Preparation method and application of a bionic radix ophiopogonis

Abstract

The application provides a preparation method of bionic rhizoma bupleuri: analyzing the strain produced in natural rhizoma bupleuri in Guangdong, according to the formation principle of natural rhizoma bupleuri, flowing out the sap of artificial incision bamboo or phyllostachys bambusoides culm, inoculating the strain in the wound, and carrying out bionic fermentation culture by using the sap as culture medium to obtain the complex of specific fungi and fermentation conversion products, namely the bionic rhizoma bupleuri. The inoculated strain includes ascomycota, onygenales, bambuspora, and / or ascomycota, discomyces, and / or ascomycota, phaeosphaerion, and / or deuteromycotina, onygenales, fusarium. The bionic rhizoma bupleuri is in the form of decoction pieces, formula granules decoction pieces, ultra-micro broken decoction pieces and the like, and is used for the medical purposes of resisting external high fever convulsions, sputum, lung injury, delirium, epilepsy, stroke, fatty liver and hyperlipidemia.

Description

Technical Field

[0001] The present invention relates to the field of preparation of traditional Chinese medicine raw materials, and specifically, to a preparation method and application of bionic Shiraia bambusicola. Background Art

[0002] In clinical applications, Shiraia bambusicola is highly favored by doctors due to its remarkable efficacy, and its demand is continuously increasing. However, the resources of Shiraia bambusicola are very scarce.

[0003] Generally, natural Shiraia bambusicola is considered to be the dried lumps of the secretion fluid inside the culms of Bambusa textilis McClure or Sinocalamus warburgii Rendle, etc. Its formation process is that after the bamboo wasp bites holes in the bamboo, bleeding sap forms inside the bamboo, and the bleeding sap accumulates inside the bamboo and is continuously enriched over a long time. Bambusa textilis McClure or Sinocalamus warburgii Schizostachyum Chinese Rendle, etc. The bleeding sap accumulates inside the bamboo and is continuously enriched over a long time after the bamboo wasp bites holes in the bamboo and the bleeding sap forms inside the bamboo.

[0004] Currently, most of the Shiraia bambusicola on the market is obtained by burning bamboo forests and collecting the solidified distillate fluid cracked from the bamboo culms as Shiraia bambusicola. This product deviates from the formation of natural Shiraia bambusicola, and its substitution effect is quite controversial.

[0005] Chinese invention CN 111375024 B discloses a preparation method of Shiraia bambusicola. However, the theoretical basis of this invention believes that the formation of Shiraia bambusicola is the composition of the bleeding sap after Bambusa textilis or Sinocalamus warburgii is injured and infected. Therefore, this invention uses yeast and a combined bacterial community from three types of fungal groups to infect the fresh bamboo after punching holes, so that the bamboo is infected and secretes more bleeding sap, and its intention is also to enrich the bleeding sap, which constitutes the main material composition of the Shiraia bambusicola obtained by this invention.

[0006] However, the theoretical basis of the present invention is different. The present invention believes that after the bamboo wasp bores holes, the bleeding sap flows out of the bamboo, forming a natural culture medium and a nutritional environment for the growth of specific fungi. The specific fungi and the fermentation transformation products of the bleeding sap under the action of the fungi are the main components of natural Shiraia bambusicola. That is, its formation essence is an in-vivo fermentation process with bamboo bleeding sap as the culture medium, forming a fermentation transformation product and a specific fungal complex. However, the current existing technologies obviously cannot achieve this process.

[0007] In view of this, the present invention is specifically proposed. Summary of the Invention

[0008] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies existing in the prior art, and to provide a preparation method of bionic Shiraia bambusicola.

[0009] The second purpose of the present invention is to provide the bionic Shiraia bambusicola prepared by the above preparation method.

[0010] The third purpose of the present invention is to provide the application of the bionic Shiraia bambusicola.

[0011] The above-mentioned objective of this invention is achieved through the following technical solution:

[0012] A method for preparing biomimetic bamboo yellow involves inoculating fresh green bamboo or Huasilao bamboo wounds with fungi isolated from naturally occurring bamboo yellow produced in Guangdong or commercially available fungal strains, using bamboo wound sap as a culture medium for biomimetic in vivo fermentation culture, to obtain a complex of fungi and its fermentation transformation products, which is the biomimetic bamboo yellow (defined as Guangdong bamboo yellow); the inoculated fungal strains include at least the genus *Bambusa* of the order Hypocreales in the phylum Ascomycota (Ascomycota). Shiraia ) and / or Ascomycota genus *Plasmodium* ( Pestalotiopsis ) and / or Ascomycota genus Chromosporidium ( Apiospora / Early genus name Arthrinium ) and / or Fusarium genus of the order Lepidales of the subphylum Deuteromycetes ( Fusarium Fungi.

[0013] Based on the above theory, this invention innovatively isolated a specific fungus from naturally occurring *Bamboo Yellow* (a type of fungus) in Guangdong, deeply analyzed the fungal composition of naturally occurring *Bamboo Yellow*, and then inoculated this fungal strain or commercially available strains onto *Bamboo stalks* or *Bamboo serrata* for in vivo fermentation, cultivating a biomimetic *Bamboo Yellow* with a complex of fungi and transformation products as the main components. Specifically, based on the formation principle of natural *Bamboo Yellow*, this invention uses biomimetic technology to simulate the formation principle of natural *Bamboo Yellow*, implanting *Bamboo Yellow* fungi (a type of fungus) from naturally occurring *Bamboo Yellow* in Guangdong into *Bamboo stalks* or *Bamboo serrata* using a perforation method. Shiraia ) and / or Ascomycota genus *Plasmodium* ( Pestalotiopsis ) and / or Ascomycota genus Chromosporidium ( Apiospora / Early genus name Arthrinium ) and / or Fusarium genus of the order Lepidales of the subphylum Deuteromycetes ( Fusarium A fungal composition mainly composed of fungi, or commercially available fungal strains, are inoculated into wounds on fresh green bamboo or Huasilao bamboo, and fermented in vivo using bamboo wound sap as a culture medium to obtain a substance mainly composed of fungi and their fermentation transformation products, which is called biomimetic Tianzhuhuang. This biomimetic Tianzhuhuang conforms to the formation state of natural Tianzhuhuang, has a large yield, is easy to operate, and solves the problems of scarce natural Tianzhuhuang resources and difficulty in guaranteeing efficacy.

[0014] Furthermore, the preparation method includes the following steps:

[0015] S1. Drill holes in the stems of fresh green bamboo or Huasilao bamboo to the size of natural bamboo wasp borers;

[0016] S2. Intrapore implantation concentration is 10. 2 ~10 10 CFU / mL must include at least Ascomycota, Hypocreales, and the genus *Phyllostachys* ( Shiraia) and / or Ascomycota genus *Plasmodium* ( Pestalotiopsis ) and / or Ascomycota genus Chromosporidium ( Apiospora / Early genus name Arthrinium ) and / or Fusarium genus of the order Lepidales of the subphylum Deuteromycetes ( Fusarium The fungus is injected at a rate of 1 mL to 10 mL per incision, and the inoculation is repeated 1 to 5 times.

[0017] S3. Once a fungal complex (containing fungi and their fermentation products) has grown, collect and dry it to obtain biomimetic Tianzhuhuang (Guangtianzhuhuang).

[0018] Furthermore, the diameter of the hole is 0.8–2.5 mm, and the hole is located in the middle of the bamboo node. This ensures that the normal growth of the bamboo is not affected, and it is consistent with the formation conditions of natural bamboo yellow, thus forming biomimetic generation conditions.

[0019] Furthermore, the inoculation concentration is 300–3000 CFU / mL.

[0020] Furthermore, after inoculation, a culture medium that promotes bacterial colonization is added. Examples include gelatin, agar, honey, or mesona chinensis extract.

[0021] Furthermore, the fungus described is a species of bamboo fungus. Shiraia bambusicola Henn., fungi of the genus *Plasmodium* are Pestalotiopsis clavata Fungi of the genus *Chromospora* are Apiospora arundinis and Apiospora guiyangensis Fusarium fungi are Fusarium sporotrichioides The combination of the above bacterial strains allows for a continuous outflow of sap, providing a nutrient environment conducive to fungal growth. Apiospora arundinis It has the function of decomposing cellulose, and at the same time, the mixed strains ferment and transform the components of the sap sap.

[0022] Furthermore, the aforementioned Shiraia bambusicola Henn.、 Pestalotiopsis clavata , Apiospora arundinis , Apiospora guiyangensis and Fusarium sporotrichioides The proportions can be any combination of proportions.

[0023] The present invention also provides biomimetic Tianzhuhuang (Guangtianzhuhuang) prepared by any of the above-described preparation methods.

[0024] The biomimetic Tianzhuhuang (Guangtianzhuhuang) slices prepared according to the above method can be further refined and extracted to produce biomimetic Tianzhuhuang (Guangtianzhuhuang) extracts, formula granules, and ultra-fine pulverized cell-wall-breaking slices that can be used directly, in order to facilitate use and drug absorption.

[0025] This invention also provides a biomimetic extract or formulation granules of Bambusa textilis (Guangtianzhuhuang), prepared by the following method:

[0026] S1. Bionic Tianzhuhuang (Guangtianzhuhuang) is broken into coarse particles;

[0027] S2. Add 6-9 times the amount of 60%-80% ethanol, heat and reflux for extraction, 2-3.5 hours each time, extract 2-3 times, filter, combine the extracts, recover the ethanol to obtain an alcohol extract; soak the residue in 8-10 times the amount of water for 1-4 hours, heat and extract for 1.5-3 hours each time, extract 2-3 times, filter, concentrate to obtain an aqueous extract, and mix the alcohol and aqueous extracts obtained above to obtain an extract; or soak in 8-10 times the amount of water for 1-4 hours, heat and extract for 1.5-3 hours each time, extract 2-3 times, filter, concentrate to obtain an extract;

[0028] S3. The extract obtained in step S2 is dried and pulverized to obtain the biomimetic Tianzhuhuang water extract, or it can be further processed into formula granules by pressing and dry or wet granulation.

[0029] This invention also provides a biomimetic Tianzhuhuang (Guangtianzhuhuang) ultra-fine pulverized cell wall-breaking medicinal slice, which is obtained by completely drying the biomimetic Tianzhuhuang, breaking it into coarse particles, and then ultra-fine pulverizing it into fine powder of 120-250 mesh.

[0030] The present invention also provides the use of any of the above-mentioned biomimetic bamboo shavings, the biomimetic bamboo shavings extract or formula granules, or the biomimetic bamboo shavings ultrafine pulverized cell wall-breaking granules in the preparation of drugs for treating exogenous high fever convulsions, cough with sputum, lung injury, coma, epilepsy, stroke, fatty liver and / or hyperlipidemia.

[0031] The present invention also provides a medicine containing any of the above-mentioned biomimetic bamboo shavings, the biomimetic bamboo shavings extract or formula granules, or the biomimetic bamboo shavings ultrafine pulverized cell wall-breaking granules.

[0032] In order to overcome the natural resource limitations of natural Tianzhuhuang (a type of fungus), ensure its clinical efficacy, and maximize its medicinal value, the inventors of this invention studied the formation mechanism of natural Tianzhuhuang and explored the fungal species in naturally formed Tianzhuhuang produced in Guangdong. This invention simulates the formation mechanism of natural Tianzhuhuang. Based on the obtained information on fungal species, these species (including those from the genus *Xanthomonas* in the order Hypocreales of the phylum Ascomycota) can also be purchased commercially. Shiraia ) and / or Ascomycota genus *Plasmodium* ( Pestalotiopsis ) and / or Ascomycota genus Chromosporidium ( Apiospora ) and / or Fusarium genus of the order Lepidales of the subphylum Deuteromycetes ( Fusarium This invention achieves mass production of Bambusa textilis through inoculation and cultivation. It simulates the natural growth environment of Bambusa textilis and preferentially uses fungi of the genus *Phyllostachys*.Shiraia bambusicola Henn., fungi of the genus *Plasmodium* are Pestalotiopsis clavata Fungi of the genus *Chromospora* are Apiospora arundinis and Apiospora guiyangensis The preferred fungi are Fusarium species in the order Rhizocarpales of the subphylum Deuteromycetes. Fusarium sporotrichioides The substance is injected into specific bamboo plants, infecting them and causing the sap to flow out. The sap is then used as a culture medium to grow a complex of fungi and transformation products, thus producing high-quality Tianzhuhuang through this biomimetic method.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] (1) Existing technologies lack understanding and research on the formation mechanism of natural bamboo shavings. This invention has conducted in-depth research on the formation mechanism of natural bamboo shavings and has for the first time innovatively revealed that specific fungi and fermentation products are the main components of bamboo shavings when fresh bamboo is fermented in vivo using sap as a culture medium. Specific fungal groups of natural bamboo shavings from Guangdong were isolated, cultivated, and identified, which plays an important role in carrying out research on bamboo shavings alternatives.

[0035] (2) This invention provides a method for preparing biomimetic bamboo yellow, which is based on the formation principle of natural bamboo yellow. Fungi isolated from naturally formed bamboo yellow produced in Guangdong are used as inoculum, or commercially available inoculum are used. These inoculum are inoculated into wounds on fresh green bamboo or Huasilao bamboo, and bamboo sap is used as a culture medium for biomimetic in vivo fermentation. The resulting substance, mainly composed of fungi and their fermentation products, is the biomimetic bamboo yellow. The inoculated fungi include *Xanthomonas* genus and / or *Plasmodium* genus and / or *Brachysporium* genus and / or *Fusarium* genus from the order Hypocreales of the phylum Ascomycota and / or *Fusarium* genus from the order Chromosporales of the phylum Ascomycota and / or *Fusarium* genus from the order Lepidodendron of the subphylum Deuteromycetes. The biomimetic bamboo yellow obtained by this method has similar quality to natural bamboo yellow, with a high yield, solving the problem of scarce bamboo yellow resources. This invention provides biomimetic Tianzhuhuang (a type of medicinal herb) in the form of medicinal slices, extracted formula granules, and ultra-micro cell-wall-broken slices. It can be used for medicinal purposes such as treating exogenous febrile seizures, cough with phlegm, lung injury, coma, epilepsy, stroke, fatty liver, and hyperlipidemia. Detailed Implementation

[0036] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0037] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0038] The isolation and purification of specific fermentation fungi inspired by Bionic Bambusa textilis were accomplished through the following experiments:

[0039] Material source: Green bamboo collected from Huaiji County, Zhaoqing City, Guangdong Province ( Bambusa textiles Mc Clure Fresh Tianzhuhuang (a type of medicinal herb) in )

[0040] Culture medium:

[0041] (1) PDA culture medium: Peel 200g of potatoes (slice and boil, filter with 8 layers of gauze to obtain the filtrate), add 20g of glucose and 20g of agar powder while hot, stir well, add water to 1000mL, and set the pH to natural.

[0042] (2) PDA liquid culture medium: 200g potato (sliced ​​and boiled, filtered through 8 layers of gauze to obtain the filtrate), 20g glucose, 1000mL water, natural pH.

[0043] All the above culture media were sterilized in a high-pressure steam sterilizer at 121°C for 30 minutes after preparation.

[0044] Tissue block isolation method: First, clean the surface of the fruiting body of *Hemiberlesia lingua*. Under aseptic conditions, use sterile scissors to cut the fruiting body into 3*3*3mm tissue blocks. Wash the tissue blocks twice with sterile water, then disinfect with 75% ethanol for 30 seconds and 2% sodium hypochlorite for 5 minutes. Rinse three times with sterile water. Finally, place 4 tissue blocks in each petri dish containing different bacterial isolation media, arrange them evenly, and incubate upside down in a constant temperature incubator at 25℃. Observe the colony growth after 3-5 days, and purify the isolated strains using the single spore isolation method.

[0045] Shake fermentation: The selected strains were inoculated into 250 mL shake flasks containing 100 mL of PDA liquid medium. The mixture was fermented on a shaker at 25°C and 150 rpm for 48 h to prepare for subsequent HPLC detection of the active pharmaceutical ingredient.

[0046] Molecular biological identification: Genomic DNA of *Pterocarya stenoptera* was extracted using a modified CTAB method, and then the ITS region of the rDNA was amplified by PCR. The primers used were ITS1 / ITS4 (sequences 5'-GGAAGTAAAAGTCGAAACAA-3' (SEQ ID No. 1) and 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID No. 2), respectively). The amplified fragment included part of 18S rDNA, ITS1 and ITS2, 5.8 rDNA, and part of 28S rDNA.

[0047] The PCR reaction volume was 50 μL, including: 5 μL 10 x Taq Reaction buffer, 4 μL 25 mmol / L Mg2+, 2 μL each of 5 μmol / L ITSI-F and ITS4-B, 1 μL 40 mmol / L dNTP, 90 ng DNA template, 0.6 μL 5 U / μL Tag polymerase, and double-distilled water to a final volume of 50 μL. The amplification reaction was performed on a My Cycler PCR instrument. The amplification program was: 95°C pre-denaturation for 5 min, followed by 95°C denaturation for 1 min, 53°C annealing for 1 min, and 72°C extension for 1 min 30 s, for a total of 35 cycles. A final extension at 72°C for 7 min was performed. The amplified products were stored at 4°C.

[0048] The obtained PCR products were obtained by Qingke Biotechnology Co., Ltd. Based on the rDNA-ITS sequencing results of the strain, BLAST alignment was performed in the NCBI database (http: / / www.ncbi.nlm.nih.gov / BLAST) for homology sequence analysis. The results are shown in Table 1 below, indicating that the fungal species in naturally formed *Bamboo Scutellaria baicalensis* from Guangdong mainly consist of the following five species.

[0049] Table 1. rDNA-ITS sequencing results of the strain and Blast alignment results in the NCBI database.

[0050]

[0051] Shiraia bambusicola Henn. rDNA-ITS sequence (SEQ ID No.3):

[0052] tccgtaggggtgacctgcggaaggatcattacctagtagtacggggttatagcaatatagccccagtctgcacccatgtcttttgcgtactaaatgtttcctcggcaggcctgcctgccggttggacacgcttatactctttgtaattgcaatcagcgtctgaaccaactataatatttacaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtagtgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccccatggtattccatggggcatgcctgttcgagcgtcatttgaaaactcaagctttgcttggtattgggtggttgtcctgttctttgcaactggactcgccttaaagatattggcagccggcattttggccttggagcgcagcacaatttgcggatccaggttggagtactgacgtccatttaagcttaccacgcttgacctcggatcaggtagggatacccgctgaacttaagcatatcaaaagccgggaggaag。

[0053] Pestalotiopsis clavata rDNA-ITS sequence (SEQ ID No.4):

[0054] caaggtctccgttggtgaaccagcggagggatcattatagagttttctaaactcccaacccatgtgaacttaccattgttgcctcggcagaagctgctcggtgcaccttaccctggaacggcctaccctgtagcgccttaccctggaacggcttaccctgtagcggctgccggtggactaccaaactcttgttattttattgtaatctgagcgtcttattttaataagtcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgcccattagtattctagtgggcatgcctgttcgagcgtcatttcaacccttaagcctagcttagtgttgggagcctactgcttttgctagctgtagctcctgaaatacaacggcggatctgcgatatcctctgagcgtagtaatttttatctcgcttttgactggagttgcagcgtctttagccgctaa。

[0055] Apiospora arundinis rDNA-ITS sequence (SEQ ID No.5):

[0056] gccgctggtactggtgagttcgaggctggtatctccaaggatggccagactcgtgagcacgctctgctcgccttcaccctcggtgtcaagcagctcatcgtcgccatcaacaagatggacaccaccaagtggtctgaggcccgttacaaggagatcatcaaggagacctcctctttcatcaagaaggtcggctacaaccccaaggaggtcgctttcgtccccatctccggcttccacggcgacaacatgctggaggagtccggcaacatgccctggtacaagggttgggagaaggagaccaaggctggcggcaagaagaccggcaagaccctgttccaggccatcgatgccatcaactctccccagcgtcctaccgacaagcccctccgtcttcccctccaggatgtttacaagatcggtggtattggcactgtgcccgtcggccgtatcgagaccggtactctgaagcccggtatggtcgtcaccttcgctcccgccaacgtcaccactgaggtcaagtccgtcgagatgcaccaccagcagcttcccgagggtttccccggtgacaacgttggtttcaacgtcaagaacgtctccgtcaaggagatccgtcgtggcaacgttgccggtgactccaagaacgacccccctctgggtgccgcttctttcaacgcccaggtcattgtcctcaaccaccctggtcagatcggtgccggttacgctcccgtcctcgattgccacaccgcccacattgcttgcaagttctctgagcttcttgagaagatcgaccgccgtactggtaagtcggttgagaactctcccaagttcgtcaagtctggtgatgccgccatcgtcaagatgattccctccaagcccatgtgcgttgaggctttcaccgac。

[0057] Apiospora guiyangensis rDNA-ITS sequence (SEQ ID No. 6):

[0058] tgtaacaaggtctccgttggtgaaccagcggagggatcattacagagttatacaactcccataccatttgtaaactttactcagttatgcctcggcgtgaactgcgtacggaggcagagtggtgttacccggtaagctaccctgtagcttaccctgtagcactaccctgcaccactcccgcgcagcccgccggtggtacactaaactcttgttttattttatattctgagcgtattattttaataattaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgcccatcagtattctggtgggcatgcctgttcgagcgtcatttcaacccttaagcctagcttagtgttgggaatctactgtattgtagttccttaaagacagtggcggagcgatagttgtcctctgagcgtagtaaatttatttctcgcttctgtaaggctctatcctcccgccataaaacccccaattttttagtggttgacctcggatcaggtaggaatacccgctgaacttaagcata。

[0059] Fusarium sporotrichioides rDNA-ITS sequence (SEQ ID No.7):

[0060] .

[0061] By purchasing the aforementioned bacterial strains, biomimetic Tianzhuhuang was prepared by mimicking the formation principle of natural Tianzhuhuang.

[0062] In the following embodiments, Shiraia bambusicola Henn. Purchased from Ningbo Mingzhou Biotechnology Co., Ltd., product number BMZ075832; Pestalotiopsis clavata Purchased from Nuoan Gene Technology (Wuhan) Co., Ltd., product number RN-35611; Apiospora arundinis Purchased from Gray Algae Biotechnology, product number HZB597350 ; Apiospora guiyangensis Purchased from China General Microbiological Culture Collection Center, accession number CGMCC3.20365; Fusarium sporotrichioidesPurchased from Taisto Biotechnology, product number TS132130. Example 1

[0063] 1) Drill holes in the middle of the upper and middle sections of green bamboo with a diameter of 4 to 9 cm. Drill holes in a distributed manner depending on the thickness of the bamboo. The diameter of the holes varies from 1.0 to 2.5 mm.

[0064] 2) Fungi Shiraia bambusicola Henn.、 Pestalotiopsis clavata , Apiospora arundinis , Apiospora guiyangensis , Fusarium sporotrichioides Prepare a mixed bacterial solution in a ratio of 1:1:1:1:1. Add PDA, peptone medium, and an appropriate amount of gelatin to the bacterial solution to increase viscosity and facilitate colonization. The concentration of the mixed bacterial solution is 1000 CFU / mL.

[0065] 3) After the wound fluid flows out of the hole, apply 5-10 mL of mixed bacterial solution to each hole opening and the wound fluid.

[0066] 4) Observe the colonization and growth of the fungal strain, replant 1 to 4 times, and after about 3 months, collect the fungal complex (containing fungi and their fermentation products), dry it, and 15.3 to 28.2g of biomimetic Tianzhuhuang can be obtained from each bamboo section.

[0067] 5) A total of 5.9 kg of biomimetic bamboo yellow was obtained in this embodiment. Example 2

[0068] 1) Drill holes in the middle of the upper and middle sections of the Huasilao bamboo with a diameter of 4 to 8 cm. The diameter of the holes varies from 0.8 to 1.5 mm depending on the thickness of the bamboo.

[0069] 2) Fungi Shiraia bambusicola Henn.、 Pestalotiopsis clavata , Apiospora arundinis , Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestalotiopsis clavata Apiospora arundinis Apiospora guiyangensis Fusarium sporotrichioides Shiraia bambusicola Pestal , Fusarium sporotrichioides Prepare a mixed bacterial solution in a ratio of 1:1:1:1:1. Add PDA culture medium and an appropriate amount of honey to the bacterial solution to increase viscosity and facilitate colonization. The concentration of the mixed bacterial solution is 300 CFU / mL.

[0070] 3) After the wound fluid flows out of the hole, apply 3-6 mL of mixed bacterial solution to each hole opening and the wound fluid.

[0071] 4) Observe the colonization and growth of the fungal strain, replant 1 to 3 times, and after about 3 months, collect the fungal complex (containing fungi and their fermentation products), dry it, and 11.5 to 27.6g of biomimetic Tianzhuhuang can be obtained from each bamboo section.

[0072] 5) A total of 4.6 kg of biomimetic Tianzhuhuang was obtained in this embodiment. Example 3

[0073] 1) Drill holes in the middle of the upper section of a green bamboo with a diameter of 4-9cm. The hole diameter varies from 1.0 to 2.5mm depending on the thickness of the bamboo.

[0074] 2) Fungi Shiraia bambusicola Henn.、 Pestalotiopsis clavata , Apiospora reed , Apiospora guiyangensis , Fusarium sporotrichioides Prepare a mixed bacterial solution in a ratio of 1:1:3:1:1. Add PDA, peptone medium, and an appropriate amount of agar to the bacterial solution to increase viscosity and facilitate colonization. The concentration of the mixed bacterial solution is 2000 CFU / mL.

[0075] 3) After the wound fluid flows out of the hole, apply 8 mL of mixed bacterial solution to each hole opening and the wound fluid.

[0076] 4) Observe the colonization and growth of the fungal strain, replant 1 to 3 times, and after about 3 months, collect the fungal complex (containing fungi and their fermentation products), dry it, and 18.1 to 29.4g of biomimetic Tianzhuhuang can be obtained from each bamboo section.

[0077] 5) A total of 5.5 kg of biomimetic bamboo yellow was obtained in this embodiment.

[0078] This invention discovers Apiospora reed The fungal strain can decompose the cellulose inside the bamboo, which is beneficial for the secretion of sap and increases the yield of each section. Example 4

[0079] 1) Drill holes in the middle of the upper and middle sections of the Huasilao bamboo with a diameter of 4 to 8 cm. The diameter of the holes varies from 0.8 to 1.5 mm depending on the thickness of the bamboo.

[0080] 2) Fungi Shiraia bambusicola Henn.、 Pestalotiopsis clavata , Apiospora reed , Apiospora guiyangensis , Fusarium sporotrichioides Prepare a mixed bacterial solution in a ratio of 1:1:3:1:1. Add PDA, peptone medium, and an appropriate amount of herbal extract to the bacterial solution to increase viscosity and facilitate colonization. The concentration of the mixed bacterial solution is 3000 CFU / mL.

[0081] 3) After the wound fluid flows out of the hole, apply 8 mL of mixed bacterial solution to each hole opening and the wound fluid.

[0082] 4) Observe the colonization and growth of the fungal strain, replant 1 to 3 times, and after about 3 months, collect the fungal complex (containing fungi and their fermentation products), dry it, and 14.8 to 27.6g of biomimetic bamboo yellow can be obtained from each section of bamboo.

[0083] 5) A total of 5.1 kg of biomimetic bamboo yellow was obtained in this embodiment.

[0084] In the embodiments of Huasiluo bamboo, the same can be seen Apiospora reed The fungal strain can decompose the cellulose inside the bamboo, increasing the yield per section. Example 5

[0085] Two kg of the biomimetic bamboo shavings obtained in Example 1 were crushed into coarse particles. Eight times the amount of 70% ethanol was added, and the mixture was heated under reflux for 3 hours each time, twice. The extracts were filtered, combined, and the ethanol was recovered to obtain an alcoholic extract. The residue was soaked in ten times the amount of water for 3 hours, then heated for 2.5 hours each time, twice. The extracts were filtered, concentrated, and an aqueous extract was obtained. The alcoholic and aqueous extracts were mixed, dried under reduced pressure, and pulverized to obtain the extract or, by pressing, the granules were prepared into a formula. The yield was measured to be 33.7%. Example 6

[0086] Take 2 kg of the biomimetic bamboo shavings obtained in Example 2, crush it into coarse particles, add 10 times the amount of water and soak for 4 hours, heat and reflux for extraction, 2.5 hours each time, extract 3 times, filter, concentrate to obtain an aqueous extract, dry the obtained extract under reduced pressure, and pulverize to obtain the biomimetic bamboo shavings aqueous extract; or wet granulate to make formula granules. The measured extract yield was 30.3%, slightly lower than the alcohol and water extraction dual extraction method, but with lower cost and higher efficiency. Example 7

[0087] The biomimetic bamboo yellow obtained in Example 1 was dried completely at 80°C, then crushed into coarse particles. These coarse particles were then pulverized into 160-mesh fine powder using an ultra-micro pulverizer, yielding biomimetic bamboo yellow ultra-micro pulverized cell-wall broken medicinal slices. The powder yield was 93.6%.

[0088] The biomimetic bamboo sap obtained by this invention can be used as natural bamboo sap. It has a sweet taste and cold nature; it enters the heart and liver meridians, clearing heat and resolving phlegm, calming the mind and relieving convulsions. Compared to simple bamboo sap or other artificial products, this biomimetic bamboo sap is a complex of fermented fungi and transformed sap. After fermentation, its cold nature is greatly reduced, which is a shortcoming of other substitutes. This reduces contraindications caused by excessive coldness, and its expectorant effect is definite. Its medicinal uses for exogenous febrile convulsions, cough with phlegm, lung injury, coma, epilepsy, stroke, fatty liver, and hyperlipidemia can be illustrated by the following experimental examples.

[0089] Experimental Example 1: Study on the antipyretic effect of biomimetic Bambusa textilis

[0090] Animals: 70 male SD rats, 8 weeks old, weighing 180±20g.

[0091] Drugs: Biomimetic Bambusa textilis slices from Example 1, biomimetic Bambusa textilis extract from Example 5, and biomimetic Bambusa textilis ultrafine pulverized and cell-wall-broken slices from Example 7.

[0092] Positive test result: Acetaminophen tablets.

[0093] Methods: Rats were randomly divided into four groups of 10 each: blank group, model group, positive control group (acetaminophen), high-dose group (1.4 g / kg) and low-dose group (0.7 g / kg) of Example 1, group 5 (0.468 g / kg), and group 7 (1.324 g / kg). Before the experiment, rats were fasted for 12 hours but allowed free access to water. Body temperature was measured three times consecutively on the day of the experiment, and the average value was used as the initial body temperature. Control group rats were administered physiological saline (10 mL / kg) subcutaneously on their backs, while other rats were administered 20% dry yeast suspension subcutaneously on their backs to establish a fever model. The acetaminophen group and each dose group of the biomimetic bamboo shavings were administered the drug once 30 minutes before and 3.5 hours after modeling. The control group and model group were administered an equal volume of physiological saline (10 mL / kg) via gavage. After 8 hours of rectal temperature measurement, blood was collected from the abdominal aorta for inflammatory factor detection. The results are shown in Tables 2 and 3.

[0094]

[0095]

[0096] Results: The body temperature of rats in the model group was significantly elevated 4 h after modeling (P < 0.01), indicating that this study successfully replicated the rat fever model induced by dried yeast. After gavage administration of the biomimetic *Bamboo Sinensis* samples from Examples 1, 5, and 7, the rectal temperature of rats was significantly reduced (P < 0.01). Inflammatory factor assays showed that the biomimetic *Bamboo Sinensis* slices, extract, and ultrafine fragmented slices could significantly reverse the elevated levels of IL-6, IL-1β, TNF-α, PGE2, cAMP, and CRH induced by subcutaneous injection of dried yeast in the back (P < 0.01). This indicates that the antipyretic mechanism of the biomimetic *Bamboo Sinensis* slices, extract, and ultrafine fragmented slices is related to their inhibition of the inflammatory response.

[0097] Conclusion: The biomimetic Tianzhuhuang has a significant antipyretic effect, which reflects its heat-clearing efficacy.

[0098] Experimental Example 2: Study on the antiepileptic effect of biomimetic Bambusa textilis

[0099] Animals: 70 male SD rats, 8 weeks old, weighing 180±20g.

[0100] Drugs: Biomimetic Bambusa textilis slices from Example 3, biomimetic Bambusa textilis granules from Example 6, and biomimetic Bambusa textilis ultrafine pulverized and cell-wall-breaking slices from Example 7.

[0101] Positive test result: Sodium valproate oral solution

[0102] Methods: Male SD rats were separated and acclimatized for 7 days. The control group received an intraperitoneal injection of an equal dose of 0.9% sodium chloride solution, while the other rats received an intraperitoneal injection of PTZ 50 mg / kg for a total of 7 days. Seizure severity, incidence of somatic tonic-clonic seizures, and mortality were observed and recorded after injection. After each PTZ injection, the rats' behavior was observed for 30 minutes, and seizure severity was evaluated according to the Racine grading system. Seizure severity was recorded, and three consecutive seizures of grade IV or higher were considered a complete ignition. Administration was by gavage. The positive control group (sodium valproate) received 200 mg / kg; Example 3 included a high-dose group (1.4 g / kg), a low-dose group (0.7 g / kg), Example 6 a group (0.468 g / kg), and Example 7 a group (1.324 g / kg). After 21 days of administration, the rats were fasted for 12 hours but allowed free water, anesthetized with 3% sodium pentobarbital, and blood was drawn from the abdominal aorta. Results are shown in Tables 4 and 5.

[0103]

[0104]

[0105] Results: 7-18 minutes after intraperitoneal injection of PTZ, rats in the model group exhibited forelimb spasms accompanied by varying degrees of orthostatic, tonic-clonic seizures, and falls. Some severe cases reached grade V, characterized by generalized tonic-clonic seizures, prolonged standing, loss of balance, and falls. The positive control group (sodium valproate), as well as the biomimetic Tianzhuhuang (bamboo shavings), formulated granules, and ultrafine fragmented pieces, significantly improved the tonic-clonic seizure symptoms in rats. Furthermore, measurements of neurotransmitter levels in the hippocampus of rats in each group revealed that intraperitoneal injection of PTZ significantly reduced GABA levels and increased Glu levels in the brain (P < 0.01). Administration of sodium valproate and biomimetic Tianzhuhuang significantly reversed this trend.

[0106] Conclusion: Biomimetic Bambusa textilis exerts its antiepileptic effect by improving symptoms of tonic-clonic seizures and regulating the content of neurotransmitters in the hippocampus.

[0107] Experimental Example 3: The Antifebrile Convulsion Effect of Biomimetic Bambusa textilis

[0108] Animals: 70 male SD rats, 3 weeks old, weighing 50±10g.

[0109] Drugs: High-dose group (1.4g / kg) and low-dose group (0.7g / kg) of biomimetic Tianzhuhuang decoction pieces in Example 3, biomimetic Tianzhuhuang formula granules (0.468g / kg) in Example 6, and biomimetic Tianzhuhuang ultra-fine broken decoction pieces (1.324g / kg) in Example 7.

[0110] Positive test result: Sodium valproate oral solution 200 mg / kg.

[0111] Methods: A febrile seizure model was established in SD rats using a combination of a hot water bath model and intraperitoneal injection of lipopolysaccharide (LPS). Specifically, after 3 days of drug administration, 200 μg / kg of LPS was injected intraperitoneally 1 hour before the last gavage. The gavage volume was 10 mL / kg, and the intraperitoneal injection volume was 5 mL / kg. Two hours after gavage, the rats were placed in a 3L beaker and kept at a constant temperature of 45℃ in a water bath, allowing them to swim freely. If any rat exhibited seizure-like behaviors affecting their swimming ability, such as head clonic movements, head shaking, or forelimb spasms, they were immediately removed from the water. Successful modeling was considered to occur if a seizure was observed within 5 minutes; otherwise, no seizure was considered to have occurred. Seizure latency and seizure scores were observed and recorded, using the Racine grading system. Three hours after the last administration, the rats were anesthetized with 3% sodium pentobarbital, and blood was collected from the abdominal aorta.

[0112]

[0113] Results: Except for the normal control group, all rats in the other groups experienced febrile seizures within 5 minutes, with a modeling success rate of 100%. Compared with the normal control group, the seizure latency in the model group was approximately 2 minutes, with a seizure score of 4-5, and the rectal temperature increased to approximately 42℃, which was statistically significant (P < 0.01). Compared with the model group, all groups treated with biomimetic Tianzhuhuang significantly prolonged the seizure latency and significantly reduced the severity of seizures, with a significant decrease in rectal temperature (P < 0.01 or P < 0.05).

[0114] Conclusion: Biomimetic Bambusa textilis exerts a significant antifebrile seizure effect by improving symptoms of tonic-clonic seizures and reducing rectal temperature. Except for the normal control group, all rats in the other groups experienced febrile seizures within 5 minutes, with a 100% model establishment success rate. Compared with the normal control group, the model group rats had a seizure latency of approximately 2 minutes, a seizure score of 4-5, and an increased rectal temperature to approximately 42℃, which was statistically significant (P < 0.01). Compared with the model group, all groups treated with biomimetic Bambusa textilis significantly prolonged the seizure latency and significantly reduced the severity of seizures, with a marked decrease in rectal temperature (P < 0.01 or P < 0.05).

[0115] Conclusion: Biomimetic Bambusa textilis exerts a significant antifebrile seizure effect by improving symptoms of tonic-clonic spasm and reducing anal temperature.

[0116] Experimental Example 4: Study on the therapeutic effect of biomimetic Tianzhuhuang (a type of medicinal herb) on stroke

[0117] Animals: 70 male SD rats, weighing 300±20g.

[0118] Drugs: High-dose group (1.4g / kg) and low-dose group (0.7g / kg) of biomimetic Tianzhuhuang slices in Example 4, Biomimetic Tianzhuhuang extract (0.468g / kg) in Example 6, and Ultrafine broken slices (1.324g / kg) in Example 7.

[0119] Positive test result: Nimodipine solution.

[0120] Methods: A rat model of ischemic stroke was established using a modified Longa suture occlusion method, as follows: Seventy male SD rats were acclimatized for one week and then randomly divided into a blank control group, a sham-operated group, a model group, a positive drug group, and various drug administration groups. All rats were administered the drug via gavage for four consecutive days, with free access to food and water. On the evening of the fourth day, food and water were restricted, and the drug was administered via gavage once an hour before model establishment on the fifth day. Except for the sham-operated group, all other groups were anesthetized by intraperitoneal injection of 3% sodium pentobarbital. The left common carotid artery, external carotid artery, and internal carotid artery were bluntly dissected and exposed. The distal end of the external carotid artery and the proximal end of the common carotid artery were ligated with sutures, and the distal end of the internal carotid artery was clamped with a micro-arterial clamp. A small incision (0.2 mm) was made at the bifurcation of the common carotid artery. The suture was gently advanced through the common carotid artery and internal carotid artery to the origin of the middle cerebral artery, approximately 18 mm from the bifurcation, thus occluding the left middle cerebral artery. Two hours after the rats experienced ischemia, the suture was gently pulled out to allow reperfusion. Twelve hours after reperfusion, rats were scored on a 5-point scale. The scoring criteria were as follows: 0 points, no neurological damage symptoms; 1 point, inability to fully extend the contralateral forepaw; 2 points, turning in circles to the contralateral side; 3 points, falling to the contralateral side; 4 points, inability to walk spontaneously and loss of consciousness; 5 points, death. The results are shown in Table 7.

[0121]

[0122] Results: Except for the sham-operated group, all other groups of rats exhibited bradykinesia and inability to extend their right forepaws; some rats crawled in circles, and in severe cases, they were unable to walk spontaneously and lost consciousness. The model group showed the most severe neurological impairment and the largest proportion of cerebral infarction area, which was statistically significant compared with the sham-operated group (P < 0.01). Compared with the model group, biomimetic Tianzhuhuang slices, extracts, and ultra-finely broken slices all significantly improved the postoperative behavioral symptoms of rats and reduced the proportion of cerebral infarction area (P < 0.01).

[0123] Conclusion: Biomimetic Tianzhuhuang slices, extracts, and ultra-finely broken slices exert significant anti-stroke effects by improving neurological function damage and reducing the proportion of cerebral infarction area.

[0124] Experimental Example 5: Study on the lipid-lowering effect of biomimetic Tianzhuhuang (Bamboo Shavings)

[0125] Animals: 70 male SD rats, 8 weeks old, weighing 200±20g. The rats were fed a high-fat diet, purchased from Beijing Xiaoshuyoutai (Beijing) Biotechnology Co., Ltd.

[0126] Drugs: High-dose group (1.4g / kg) and low-dose group (0.7g / kg) of biomimetic Tianzhuhuang decoction pieces in Example 4; biomimetic Tianzhuhuang formula granules (0.468g / kg) in Example 6; and biomimetic Tianzhuhuang ultra-fine broken decoction pieces (1.324g / kg) in Example 7.

[0127] Positive test result: Fenofibrate tablets 40 mg / kg.

[0128] Methods: Seventy male SD rats were acclimatized for one week and then randomly divided into a control group (maintenance diet) and a high-fat diet model group. After four weeks of continuous feeding, rats were randomly selected from both the control and model groups. Blood samples were collected from the eyelid veins under fasting conditions to detect the levels of triglycerides (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C). If the levels of TG, TC, and LDL-C were significantly higher than those in the control group and statistically significant, the model was considered successfully established. After successful modeling, the rats in the model group were randomly divided into a model group, a positive drug group, high- and low-dose groups (Example 4), Example 6, and Example 7, and administered the drugs by gavage for four weeks. Twelve hours after the last administration, the rats were anesthetized with 3% sodium pentobarbital, and blood was collected from the abdominal aorta. The results are shown in Table 8.

[0129]

[0130] Results: The levels of TG, TC, and LDL-C in rats on a high-fat diet were significantly higher than those in the blank control group, indicating successful model establishment. After 4 weeks of drug administration, the levels of TG, TC, and LDL-C in the model group were significantly higher than those in the blank control group, while the level of HDL-C was significantly lower than that in the blank control group, and the differences were statistically significant (P < 0.01). Compared with the model group, biomimetic Tianzhuhuang decoction pieces, formulated granules, and ultra-finely crushed decoction pieces could all significantly reduce the levels of TG, TC, and LDL-C in hyperlipidemic rats and increase the level of HDL-C (P < 0.01).

[0131] Conclusion: Biomimetic Tianzhuhuang has a significant lipid-lowering effect.

[0132] Experimental Example 6: Study on the expectorant effect of biomimetic Bambusa textilis

[0133] Animals: 60 male Kunming mice, 8 weeks old, weighing 20±2g.

[0134] Drugs: High-dose group (1.4g / kg) and low-dose group (0.7g / kg) of biomimetic Tianzhuhuang decoction pieces in Example 3; Biomimetic Tianzhuhuang formula granules (0.468g / kg) in Example 5; and Biomimetic Tianzhuhuang ultra-fine broken decoction pieces (1.324g / kg) in Example 7.

[0135] Positive test result: Ambroxol hydrochloride 180 mg / kg.

[0136] Methods: A phenol red excretion experiment was conducted in mice to evaluate the expectorant effect of biomimetic bamboo shavings. Mice were randomly divided into a blank group, a positive drug group, high-dose and low-dose groups (Example 3), a group (Example 5), and a group (Example 7), with 10 mice in each group. The drugs were administered by gavage twice daily for 7 consecutive days. Thirty minutes after the last administration, a 5% phenol red solution was injected intraperitoneally at a dose of 10 mL / kg. Thirty minutes later, the mice were euthanized by cervical dislocation, and the trachea was separated. The tracheal segment from the thyroid cartilage to the tracheal bifurcation was placed in 2 mL of physiological saline, sonicated for 5 min, shaken for 20 min, and centrifuged at 4°C for 5 min. The supernatant was collected. The absorbance (A) was measured at 546 nm using a microplate reader in 96 wells. The phenol red content was calculated using a regression equation, and the results are shown in Table 9.

[0137]

[0138] Results: Compared with the blank control group, the amount of phenol red excreted in each treatment group of the example was significantly increased (P < 0.01).

[0139] Conclusion: Biomimetic Bambusa textilis has a significant expectorant effect.

[0140] Experimental Example 7: Study on the Anti-Acute Lung Injury Effect of Biomimetic Bambusa textilis

[0141] Animals: 70 male ICR mice, 8 weeks old, weighing 20±2g.

[0142] Materials: Lipopolysaccharide (purchased from Sigma-Aldrich, USA).

[0143] Drugs: High-dose group (1.4g / kg) and low-dose group (0.7g / kg) of biomimetic Tianzhuhuang decoction pieces in Example 3; Biomimetic Tianzhuhuang formula granules (0.468g / kg) in Example 5; and Biomimetic Tianzhuhuang ultra-fine broken decoction pieces (1.324g / kg) in Example 7.

[0144] Positive test result: Dexamethasone 40 mg / kg.

[0145] Methods: An acute lung injury mouse model was established by intraperitoneal injection of lipopolysaccharide (LPS). The procedure was as follows: Seventy male ICR mice were randomly divided into four groups: blank group, model group, positive control group, high-dose group (Example 3), low-dose group (Example 5), and Example 7 group (n=10 per group). From day 1 to day 3, all treatment groups received the drug via gavage once daily. On day 4, the model group and all treatment groups received an intraperitoneal injection of 20 mg / kg LPS to establish the acute lung injury mouse model, while the control group received an equal volume of PBS intraperitoneally. The results are shown in Table 10.

[0146]

[0147] Results: No mice died after modeling. Compared with the control group, the lung tissue W / D ratio of the model group mice was significantly increased (P<0.01); compared with the model group, all groups of biomimetic Tianzhuhuang significantly reduced the lung tissue W / D of mice with acute lung injury (P<0.01). ELISA results showed that compared with the control group, the serum levels of IFN-γ, TNF-α, IL-4, and IL-12 of the model group mice were significantly increased (P<0.01), and compared with the model group, all groups of biomimetic Tianzhuhuang significantly reduced the serum levels of inflammatory factors in mice with acute lung injury (P<0.01).

[0148] Conclusion: Biomimetic Bambusa textilis has a significant anti-acute lung injury effect.

Claims

1. A method for preparing biomimetic Tianzhuhuang (a type of medicinal herb), characterized in that, The fungal strain was inoculated into wounds of fresh green bamboo or *Phyllostachys edulis*, and biomimetic in vivo fermentation was carried out using bamboo wound sap as a culture medium to obtain the fungus and its fermentation transformation product complex, which is the biomimetic *Bamboo Yellow*. The inoculated fungal strain was derived from... Shiraia bambusicola Henn.、 Pestalotiopsis clavata , Apiospora arundinis , Apiospora guiyangensis and Fusarium sporotrichioides composition.

2. The preparation method according to claim 1, characterized in that, The preparation method includes the following steps: S1. Drill holes in the stems of fresh green bamboo or Huasilao bamboo to the size of natural bamboo wasp borers; S2. Intrapore implantation concentration is 10. 2 ~10 10 CFU / mL by Shiraia bambusicola Henn.、 Pestalotiopsis clavata , Apiospora arundinis , Apiospora guiyangensis and Fusarium sporotrichioides The fungus is injected at a volume of 1 mL to 10 mL per incision, and the inoculation is repeated 1 to 5 times. S3. Once the fungal complex has grown, collect and dry it to obtain biomimetic Tianzhuhuang (a type of medicinal herb).

3. The preparation method according to claim 2, characterized in that, During inoculation, a culture medium that promotes bacterial colonization may or may not be added.

4. The preparation method according to claim 2, characterized in that, The Shiraia bambusicola Henn.、 Pestalotiopsis clavata , Apiospora arundinis , Apiospora guiyangensis and Fusarium sporotrichioides The proportion can be any proportion.

5. The biomimetic Tianzhuhuang prepared by any one of the preparation methods described in claims 1 to 4.

6. A biomimetic extract or granulated powder of Bambusa textilis, characterized in that, It is prepared by the following method: S1. The biomimetic bamboo yellow described in claim 5 is crushed into coarse particles; S2. Add 6-9 times the amount of 60%-80% ethanol, heat and reflux for extraction, 2-3.5 hours each time, extract 2-3 times, filter, combine the extracts, recover the ethanol to obtain an alcohol extract; soak the residue in 8-10 times the amount of water for 1-4 hours, heat and extract for 1.5-3 hours each time, extract 2-3 times, filter, concentrate to obtain an aqueous extract, and mix the alcohol and aqueous extracts obtained above to obtain an extract; or add 8-10 times the amount of water, soak for 1-4 hours, heat and extract for 1.5-3 hours each time, extract 2-3 times, filter, concentrate to obtain an extract; S3. The extract obtained in step S2 is dried and pulverized to obtain the biomimetic Tianzhuhuang water extract, or it can be further granulated by dry or wet methods to make formula granules.

7. A biomimetic bamboo yellow ultrafine pulverized cell wall-breaking medicinal slice, obtained by completely drying the biomimetic bamboo yellow described in claim 5, crushing it into coarse particles, and then ultrafine pulverizing it into fine powder of 120-250 mesh.

8. The use of the biomimetic bamboo shavings of claim 5, the biomimetic bamboo shavings extract or formulated granules of claim 6, or the biomimetic bamboo shavings ultrafine pulverized cell wall-breaking granules of claim 7 in the preparation of drugs for treating exogenous febrile convulsions, cough with sputum, acute lung injury, epilepsy, stroke, fatty liver, or hyperlipidemia.

9. A drug, characterized in that, It contains the biomimetic bamboo shavings of claim 5, the biomimetic bamboo shavings extract or formula granules of claim 6, or the biomimetic bamboo shavings ultrafine pulverized cell wall-breaking granules of claim 7.

Images