regulating the NF-κB-CCL-22 axis needs further study.
[0006] At present, the application of paeonol combined with doxycycline in the preparation of drugs for the treatment of colorectal cancer is still blank. Summary of the Invention
[0007] In view of the above problems, the present invention provides the application of paeonol in the preparation of drugs for improving the tumor microenvironment of colorectal cancer, as well as a colorectal cancer treatment drug comprising paeonol combined with doxycycline.
[0008] The first object of the present invention is to provide the application of paeonol in the preparation of drugs for improving the tumor microenvironment of colorectal cancer, and the paeonol regulates the tumor microenvironment by regulating tumor-associated macrophages.
[0009] Furthermore, the paeonol regulates tumor-associated macrophages by inhibiting the function of tumor-associated macrophages and reversing the polarization of tumor-associated macrophages.
[0010] Furthermore, the paeonol inhibits the secretion function of CCL-22 protein of tumor-associated macrophages and reverses the polarization of tumor-associated macrophages by regulating the p65 subunit protein in the NF-κB signaling pathway of tumor-associated macrophages.
[0011] Furthermore, the paeonol binds to the p65 subunit protein to form a Pae-p65 complex.
[0012] Furthermore, the binding energy between the paeonol and the p65 subunit protein is -5.05 Kcal / mol to -4.71 Kcal / mol.
[0013] Furthermore, the reversal of the polarization of tumor-associated macrophages is as follows:
[0014] The polarization of tumor-associated macrophages is transformed into a tumor-associated macrophage phenotype with pro-inflammatory effects.
[0015] The second object of the present invention is to provide the application of paeonol combined with doxycycline in the preparation of drugs for the treatment of colorectal cancer. In the treatment of colorectal cancer, the paeonol combined with the doxycycline regulates the tumor microenvironment to enhance the anti-colorectal cancer effect of the doxycycline and overcome the occurrence of drug resistance in the treatment of colorectal cancer.
[0016] Furthermore, the combination of paeonol and doxycycline provides a liver protection effect in the treatment of colorectal cancer.
[0017] Furthermore, the application of the combination of paeonol and doxycycline in the preparation of drugs for the treatment of colorectal cancer liver metastasis.
[0018] The third object of the present invention is to provide a colorectal cancer treatment drug comprising paeonol and doxycycline.
[0019] Furthermore, the mass ratio of paeonol to doxycycline is 0-6:0-1.
[0020] Advantages of the present invention:
[0021] In the present invention, through tumor-associated macrophage experiments and mouse liver metastasis xenograft model experiments with paeonol, it is verified that paeonol regulates the tumor microenvironment by modulating tumor-associated macrophages.
[0022] Among them, the specific mechanism by which paeonol regulates the tumor microenvironment by modulating tumor-associated macrophages is clarified, specifically manifested as: paeonol directly targets the p65 subunit protein, binds to the p65 subunit protein to form the Pae-p65 complex, thereby inhibiting the CCL-22 protein secretion function of tumor-associated macrophages, while reversing the polarization of tumor-associated macrophages, remodeling the tumor microenvironment, disrupting the immune escape process, and thus inhibiting the proliferation and metastasis of colorectal cancer cells. The mechanism of action of paeonol in the preparation of drugs for treating colorectal cancer is clarified, providing important insights for improving the treatment outcome of metastatic colorectal cancer cells.
[0023] The present invention provides the application of paeonol combined with doxycycline in the preparation of drugs for treating colorectal cancer and the drug. Through experiments on colorectal cancer cells, tumor-associated macrophages, and mouse liver metastasis xenograft models with paeonol, doxycycline, and their combination, it is verified that in the treatment of colorectal cancer with the combination of paeonol and doxycycline, paeonol makes up for the defect that doxycycline alone cannot effectively target the immunosuppressive tumor microenvironment. The two form a synergistic effect, exerting a great role in overcoming the metastasis of colorectal cancer cells, improving the treatment effect of colorectal cancer. At the same time, it overcomes the occurrence of drug resistance in the treatment of colorectal cancer and provides liver protection, enabling the promotion and application of the combination of paeonol and doxycycline in the preparation of drugs for colorectal cancer liver metastasis.
[0024] Other features and advantages of the present invention will be described in the subsequent description, and part of them will become obvious from the description or be understood by implementing the present invention. The objectives and other advantages of the present invention can be achieved and obtained through the structures pointed out in the description, claims, and drawings. Description of the Drawings
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0026] Figure 1 The figure shows the qPCR analysis diagram of macrophage polarization markers according to an embodiment of the present invention. Among them, A is the qPCR analysis diagram of M1-type characteristic factors (IL-12, CXCL10, CD80); B is the qPCR analysis diagram of M2-type characteristic factors (IL-10, CD163, CD206).
[0027] Figure 2 The figure shows the analysis diagram of the differentiation process of M1 and M2 macrophages according to an embodiment of the present invention. Among them, A is the qPCR analysis of the CCL-22 mRNA level in M1 and M2 macrophages (using GAPDH as an internal reference); B is the ELISA detection of the CCL-22 protein secretion amount.
[0028] Figure 3 The figure shows the diagram of the knockdown and overexpression efficiency verification of CCL-22 in M2 macrophages by qPCR according to an embodiment of the present invention. Among them, A is the diagram of the knockdown expression efficiency verification of CCL-22 in M2 macrophages by qPCR, and B is the diagram of the overexpression efficiency verification of CCL-22 in M2 macrophages by qPCR.
[0029] Figure 4 The figure shows the Western blot analysis of the knockdown and overexpression of CCL-22 (using β-actin as an internal reference) according to an embodiment of the present invention. Among them, A is the diagram of the knockdown expression efficiency analysis of CCL-22 by Western blot, and B is the diagram of the overexpression efficiency analysis of CCL-22 by Western blot.
[0030] Figure 5 The figure shows the representative cloning test diagram of the lentiviral vector with CCL-22 knockdown and transduction of M2 macrophages according to an embodiment of the present invention.
[0031] Figure 6 The figure shows the representative cloning test diagram of the lentiviral vector with CCL-22 overexpression and transduction of M2 macrophages according to an embodiment of the present invention.
[0032] Figure 7 The figure shows the diagram of the effect of CCL-22 on the migration of CRC cells (HCT116 cells and DLD-1 cells) according to an embodiment of the present invention (it is a microscopic diagram after cell staining, and the cells are obtained from the Transwell migration experiment). Among them, A is the diagram of the migration effect under knockdown expression, and B is the diagram of the migration effect under overexpression. Figure 7 The scale bar in it is 249μm, the blue is the cells, and the light yellow, yellow, and white are all the background.
[0033] Figure 8Shows the invasion diagrams of CCL-22 on CRC cells (HCT116 cells and DLD-1 cells) according to an embodiment of the present invention (microscopic diagrams after cell staining, and the cells are obtained by Transwell). Among them, A is the invasion diagram under knockdown expression, and B is the invasion diagram under overexpression. Figure 7 The scale bar in [the figure] is 249 μm. The blue color represents cells, and the light yellow, yellow, and white colors are all backgrounds.
[0034] Figure 9 Shows the quantitative analysis diagram of the scratch test after co-culture of HCT116 cells and M2 macrophages according to an embodiment of the present invention. Among them, A is the co-culture result diagram in the conditioned medium of CCL-22 knockdown M2 macrophages, and B is the co-culture test result diagram in the conditioned medium of CCL-22 overexpression. All data are the mean ± SEM of three independent experiments. The scratch experiment is 50 μm, p < 0.05, ** or **** p < 0.001 (vs the control group).
[0035] Figure 10 Shows the quantitative analysis diagram of the scratch test after co-culture of DLD-1 cells and M2 macrophages according to an embodiment of the present invention. Among them, A is the co-culture result diagram in the conditioned medium of CCL-22 knockdown M2 macrophages, and B is the co-culture test result diagram in the conditioned medium of CCL-22 overexpression. All data are the mean ± SEM of three independent biological replicates (p < 0.05, p < 0.01, or **** p < 0.001 vs the control group)
[0036] Figure 11 Shows the representative diagram of the cell colony formation experiment results after co-culture of HCT116 and DLD-1 cells with the culture supernatant derived from M2 macrophages treated with Pae according to an embodiment of the present invention. The Control group is the supernatant derived from macrophages without any treatment, the M2 group is the supernatant derived from M2 macrophages induced by tumor supernatant, and the Pae group is the supernatant collected after treating M2 macrophages induced by tumor supernatant with 240 μg / mL Pae for 24 hours.
[0037] Figure 12 Shows the representative diagram of the cell migration experiment results after co-culture of HCT116 and DLD-1 cells with M2 macrophages treated with Pae according to an embodiment of the present invention. The Control group is untreated macrophages, the M2 group is M2 macrophages induced by tumor supernatant, and the Pae group is the state of M2 macrophages induced by tumor supernatant after treating with 240 μg / mL Pae for 24 hours.
[0038] Figure 13Shows a representative graph of the results of a cell invasion experiment after co - culturing HCT116 and DLD - 1 cells with M2 - type macrophages treated with Pae according to an embodiment of the present invention. The Control group is macrophages without treatment, the M2 group is M2 - type macrophages induced by tumor supernatant, and the Pae group is the state of M2 - type macrophages induced by tumor supernatant after treatment with 240 μg / mL Pae for 24 hours.
[0039] Figure 14 Shows a quantitative analysis graph of a scratch experiment performed after co - culturing HCT116 cells with the supernatant derived from M2 - type macrophages treated with Pae according to an embodiment of the present invention. The Control group is macrophages without treatment, the M2 group is M2 - type macrophages induced by tumor supernatant, and the Pae group is the state of M2 - type macrophages induced by tumor supernatant after treatment with 240 μg / mL Pae for 24 hours. The migration of cells was dynamically observed under a microscope, and the time points were recorded as 0, 24, 48, and 72 hours. All data were based on three independent biological replicates, and the results were expressed as mean ± SEM (*p < 0.01, *** or ****p < 0.001).
[0040] Figure 15 Shows a quantitative analysis graph of a scratch experiment performed after co - culturing DLD - 1 cells with the supernatant derived from M2 - type macrophages treated with Pae according to an embodiment of the present invention. The Control group is macrophages without any treatment, the M2 group is M2 - type macrophages induced by tumor supernatant, and the Pae group is the state of M2 - type macrophages induced by tumor supernatant after treatment with 240 μg / mL Pae for 24 hours. The migration of cells was observed under a microscope, and the time points were recorded as 0, 24, 48, 72, and 96 hours. All data were based on three independent biological replicates, and the results were expressed as mean ± SEM (*** or ****p < 0.001)
[0041] Figure 16 Shows a quantitative analysis graph of the viability of M1 - type and M2 - type macrophages by Pae according to an embodiment of the present invention. Among them, A is the quantitative analysis of the viability of M1 - type macrophages (left) and M2 - type macrophages (right) by different doses of Pae; B is the quantitative analysis of the viability of M1 - type (left) and M2 - type (right) macrophages by Pae at different treatment times.
[0042] Figure 17It shows the quantitative analysis chart of the gene expression of M2 macrophage markers induced by tumor supernatant with Pae according to the embodiments of the present invention. Among them, A is the quantitative analysis of the gene expression of M1 macrophage markers CD80 and IL-12, and B is the quantitative analysis of the gene expression of M2 macrophage markers CD163 and IL-10. All data are based on three independent biological replicates, and the results are expressed as mean ± SEM (*p<0.01, *** or ****p<0.001).
[0043] Figure 18 It shows the quantitative analysis chart of the expression of M2 macrophage marker CD206 induced by tumor supernatant with Pae according to the embodiments of the present invention. After treating M2 macrophages with different doses of Pae for 24 hours, the expression level of CD206 molecules on the cell membrane surface was detected by immunohistochemical staining. All data are based on three independent biological replicates, and the results are expressed as mean ± SEM (****p<0.001).
[0044] Figure 19 It shows the quantitative analysis chart of the CCL-22 expression in M2 macrophages induced by tumor supernatant with Pae according to the embodiments of the present invention. Among them, A is the quantitative analysis of the CCL-22 gene expression level in M2 macrophages after treatment with different doses of Pae; B is the quantitative analysis of the CCL-22 protein expression level under the corresponding conditions. All data are based on three independent biological replicates, and the results are expressed as mean ± SEM (**p<0.01, ****p<0.001).
[0045] Figure 20 It shows the quantitative analysis chart of the CCL-22 secretion by M2 macrophages induced by tumor supernatant with Pae according to the embodiments of the present invention. After treating M2 macrophages with different doses of Pae for 24 hours, the secretion level of CCL-22 in the culture supernatant was detected by enzyme-linked immunosorbent assay (ELISA). **p<0.01, *** or ****p<0.001.
[0046] Figure 21 It shows the quantitative analysis chart of the expression of phosphorylated p65 (P-p65), total p65 protein and CCL-22 in M2 macrophages induced by tumor supernatant with Pae according to the embodiments of the present invention. Among them, A is the quantitative analysis of the p65 gene expression in M2 macrophages after treatment with different doses of Pae; B is the analysis of the protein expression levels of P-p65, total p65 protein and CCL-22 in M2 macrophages after treatment with different doses of Pae. All data are from three independent biological replicates, and the results are expressed as mean ± SEM (**p<0.01, ****p<0.001).
[0047] Figure 22 Shows the quantitative analysis chart of p65 knockdown in M2 macrophages according to an embodiment of the present invention. Among them, A is the quantitative analysis of gene expression in M2 macrophages after p65 knockdown, and B is the quantitative analysis of the expression of P-p65 and total p65 proteins after p65 knockdown. All data are from three independent biological replicates, and the results are expressed as mean ± SEM (**p<0.01, ***p<0.001).
[0048] Figure 23 Shows the quantitative analysis chart of p65 overexpression in M2 macrophages according to an embodiment of the present invention. Among them, A is the quantitative analysis of the expression of p65 mRNA in overexpressed M2 macrophages; B is the quantitative analysis of the expression of P-p65 and total p65 proteins in overexpressed M2 macrophages. All data are the mean ± SEM of three independent biological replicates (**p<0.01, ***p<0.001).
[0049] Figure 24 Shows the quantitative analysis chart of the expression levels of P-p65, total p65 protein and CCL-22 after p65 gene knockdown or overexpression in M2 macrophages induced by tumor supernatant with Pae according to an embodiment of the present invention. Among them, A is the quantitative analysis of the effect of Pae treatment on the expression of P-p65, total p65 and CCL-22 in p65-knockdown M2 macrophages; B is the quantitative analysis of the effect of Pae treatment on the expression of P-p65, total p65 and CCL-22 in p65-overexpressed M2 macrophages.
[0050] Figure 25 Shows the molecular docking diagram of the interaction between Pae and p65 according to an embodiment of the present invention.
[0051] Among them, A are the key amino acid residues (Leucine (Leu) 7, Serine (Ser) 370, Glycine (Gly) 371) when Pae binds to p65; B are the wild-type (WT) sequences and mutant-type (MT) sequences of these key amino acid residues.
[0052] Figure 26 Shows the results of molecular dynamics simulation of the interaction between Pae and p65 according to an embodiment of the present invention. Among them, A is the change in root mean square deviation (RMSD) in the molecular dynamics simulation when Pae binds to wild-type (WT) p65; B is the change in RMSD when Pae binds to mutant-type (MT) p65.
[0053] Figure 27 Shows the quantitative analysis chart of the thermal stability of p65 by Pae according to an embodiment of the present invention.
[0054] Among them, A shows the expression of p65 protein in M2 macrophages treated with Pae under different temperature conditions by Western blot, with the DMSO group as the control; B shows the quantitative analysis results of the above experiment. The expression level of p65 protein at 37°C was set as 100%, and the relative percentage of p65 protein expression under other temperature conditions was calculated, and the relative expression levels at each temperature were plotted to generate an apparent melting curve. ΔTm represents the melting temperature difference in the thermal stability of p65 between the Pae-treated group and the DMSO-treated group. All data are the mean ± SEM of three independent biological replicates (**p < 0.01, ***p < 0.001).
[0055] Figure 28 It shows the dose-dependent quantitative analysis results of the effect of Pae on the thermal stability of p65 according to the embodiments of the present invention. Among them, A shows the expression of p65 protein in M2 macrophages treated with different concentrations of Pae at 56°C by Western blot, with β-actin as the internal reference; B shows the quantitative analysis results of the above experiment. The expression level of p65 protein in the untreated group (0 μg / mL Pae) was set as 100%, and the relative expression percentage of p65 protein at the remaining Pae treatment concentrations was calculated, and an isothermal dose-response curve was plotted. All data are the mean ± SEM of three independent biological replicates.
[0056] Figure 29 It shows the quantitative analysis chart of the inhibitory effect of Dox on the proliferation of HCT116 and DLD-1 cells according to the embodiments of the present invention. Among them, A shows the analysis of the inhibitory effect of different concentrations of Dox on the proliferation of HCT116 cells at different time points; B shows the analysis of the inhibitory effect on the proliferation of DLD-1 cells under the same treatment conditions. All data are the mean ± SEM of three independent biological replicates.
[0057] Figure 30 It shows the quantitative analysis chart of the inhibitory effect of Dox on the colony formation of HCT116 and DLD-1 cells according to the embodiments of the present invention. Among them, A shows the analysis of the inhibitory effect of different concentrations of Dox (10 μg / mL and 20 μg / mL) on the colony formation of HCT116 cells; B shows the analysis of the inhibitory effect on the colony formation of DLD-1 cells under the same treatment conditions. All data are the mean ± SEM of three independent biological replicates (*p < 0.05, ****p < 0.001).
[0058] Figure 31Shows the quantitative analysis diagrams of the inhibitory effects of Dox on the migration and invasion of HCT116 and DLD-1 according to the embodiments of the present invention. Among them, A is the analysis of the inhibitory effect of different concentrations of Dox (10 μg / mL and 20 μg / mL) on the migration of HCT116 cells; B is the analysis of the inhibitory effect on the migration of DLD-1 under the same treatment conditions; C is the analysis of the inhibitory effect of different concentrations of Dox (10 μg / mL and 20 μg / mL) on the invasion of HCT116 cells; D is the analysis of the inhibitory effect on the invasion of DLD-1 under the same treatment conditions. All data are the mean ± SEM of three independent biological replicates (****p < 0.001).
[0059] Figure 32 Shows the quantitative analysis diagrams of the inhibitory effects of Dox on the scratch wound healing of HCT116 and DLD-1 cells according to the embodiments of the present invention. Among them, A is the analysis of the inhibitory effect of different concentrations of Dox (10 μg / mL and 20 μg / mL) on the scratch wound healing ability of HCT116 cells; B is the analysis of the inhibitory effect on the scratch wound healing ability of DLD-1 cells under the same treatment conditions. All data are the mean ± SEM of three independent biological replicates (*p < 0.05, ****p < 0.001).
[0060] Figure 33 Shows the quantitative analysis diagrams of the inhibitory effects of the culture supernatants derived from M2 macrophages treated with different concentrations of Dox combined with different concentrations of Pae on the proliferation of HCT116 and DLD-1 cells according to the embodiments of the present invention. Among them, A is the analysis of the inhibitory effect on the proliferation of HCT116 cells at different time points by the culture supernatants derived from M2 macrophages treated with different concentrations of Dox (10 μg / mL and 20 μg / mL) combined with different concentrations of Pae (60 μg / mL, 120 μg / mL, and 240 μg / mL); B is the analysis of the inhibitory effect on the proliferation of DLD-1 cells under the same treatment conditions. All data are the mean ± SEM of three independent biological replicates.
[0061] Figure 34 Shows the quantitative analysis diagrams of the inhibitory effects of the culture supernatants derived from M2 macrophages treated with different concentrations of Dox combined with Pae on the colony formation of HCT116 and DLD-1 cells. In the experiment, the culture supernatants derived from M2 macrophages treated with 240 μg / mL Pae were combined with 10 μg / mL and 20 μg / mL Dox respectively, and after acting on HCT116 and DLD-1 cells for 14 days, their colony formation abilities were evaluated. In the figure, magenta represents cell colonies and white is the background.
[0062] Figure 35Shows the quantitative analysis chart of the inhibitory effect of M2 macrophages treated with different concentrations of Dox combined with Pae on the migration of HCT116 and DLD-1 cells according to an embodiment of the present invention. Among them, A is the analysis of the inhibitory effect of M2 macrophages treated with 10 μg / mL and 20 μg / mL Dox combined with 240 μg / mL Pae on the migration of HCT116 cells; B is the analysis of the inhibitory effect on the migration of DLD-1 cells under the same treatment conditions. All data are the mean ± SEM of three independent biological replicates (****P<0.001).
[0063] Figure 36 Shows the quantitative analysis chart of the inhibitory effect of M2 macrophages treated with different concentrations of Dox combined with Pae on the invasion of HCT116 and DLD-1 cells according to an embodiment of the present invention. Among them, A is the analysis of the inhibitory effect of M2 macrophages treated with 10 μg / mL and 20 μg / mL Dox combined with 240 μg / mL Pae on the invasion of HCT116 cells; B is the analysis of the inhibitory effect on the invasion of DLD-1 cells under the same treatment conditions. All data are the mean ± SEM of three independent biological replicates (****P<0.001).
[0064] Figure 37 Shows the quantitative analysis chart of the inhibitory effect of M2 macrophages treated with different concentrations of Dox combined with Pae on the scratch wound healing of HCT116 cells according to an embodiment of the present invention. The inhibitory effect of M2 macrophages treated with 10 μg / mL and 20 μg / mL Dox combined with 240 μg / mL Pae on the scratch wound healing of HCT116 cells was analyzed by a scratch assay. All data are the mean ± SEM of three independent biological replicates (****P<0.001).
[0065] Figure 38 Shows the quantitative analysis chart of the inhibitory effect of M2 macrophages treated with different concentrations of Dox combined with Pae on the scratch wound healing of DLD-1 cells according to an embodiment of the present invention. The inhibitory effect of M2 macrophages treated with 10 μg / mL and 20 μg / mL Dox combined with 240 μg / mL Pae on the scratch wound healing of DLD-1 cells was analyzed by a scratch assay. All data are the mean ± SEM of three independent biological replicates (****P<0.001).
[0066] Figure 39Shows the quantitative analysis chart of Dox combined with Pae in the treatment of liver metastases of colorectal cancer according to an embodiment of the present invention. Among them, A is the representative image of liver metastases after treatment with 25 mg / kg and 50 mg / kg Dox combined with 300 mg / kg Pae; B is the statistical count of the number of metastatic nodules in the livers of mice in each treatment group. All data are based on 8 mice in each group, and the results are expressed as mean ± SD (*** or **** P < 0.001).
[0067] Figure 40 Shows the quantitative analysis chart of P-p65, total p65, and CCL-22 in liver tissues in the treatment of liver metastases of colorectal cancer with Dox combined with Pae according to an embodiment of the present invention. Among them, A is the expression analysis of P-p65 in the livers of each experimental group; B is the expression analysis of total p65 in the livers of each experimental group; C is the expression analysis of CCL-22 in the livers of each experimental group. All data are the mean ± SEM of three independent biological replicates (* P < 0.05, ** P < 0.01, *** or **** P < 0.001).
[0068] Figure 41 Shows the quantitative analysis chart of histological staining (H&E) of the liver in the treatment of liver metastases of colorectal cancer with Dox combined with Pae according to an embodiment of the present invention. All data are the mean ± SEM of three independent biological replicates (* P < 0.05, ** P < 0.01, *** or **** P < 0.001).
[0069] Figure 42 Shows the microscopic image of histological staining (H&E) of the liver in the treatment of liver metastases of colorectal cancer with Dox combined with Pae according to an embodiment of the present invention, Figure 42 The scale bar in is 100 μm.
[0070] Figure 43 Shows the immunohistochemical quantitative analysis chart of the expression of P-p65, total p65, and CCL-22 in liver tissues in the liver metastasis model of colorectal cancer treated with Dox combined with Pae according to an embodiment of the present invention. Among them, A is the immunohistochemical expression level of P-p65 in the liver tissues of each group; B is the expression of total p65, and C is the expression difference of CCL-22 in the liver tissues of each group. All data are the mean ± SEM of three independent biological replicates (* P < 0.05, ** P < 0.01, *** or **** P < 0.001). Detailed implementation manners
[0071] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts fall within the scope of protection of the present invention.
[0072] 1 Experiment
[0073] 1.1 Cells and Reagents
[0074] Human colorectal cancer cell lines HCT116 and DLD-1, human acute monocytic leukemia cell THP-1, and human embryonic kidney cell HEK 293T were from the Shanghai Cell Bank (Chinese Academy of Sciences). These cells were cultured in α-MEM (Gibco, Thermo Fisher Scientific) medium containing 10% fetal bovine serum (FBS, Royacel, China) and 1% penicillin-streptomycin. All cell cultures were routinely tested for mycoplasma contamination.
[0075] Antibodies used in the present invention included: anti-p-p65 (Cat.#: 310013) and anti-p65 (Cat.#: 380172, Zen-Bioscience, Ltd., China), anti-CCL-22 / MDC (Cat.#: MAB336, R&D Systems, USA), anti-CD206 (Cat.#: ab300621, Abcam, USA), and anti-actin (Cat.#: AF5003, Beyotime Biotech Inc., China). ELISA kits for detecting CCL-2 (Cat.#: JL19334) and CCL-22 (Cat.#: JL34371) were purchased from Jonlnbio Industrial Co., Ltd. (China).
[0076] The reagents used included: paeonol (Pae, Cat.#: 552-41-0) and LPS (Cat.#: NONE6691, Merck, Sigma-Aldrich, USA), doxycycline (Dox, Cat.#: GC63621) and CCK-8 kit (Cat.#: GK10001, GlpBio Technology Inc., USA), IFN-γ (Cat.#: 300-02, Thermo Fisher Scientific, PeproTech), 12-tetradecanoylphorbol 13-acetate (PMA, BBI Co., Ltd., China), puromycin (Cat.#: BS111, Biosharp, China) and Matrigel Matrix (Cat.#: 354234, Corning, USA).
[0077] 1.2 Plasmid and lentivirus transfection
[0078] The transfer plasmids pLVTHM (Cat.#: 12247) and pLenti-puro (Cat.#: 39481) for gene silencing, as well as the packaging plasmid psPAX2 (Cat.#: 12260) and the envelope plasmid pMD2.G (Cat.#: 12259) were from Addgene (USA). To knockdown CCL-22 and p65 expression, specific short hairpin RNA (shRNA) sequences targeting CCL-22, p65 and a negative control sequence were synthesized and cloned into the pLVTHM vector. The shRNA sequences for CCL-22 were CCTGGGTGAAGATGATTCTCAATAA (shRNA-1) and CCCTGCGCGTGGTGAAACACTTCTA (shRNA-2), and the shRNA sequences for p65 were GGATTGAGGAGAAACGTAAAAT (shRNA-1) and GGACATATGAGACCTTCAAT (shRNA-2). The control sequence was AACGAGTGTGCCTACATCCT. Lentivirus-mediated gene silencing was performed using these constructs.
[0079] 1.3 Preparation of tumor-conditioned medium
[0080] To prepare tumor-conditioned medium, HCT116 or DLD-1 cells were cultured in complete α-MEM medium until they reached approximately 70-80% confluence. Then, the culture medium was replaced with fresh complete α-MEM medium, and the cells were further cultured for 24 hours to collect tumor supernatant (TSN). The collected supernatant was centrifuged at 300×g for 10 minutes to remove cell debris, filtered through a 0.45 μm filter, and stored at -80 °C for later use.
[0081] 1.4 Induction of macrophage differentiation
[0082] To induce macrophage differentiation in vitro, THP-1 cells were seeded in 6-well plates at a density of 1×10 6 cells / well. They were treated with 100 nM PMA for 24 hours to promote their differentiation into macrophage-like cells. After PM treatment, the culture medium was removed, and the cells were washed twice with phosphate-buffered saline (PBS) to remove residual PMA. The differentiated macrophages were further cultured in complete α-MEM medium without PMA for 24-48 hours to further mature and become quiescent. These unstimulated terminally differentiated cells were considered to represent M0 macrophages.
[0083] To induce M1 macrophages, the differentiated M0 macrophages were treated with IFN-γ (20 ng / mL) and LPS (100 ng / mL) in α-MEM medium without PMA for 24 hours to promote their polarization into a pro-inflammatory M1 phenotype. After treatment, the cells were harvested for further analysis or processed as needed.
[0084] For M2 polarization, TSN was diluted 1:1 with fresh α-MEM and used to culture M0 macrophages for 24 hours to induce their polarization into the M2 phenotype. After treatment, the cells were harvested or subsequent experiments were performed as needed.
[0085] 1.5 Treatment of M2 macrophages with Pae
[0086] To evaluate the effect of Pae on M2 macrophages, the differentiated M2 macrophages were cultured in α-MEM medium and exposed to different concentrations of Pae (0, 60, 120, 240, 480 μg / mL). After 24 hours, the supernatant was collected for cytokine production analysis, and the cells were harvested for further molecular analysis. RNA was extracted from the cells by RT-qPCR to examine the expression of M1 / M2-related genes. In addition, the expression of cell surface CD206 was detected by cytochemical staining.
[0087] 1.6 Cytochemical staining analysis
[0088] The M2 macrophages induced by TSN were seeded in 6-well plates at a density of 5.0×105 Cells were seeded at a density of 5.0×10 5 cells per well and treated with different concentrations of Pae (0, 60, 120, 240, 480 μg / mL) for 24 hours. After washing with PBS, the cells were fixed with 4% paraformaldehyde, treated with 3% hydrogen peroxide, and blocked with 5% goat serum. Then, the CD206 antibody (diluted 1:150) was incubated overnight at 4°C, followed by incubation with biotinylated goat anti-rabbit IgG and HRP-conjugated streptavidin. The color was developed using DAB solution and observed under a microscope for 5 - 15 seconds. Then, hematoxylin counterstaining, dehydration, mounting, and installation with neutral resin were performed. The sections were observed under a microscope, and the average optical density (AOD) in the images was analyzed using ImageJ.
[0089] 1.7 Preparation of medium
[0090] To evaluate the effect of CCL-22 or p65 from macrophages on CRC cell function, M2 macrophage-conditioned medium was prepared from lentivirus-transduced THP-1 cells, which were induced to become M2 macrophages under conditions of CCL-22 or p65 silencing or overexpression. After 24 hours, the supernatant was collected and centrifuged, filtered, and diluted 1:1 to prepare for functional experiments.
[0091] For Pae treatment, TSN-induced M2 macrophages were seeded in 6-well plates at a density of 5.0×10 5 cells per well and treated with different concentrations of Pae (0, 60, 120, 240, 480 μg / mL). After 24 hours, the medium was collected, centrifuged, filtered, and stored at -80°C. Before use, the medium was thawed, diluted 1:1, and used for CCK-8, colony formation, and scratch assays.
[0092] 1.8 Cell viability assay
[0093] Cell viability was evaluated using the CCK-8 method, which measures viable cells by the reduction of the soluble tetrazolium salt (WST-8) to formazan. For macrophage viability, M1 / M2 macrophages were seeded in 96-well plates at a density of 1.0×10 4 cells per well and cultured for 24 hours. After changing the culture medium, they were treated with different concentrations of Pae (0, 60, 120, 240, 480 μg / mL) for 24, 48, 72, and 96 hours. Then, CCK-8 reagent was added, and after a 2-hour incubation, the absorbance was measured at 450 nm.
[0094] For CRC cell lines (HCT116 and DLD-1), the cells were seeded in 96-well plates at a density of 1.0×10 4Cells per well were cultured for 24 hours. Then, they were treated with Dox (0, 11.25, 22.5, 45, 90 μg / mL) for 24, 48, 72, and 96 hours. After appropriate incubation, CCK-8 reagent was added, and the absorbance was measured at 450 nm.
[0095] For combination therapy, CRC cells were seeded in a 96-well plate at 1.0×10 4 cells per well and cultured for 24 hours. After changing the medium, the culture solution was replaced with conditioned medium of M2 macrophages treated with Pae, and Dox (10 or 20 μg / mL) was added. Incubation was carried out at the same time points as in individual treatments. CCK-8 reagent was added and the absorbance was measured, and cell viability was determined based on the absorbance value.
[0096] 1.9 RNA Extraction and Quantitative Real-Time PCR
[0097] Total RNA was extracted from untreated and treated cells or mouse tumor tissues using Trizol (Invitrogen). The mRNA levels of IL-10, IL-12, CCL-2, CCL-22, CXCL-10, CD163, CD80, and p65 were quantified using SYBR Green Master Mix (Cat.#: AH0104, Sparkjade, China). Gene expression was normalized relative to GAPDH, and the relative expression level was calculated using the Ct method. Gene primers are common knowledge in this technical field and will not be elaborated here.
[0098] 1.10 Western Blot
[0099] Total proteins were extracted from untreated and treated cells or mouse tumor tissues and separated by 10% SDS-PAGE. Proteins were transferred to PVDF membranes (Millipore, MA, USA), and non-specific binding was blocked using 5% non-fat milk powder in TBS-Tween-20 (0.1%). The membranes were incubated with anti-CCL-22 (1:2000), anti-p-p65 (1:1000), and anti-p65 (1:1000) at room temperature for 2 hours. After washing, they were incubated with secondary antibody at room temperature for 1 hour. Signals were detected using Immobilon Western HRP Chemiluminescent Substrate (BL520B, Biosharp, China), and band intensities were visualized using a Tanon 5200 image analyzer (Tanon, China), and protein expression was quantified using ImageJ software.
[0100] 1.11 Colony Formation Assay
[0101] To evaluate the effect of CCL-22 or p65 from macrophages on the proliferation of CRC cells, the conditioned medium of lentivirus-transduced M2 macrophages was added to a 6-well plate seeded with 1000 HCT116 or DLD-1 cells and cultured for 14 days. The clones were fixed, stained with 0.1% crystal violet, washed and air-dried, and then the clones were counted to evaluate the colony formation ability.
[0102] For the treatment with Pae or Pae combined with Dox, HCT116 or DLD-1 cells were seeded in a 96-well plate at a density of 1×10 3 cells / well and treated with the conditioned medium of M2 macrophages treated with Pae (240 μg / mL), alone or in combination with Dox (10, 20 μg / mL). The colony formation ability was evaluated following the same procedure as above.
[0103] 1.12 Scratch assay
[0104] To quantify the dependence of cell migration on the secretion of CCL-22 or p65 from macrophages, HCT116 or DLD-1 cells were seeded in a 6-well plate at a density of 1×10 6 cells / well. After 24 hours, a wound was created using the vertical scratch method, washed with PBS and cultured in the conditioned medium of M2 macrophages from lentivirus-transduced cells (1% FBS) until the wound healed. Photos were taken every 24 hours and the wound area was analyzed using TScratch software.
[0105] For the treatment with Pae or Pae combined with Dox, the same procedure was followed, replacing it with the conditioned medium of M2 macrophages treated with Pae (240 μg / mL), alone or in combination with Dox (10, 20 μg / mL).
[0106] 1.13 Transwell assay
[0107] To evaluate the dependence of the secretion of CCL-22 or p65 from macrophages on the migration and invasion of CRC cells, HCT116 or DLD-1 cells were seeded into Transwell chambers at a density of 2×10 4 cells / well (migration assay) or 4×104 cells / well (invasion assay), with or without Matrigel. 1×10 5 CCL-22 / p65 shRNA or overexpressing stable M2 macrophages were seeded in the bottom well. After 24 hours (migration) or 48 hours (invasion), the cells migrated through the filter membrane, were fixed, stained with 0.1% crystal violet, and photographed. The number of cells was quantified using ImageJ.
[0108] For Pae, Dox, or Pae+Dox treatment, the same procedure was followed with minor modifications. Pre-treated HCT116 or DLD-1 cells were treated with or without Pae (240 μg / mL) in Transwell chambers with M2 macrophages at the bottom. After 24 hours of culture, the medium was replaced with fresh medium containing 20% FBS. For Dox treatment, fresh medium containing 20% FBS was added to the bottom well without Pae or cells. After 24 hours for the migration assay and 48 hours for the invasion assay, cells were processed and quantified as described above.
[0109] 1.14 Computational analysis of the binding of Pae to p65
[0110] Initial molecular docking was performed using AutoDock Vina software to predict the potential binding sites of Pae to the p65 protein and calculate its binding free energy. Subsequently, the docking results were optimized using the NeuralPlex algorithm to determine the most favorable binding conformation, identify key binding sites and intermolecular interactions. Based on these results, key amino acid residues in p65 that interact with Pae were selected for mutagenesis studies.
[0111] Molecular dynamics simulations of the binding of Pae to wild-type and mutant p65 were performed using GROMACS 2022.3. Small molecules were pre-treated using AmberTools22, hydrogenated using the GAFF force field and Gaussian16W, and RESP charges were calculated, which were incorporated into the topology of the system. Simulations were carried out at 300 K and 1 bar using the Amber99sb-ildn force field and the TIP3P water model, and Na+ ions were added to neutralize the system charge.
[0112] The system was first energy-minimized and then subjected to 100,000 steps of NVT and NPT equilibration (0.1 ps coupling constant, 100 ps duration). The production phase involved 5,000,000 steps (2 fs time step) to simulate 100 ns. Post-simulation analysis included RMSD, RMSF, radius of gyration, and MMGBSA free energy calculations, as well as free energy surface plots.
[0113] 1.15 Cellular thermal shift assay
[0114] Cell Thermal Shift Assay (CETSA) was used to evaluate the thermal stability and concentration-dependent solubility of p65 protein in M2 macrophages after Pae treatment. To obtain the apparent melting curve experiment, THP-1 cells induced by PMA were differentiated into macrophages, and then induced by TSN to differentiate into M2 macrophages. Cells were treated with 30 μg / mL Pae solution, and DMSO was used as a control for 24 hours. Cells were washed with cold PBS, collected and centrifuged, and resuspended in 0.5 mL cell lysis buffer. The lysate was distributed into 10 PCR tubes, and each tube was treated with Pae and DMSO control groups, with 10 tubes in each group. These tubes were treated at 10 different temperatures (37°C, 41°C, 44°C, 47°C, 50°C, 53°C, 56°C, 59°C, 63°C, and 67°C) for 3 minutes, then quickly cooled at room temperature for 3 minutes, and snap-frozen using liquid nitrogen. After alternating freeze-thaw cycles, the cell lysate was centrifuged and sample buffer was added for boiling. Western blot analysis was used to detect the expression of p65 protein. The apparent melting curve was generated using GraphPad Prism 9, showing the temperature-dependent solubility of p65 after Pae treatment.
[0115] In the isothermal dose-response experiment, M2 macrophages were treated with different concentrations of Pae (0, 0.9375, 1.875, 3.75, 7.5, 15, 30, 60, 120, 240 μg / mL) at a fixed temperature of 56°C. After 24 hours, cells were collected and subjected to the same freeze-thaw cycle. The lysate was centrifuged, the protein concentration was determined using the BCA method, and 90 μg of protein was loaded for Western blot analysis. The isothermal dose-response curve was plotted using GraphPad Prism 9, with the Pae concentration on the X-axis and the expression level of p65 on the Y-axis, providing insights into the effect of Pae concentration on p65 solubility.
[0116] 1.16 Mouse liver metastasis xenograft model
[0117] A mouse model of CRC liver metastasis was established as described previously, following the ethical guidelines of the Ethics Committee of Anhui University of Chinese Medicine (approval number: AHUCM-mouse-2024199). 64 male Balb / c nude mice (5 weeks old, SPF grade) were purchased from Hangzhou Ziyuan Experimental Animal Science and Technology Co., Ltd. and housed in a clean-grade facility. To establish the liver metastasis model, 1×10 7 HCT116 cells and 3.3×10 6 M2 macrophages (at a ratio of 3:1) were mixed and injected into the spleens of 8 mice, with 100 μL of serum-free medium injected into each mouse, for a total of 1.33×10 7Cells. After injection, the spleen was returned to the abdominal cavity, and the cells migrated to the liver through the circulatory system and formed metastatic lesions. Treatment with Pae, Dox, or Pae combined with Dox started 1 week after injection. Pae was administered by gavage at a dose of 300 mg / kg / 0.2 mL / mouse / d; Dox was administered by intraperitoneal injection at a dose of 25 mg / kg / 0.2 mL / mouse / d or 50 mg / kg / 0.2 mL / mouse / d. The treatment continued for 5 weeks and was analyzed at the 6th week. The experimental groups included: blank group (saline was given after injecting serum-free medium into the spleen); model group I (HCT116 cells + saline); model group II (HCT116 cells + M2 macrophages followed by saline); Pae group (HCT116 cells + M2 macrophages + Pae 300 mg / kg / d); Dox 25 group (HCT116 cells + Dox 25 mg / kg / d); Dox 50 group (HCT116 cells + Dox 50 mg / kg / d); Dox 25 + Pae group (HCT116 cells + M2 macrophages + Pae 300 mg / kg / d + Dox 25 mg / kg / d); Dox50 + Pae group (HCT116 cells + M2 macrophages + Pae 300 mg / kg / d + Dox 50 mg / kg / d).
[0118] 1.17 Immunohistochemical analysis
[0119] Tissues extracted from the liver tissue samples of nude mice were fixed in 4% paraformaldehyde, dehydrated, cleared, and embedded in paraffin. After sectioning, the paraffin was removed by xylene, hydrated successively through gradient concentrations of ethanol, and stained with hematoxylin and eosin (H&E). The stained sections were observed using a scanner, and the images were taken and saved.
[0120] For tumor tissues or cells treated with different concentrations of Pae (0, 60, 120, 240, 480 μg / mL) for 24 hours, antigen retrieval was first performed by boiling the samples in sodium citrate buffer (10 mM, pH 6.0) for 20 minutes. Then, the tissues were incubated with CD206 (1:150), p-p65 (1:200), p65 (1:200), and CCL-22 (1:200) antibodies. Bright-field images were taken using a microscope and analyzed using ImageJ.
[0121] 1.18 Statistical analysis
[0122] All experiments were repeated at least three times, except for animal models. Statistical analysis was performed using SPSS 23.0 software. The differences between two groups were evaluated using an independent samples t-test, and comparisons among multiple groups were made using one-way analysis of variance (ANOVA). A P-value < 0.05 was considered statistically significant. Graphs were generated using GraphPad Prism 9.
[0123] 2 Results
[0124] 2.1 CCL-22 secreted by TAMs promotes CRC cell proliferation and metastasis
[0125] To generate polarized macrophage subsets, particularly TAM-like M2 macrophages, THP-1 cells were induced to differentiate into M0 macrophages using PMA, followed by induction of M1 macrophages using LPS and IFN-γ, and M2 macrophages using TSN. The differentiation process was confirmed by measuring the production of pro-inflammatory cytokines (IL-12, TNF-α) in M1 macrophages and anti-inflammatory cytokines (IL-10, TGF-β) in M2 macrophages, as well as the expression of surface markers (M1: CD80, CD86; M2: CD163, CD206) (as can be seen from Figure 1 ). As can be seen from Figure 2 , CCL-22 secreted by M1 macrophages was lower, while M2 macrophages showed a significant increase in CCL-22.
[0126] To investigate the role of CCL-22 in the development of colorectal cancer (CRC), lentiviral vectors with CCL-22 knockdown and overexpression were constructed and transduced into M2 macrophages, and the results are as shown in Figures 3 - 6 . Figure 3 (RT-qPC analysis) and Figure 4 (Western blot analysis) confirmed successful regulation of CCL-22 expression, and these vectors can be used as effective tools to study the function of CCL-22 secreted by TAMs. By co-culturing CRC cells with the culture supernatants of CCL-22 knockdown or overexpressing TAMs, it was found that: compared with the shRNA negative control, the number of CRC cell clones in the CCL-22 knockdown group was significantly reduced ( Figure 5 ); while the colony-forming ability of the overexpression group was significantly enhanced compared with the pLenti-puro negative control ( Figure 6 ). As can be seen from Figures 3 - 6 , CCL-22 derived from TAMs can significantly promote CRC cell proliferation.
[0127] The effects of CCL-22 on CRC cell migration and invasion were further investigated by Transwell and wound scratch assays, and the results are as shown in Figures 7 - 10 . As shown in Figure 7As shown, compared with the control group, the migration ability of CRC cells in the CCL-22 knockdown group was significantly weakened, while that in the overexpression group was enhanced. As Figure 8 shown by the invasion experiment results, the number of CRC cells at the bottom of the Transwell chamber was positively correlated with the CCL-22 level secreted by TAMs. In addition, Figure 9 the results of the co-culture experiment shown in Figure 10 showed that when the CCL-22 level in the TAMs supernatant decreased, the motility of HCT116 cells decreased significantly; conversely, it accelerated significantly. As
[0128] 2.2 Pae inhibits CRC cell proliferation and metastasis by regulating TAMs function
[0129] To explore how Pae regulates TAMs polarization and affects the behavior of CRC cells, a colony formation experiment was performed by co-culturing HCT116 cells with the supernatant of M2 macrophages treated with Pae (240 μg / mL). The results of the colony formation experiment are as Figure 11 shown. As can be seen from the data in Figure 11 , TAMs treated with Pae significantly reduced the colony formation potential of CRC cells, indicating that Pae effectively interfered with the promoting effect of TAMs on CRC cell proliferation.
[0130] Next, the present invention evaluated the effects of Pae-treated TAMs on CRC cell migration and invasion. After co-culturing HCT116 and DLD-1 cells with M2 macrophages treated with Pae (240 μg / mL), a Transwell experiment was performed. The results of the Transwell experiment are shown in detail in Figure 12 and Figure 13 . As can be seen from Figure 12 and Figure 13 , compared with the control group, the migration (as shown in Figure 12 ) and invasion ( Figure 13 ) of M2 macrophages were significantly enhanced, emphasizing the pro-metastatic role of TAMs in the tumor microenvironment. It can be seen that Pae treatment significantly reduced the ability of M2 macrophages to promote CRC cell migration and invasion.
[0131] These observations were further verified in the scratch experiment, confirming the reduced migration of CRC cells. In particular, Pae-treated TAMs significantly reduced the migration of HCT116 and DLD-1 cells (Figure 14 and Figure 15 ), further enhancing the anti - metastatic effect of Pae in inhibiting metastasis by regulating the functions of TAMs.
[0132] In summary, Pae not only inhibits the proliferation of CRC cells by regulating TAMs, but also reduces the migration and invasion of CRC cells by inhibiting the functions of TAMs.
[0133] 2.3 Pae reprograms TAM polarization and reduces the secretion of CCL - 22 in TAMs
[0134] To further investigate how Pae affects the pro - metastatic properties of M2 macrophages, the polarization and phenotypes of TSN - induced M2 macrophages were first analyzed and then treated with Pae. To evaluate the effect of Pae on the activities of macrophage subsets, M1 and M2 macrophages were treated with different concentrations of Pae (0, 60, 120, 240, 480 μg / mL) respectively, and the cell viability was evaluated using the CCK - 8 method. The results are as Figure 16 shown. As can be seen from Figure 16 A, Pae had little effect on the viability of M1 macrophages, indicating that Pae did not significantly change its pro - inflammatory function. As can be seen from Figure 16 B, Pae treatment significantly reduced the viability of M2 macrophages in a dose - dependent manner. In summary, Pae specifically targets the immunosuppressive properties of M2 macrophages, which are usually associated with tumor progression.
[0135] To further clarify the effect of Pae on the polarization of M2 macrophages, the present invention analyzed the expressions of M1 and M2 markers after Pae treatment. The results are shown in Figure 17 As shown. As can be seen from Figure 17 A and B, Pae increased the expressions of M1 - related markers (such as CD80 and IL - 12) in a dose - dependent manner, while reducing the expressions of M2 - related markers (such as CD163 and IL - 10).
[0136] Combining Figure 16 and Figure 17 results show that Pae transforms macrophage polarization towards a more pro - inflammatory M1 - type phenotype. In addition, the results of immunohistochemical analysis of the M2 macrophage marker CD206 by Pae are specifically shown in Figure 18 . As can be seen from Figure 18 , Pae treatment significantly reduced the expression of CD206 on the surface of TAMs, further supporting that Pae reprograms TAMs from a tumor - promoting M2 phenotype to a more anti - tumor phenotype.
[0137] Next, it was investigated how Pae affects TAMs by regulating CCL-22, a key cytokine secreted by M2 macrophages. The results are as Figure 19 shown. As can be seen from Figure 19 A, Pae treatment dose-dependently reduced the expression of the CCL-22 gene. Combining Figure 19 with B, it was further verified that Pae treatment correspondingly reduced the protein level of CCL-22 in TAMs. Figure 19 It is shown that Pae inhibits the prometastatic activity of TAMs by downregulating the expression of CCL-22.
[0138] Finally, the present invention detected the secretion of CCL-22 after Pae treatment of TAMs using ELISA. The results are as Figure 20 shown. As can be seen from Figure 20 , the secretion of CCL-22 decreased in a dose- and time-dependent manner with the increase of Pae concentration and treatment time, and this result further strengthened that Pae reduced the secretion of key cytokines promoting tumor progression and metastasis by regulating the tumor immune microenvironment.
[0139] In summary, these findings indicate that Pae reprograms TAMs from a tumor-promoting M2 phenotype to a more antitumor phenotype by regulating the viability and polarization of TAMs, and reduces the secretion of prometastatic factors such as CCL-22.
[0140] 2.4 Pae inhibits CCL-22 expression by regulating the p65 subunit in the NF-κB signaling pathway
[0141] To investigate the mechanism by which Pae reduces the secretion of CCL-22 in TAMs, the present invention evaluated the expression levels of p-p65, total p65, and CCL-22 in M2 macrophages treated with different concentrations of Pae (0, 60, 120, 240, 480 μg / mL). The results are shown in detail in Figure 21 . As can be seen from Figure 21 A, compared with the untreated group, Pae significantly reduced the level of p65 mRNA in M2 macrophages, although there was no significant difference among different Pae treatment doses. Figure 21 The results in B further verified that Pae dose-dependently reduced the protein expression of p-p65, p65, and CCL-22 in the concentration range of 0 μg / mL to 480 μg / mL.
[0142] To further explore how the change in p65 expression affects the secretion of CCL-22, the present invention constructed a lentiviral vector to induce overexpression or silencing of p65 in TAMs. The results are as Figure 22 and Figure 23 shown. As can be seen fromFigures 22 - 23 As can be seen from [reference], the expression changes of p-p65, p65 and CCL-22 after p65 gene silencing or overexpression were studied. Using this system, the present invention further investigated the expression of key signaling proteins in M2 macrophages treated with 240 μg / mL of Pae. The results are as Figure 24 shown in ( Figure 24 shown in A of [reference]) in p65-silenced cells, Pae treatment led to a further decrease in the levels of p-p65 and total p65, and consequently a corresponding decrease in CCL-22 expression. Conversely ( Figure 24 shown in B of [reference]), in p65-overexpressing cells, Pae treatment reversed the overexpression of p65 and altered the expression of CCL-22.
[0143] Figures 21 - 24 These results indicate that Pae reduces the expression of CCL-22 and restricts its pro-metastatic effect by regulating the NF-κB signaling pathway, particularly by modulating the p65 subunit.
[0144] 2.5 Docking and molecular dynamics simulations predict the binding of Pae to p65
[0145] To investigate the molecular mechanism by which Pae regulates the expression of the p65 subunit, the present invention first performed molecular docking simulations using AutoDock Vina software to predict the interaction between Pae and the p65 protein. The docking results revealed potential binding sites and provided insights into the binding affinity between Pae and p65 (data not shown). Specifically, the predicted binding free energy indicated that the interaction between Pae and p65 was favorable, suggesting that Pae might directly bind to p65 and thereby potentially affect its stability and function.
[0146] To further optimize these findings, the present invention used the NeuralPlex algorithm, which helped to determine the most favorable binding conformation and identify the key amino acid residues involved in intermolecular interactions. As Figure 25 shown in A of [reference], leucine 7, serine 370 and glycine 371 played important roles in stabilizing the Pae-p65 interaction. The main types of binding identified were hydrogen bonds and hydrophobic interactions, with intermolecular distances of 3.1, 2.2, 2.4 and
[0147] Next, the present invention performed site-directed mutagenesis on these key residues, substituting them with valine, and re-evaluated the docking scores, the results of which are as Figure 25 shown in B of [reference]. From the data in Table 1, it can be seen that the docking scores increased significantly after mutating these residues (Table 1 shows the binding energies of Pae to wild-type (WT) p65 and mutant-type (MT) p65 proteins), indicating that these key amino acids play a crucial role in the stability of the Pae-p65 complex.
[0148] Table 1
[0149]
[0150] Based on these preliminary findings, the present invention used GROMACS software to perform molecular dynamics (MD) simulations to evaluate the stability of the binding of Pae to wild-type and mutant p65. This enabled the present invention to compare the behaviors of wild-type p65 and mutant p65 after binding to Pae, and the results are as Figure 26 . As can be seen from Figure 26 , the RMSD value of the wild-type p65-Pae complex fluctuates less and remains relatively stable. In contrast, the binding stability of mutant p65 to Pae is poor. In addition, the number of hydrogen bonds formed between wild-type p65 and Pae is greater than that between mutant p65 and Pae, further supporting the view that the wild-type p65-Pae complex is more stable. This enhanced stability may be attributed to the specific binding of Pae to key residues, highlighting the importance of these interactions in regulating p65 stability and function.
[0151] 2.6 In vitro experiments on Pae stabilizing p65
[0152] To further verify the computational results, the present invention used CETSA to evaluate the thermal stability of p65 in M2 macrophages after treatment with Pae. As Figure 27 shown, in the DMSO-treated control group, the thermal stability of p65 decreased significantly when the temperature exceeded 44 °C. In contrast, the stability of the p65 complex after treatment with Pae increased significantly in the range of 47 - 56 °C. Specifically, the melting temperature (Tm) of p65 increased from 52.43 °C to 55.33 °C, reflecting a change in ΔTm of 2.9 °C. Whether Pae was treated or not, the stability of the reference protein β-actin did not change significantly, indicating that Pae significantly enhanced the thermal stability of p65.
[0153] In addition, to evaluate the concentration dependence of Pae on the stability of p65, the present invention detected the effect of different concentrations of Pae on the thermal stability of p65, and the results are as Figure 28 . Figure 28 In
[0154] 2.7 Pae enhances the inhibitory effect of Dox on the proliferation and metastasis of CRC cells
[0155] Previous studies have shown that Dox can inhibit the growth and metastasis of various cancers (including breast cancer, ovarian cancer, and brain cancer) through multiple mechanisms. One of the mechanisms is the PAR1 / NF-κB / miR-17 / E-cadherin pathway. In this study, the present invention evaluated the effects of Dox on the proliferation and metastasis of colorectal cancer (CRC) cells at concentrations of 10 and 20 μg / mL. To evaluate the effects of Dox on the behavior of CRC cells, the present invention employed a variety of experiments, including the CCK-8 assay (the results are shown in detail in Figure 29 ) for cell proliferation, the colony formation assay (the results are shown in detail in Figure 30 ) for long-term survival assessment, the Transwell assay (the results are shown in detail in Figure 31 ) for migration and invasion assessment, and the scratch assay (the results are shown in detail in Figure 32 ) for cell migration assessment. Figures 29 - 32 The results consistently showed that Dox significantly inhibited the proliferation, colony formation, migration, and invasion of CRC cells at these two concentrations (10 and 20 μg / mL), indicating its significant inhibitory effect on the malignancy of CRC cells.
[0156] To further evaluate the synergistic effect of Pae and Dox on the proliferation and metastasis of CRC cells, the present invention co-cultured CRC cells treated with Dox (10 and 20 μg / mL) with M2 macrophages treated with different concentrations of Pae (0, 60, 120, 240 μg / mL) or with the supernatants of these pre-treated macrophages. The results are shown in detail in Figures 33 - 34 . Figure 33 The results showed that the combined use of Pae and Dox enhanced the inhibitory effect of Dox, and the use of Dox alone also showed a dose-dependent inhibition of the proliferation of CRC cells. This was further confirmed in the colony formation assay (i.e., Figure 34 ), where the Pae-Dox combination treatment significantly reduced the colony formation of HCT116 and DLD1 cells.
[0157] Next, the present invention investigated the effects of the combined use of Pae and Dox on the migration and invasion of CRC cells. The results are shown in Figures 35 - 38 . As shown in Figure 35 and Figure 36 , compared with the group treated with Dox alone, the combined use of Pae and Dox significantly reduced the migration and invasion abilities of HCT116 and DLD1 cells. It is worth noting that ( Figure 35 and Figure 36 ) the combination of 20 μg / mL of Dox and 240 μg / mL of Pae had the strongest inhibitory effect on migration and invasion. From Figure 37 and Figure 38As can be seen, similarly, the migratory ability of tumor cells was also significantly reduced in the Pae-Dox combination treatment group. Figures 37 - 38 It is shown that Pae enhanced the inhibitory effect of Dox on the malignancy of CRC cells, indicating that the combined action of Pae-Dox on CRC cells may produce a synergistic anti-tumor effect.
[0158] 2.8 Pae enhances the synergistic inhibition of tumor metastasis in a mouse model of CRC liver metastasis by Dox
[0159] To evaluate the effects of Pae and Dox on the progression of colorectal cancer (CRC), a nude mouse liver metastasis model was established in the present invention. The mice in the blank group maintained a stable physiological state, while the mice in the model group and the experimental group showed slight loss of appetite and weight loss. Model group I and model group II, which received injections of CRC cells and M2 macrophages respectively, showed the most metastatic lesions ( Figure 39 ). As can be seen from Figure 39 , the high-dose combination group of Pae (300 mg / kg) and Dox (50 mg / kg) (corresponding to the Dox50+Pae group in Figure 39 ) significantly reduced liver metastasis. Among all the drug combination groups, the Dox50+Pae group showed the least liver metastasis. In contrast, the number of metastatic lesions in the single-drug treatment group was less than that in the model group, but the effect was not as good as that of the Dox50+Pae group, indicating that Dox and Pae have a synergistic inhibitory effect on the liver metastasis of CRC cells.
[0160] Western blot analysis showed (i.e., as can be seen from Figure 40 ) that the expression levels of p-p65, p65, and CCL-22 in model group I and model group II (CRC cells alone or CRC cells and M2 macrophages) were significantly higher than those in the blank group. The combined treatment in the Dox50+Pae group (Pae 300 mg / kg + Dox 50 mg / kg) most effectively reduced the expression of these proteins. The use of Dox or Pae alone could also reduce the expression of these proteins, but the effect was not as good as that of the Dox50+Pae group, indicating that Dox and Pae have a synergistic inhibitory effect on the expression of -p65, p65, and CCL-22.
[0161] HE staining showed (i.e., as can be seen from Figure 41 ) that the combined treatment in the Dox50+Pae group showed the fewest tumor nodules. As can be seen from Figure 42As can be seen, the combined treatment of the Dox50+Pae group showed significant liver protection, not only inhibiting tumor progression, but also maintaining the hepatic lobule structure and reducing vacuolization. Although the Dox25+Pae group still showed some tumor nodules and vacuolization, these changes were improved to a certain extent compared with the Dox25 group. These indicate that Pae enhanced the anti-tumor effect of Dox and provided liver protection in a dose-dependent manner.
[0162] From Figure 43 Furthermore, the analysis of the expression results of p-p65, p65, and CCL-22 showed that the Dox50+Pae group significantly inhibited the expression of key signaling proteins, while the effect of the Dox25+Pae group was weaker. These findings indicate that Pae enhanced the anti-tumor effect of Dox and provided protection for the liver by regulating TAMs and reducing the infiltration of immunosuppressive cytokines.
[0163] 3 Conclusions
[0164] This invention highlights the potential of Pae as an adjuvant therapy, which can enhance the therapeutic effect of Dox on CRC liver metastasis by targeting the NF-κB-CCL-22 axis in tumor-associated macrophages (TAMs). The research results of this invention support the rationality of combining Pae with existing chemotherapeutic drugs to improve the therapeutic effect of metastatic CRC. Given the key role of TAMs in mediating drug resistance, strategies targeting M2-type TAMs, such as Pae-based therapy, may provide a promising approach to overcome the limitations of conventional chemotherapy and improve patient prognosis.
[0165] Although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of paeonol in preparing a drug for improving the tumor microenvironment of colorectal cancer, characterized in that, The paeonol regulates the tumor microenvironment by modulating tumor-associated macrophages.
2. Use of paeonol according to claim 1 in the preparation of a drug for improving the tumor microenvironment of colorectal cancer, characterized in that, The paeonol regulates tumor-associated macrophages by inhibiting the functions of tumor-associated macrophages and reversing the polarization of tumor-associated macrophages.
3. Use of paeonol according to claim 2 in the preparation of a drug for improving the tumor microenvironment of colorectal cancer, characterized in that, The paeonol inhibits the CCL-22 protein secretion function of tumor-associated macrophages and reverses the polarization of tumor-associated macrophages by regulating the p65 subunit protein in the NF-κB signaling pathway in tumor-associated macrophages.
4. The use of paeonol according to claim 3 in the preparation of a drug for improving the tumor microenvironment of colorectal cancer, characterized in that, The paeonol binds to the p65 subunit protein to form a Pae-p65 complex.
5. Use of paeonol according to any one of claims 2 - 4 in the preparation of a drug for improving the tumor microenvironment of colorectal cancer, characterized in that, The reversal of the polarization of tumor-associated macrophages is as follows: The polarization of tumor-associated macrophages transforms into a tumor-associated macrophage phenotype with pro-inflammatory effects.
6. Use of paeonol combined with doxycycline in the preparation of a medicament for treating colorectal cancer, characterized in that, In the treatment of colorectal cancer, the combination of paeonol and doxycycline enhances the anti-colorectal cancer effect of doxycycline by paeonol regulating the tumor microenvironment.
7. Use of paeonol combined with doxycycline in the preparation of a medicament for treating colorectal cancer according to claim 6, characterized in that, The combination of paeonol and doxycycline provides liver protection in the treatment of colorectal cancer.
8. Use of paeonol combined with doxycycline according to any one of claims 6-7 in the preparation of a medicament for treating colorectal cancer, characterized in that, Use of the combination of paeonol and doxycycline in the preparation of a therapeutic drug for colorectal cancer liver metastasis.
9. A colorectal cancer treatment drug comprising paeonol and doxycycline.
10. A colorectal cancer treatment drug comprising paeonol and doxycycline according to claim 9, characterized in that, The mass ratio of the paeonol to the doxycycline is 0-6:0-1.