SNP molecular marker related to pigeon hatching number and application thereof

Abstract

The present application provides a SNP molecular marker related to pigeon hatch number, and the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 3 or SEQ ID NO. 4. The present application also provides the application of the SNP molecular marker related to pigeon hatch number in identifying and breeding pigeon hatch number, a specific primer pair for detecting the SNP molecular marker related to pigeon hatch number, and a method for identifying or breeding pigeon hatch number. Through the molecular marker and the primer, a rapid, efficient and accurate molecular marker assisted breeding technology can be established by using PCR technology and direct sequencing method to carry out early breeding of Shiqi pigeon, reduce the feeding cost, and improve the production efficiency.

Description

Technical Field

[0001] This invention belongs to the field of breeding technology, and specifically relates to SNP molecular markers, particularly SNP molecular markers related to the number of pigeon chicks and their applications. Background Technology

[0002] my country is a major pigeon producer, but the low reproductive performance of domestic pigeons and insufficient supply limit the development of the pigeon industry. The annual number of squabs slaughtered is a crucial indicator of breeding performance. Therefore, targeted efforts to increase the number of chicks in meat pigeon breeding can bring greater economic benefits to producers.

[0003] Traditional methods for determining chick count require counting the number of chicks produced by pigeons throughout the year, which is time-consuming and makes it difficult to promptly cull low-producing pigeons, resulting in significant waste of breeding costs. How to screen pigeons for reproductive performance in the early stages of breeding and eliminate individuals with poor production performance is currently a key focus.

[0004] With the rapid development of modern molecular biology techniques, significant progress has been made in molecular-assisted breeding and genetic marker research in livestock and poultry breeding. Utilizing indirect trait indicators or molecular markers is an effective means to increase the number of chicks hatched in pigeons. However, compared with other livestock and poultry, research on molecular markers for pigeons is relatively weak, and there is currently no research or application of molecular markers related to the annual number of chicks hatched in pigeons. Summary of the Invention

[0005] The purpose of this invention is to overcome at least one of the shortcomings of the prior art and to provide an SNP molecular marker related to the number of pigeon chicks and its application.

[0006] To address the aforementioned technical problems, the first aspect of this invention provides an SNP molecular marker related to the number of pigeon chicks hatched. Its main feature is that the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.3 or SEQ ID NO.4, and its 251st base is T or C.

[0007] To fill the gap in breeding methods for selecting the number of pigeon chicks in production, the inventors conducted extensive research and discovered that the T>C nucleotide mutation at position 14891013 on chromosome 11 of the pigeon genome (reference genome GCA_028654425.1) is related to the number of pigeon chicks, thus completing this invention.

[0008] A second aspect of the invention provides the application of the aforementioned SNP molecular markers related to the number of pigeon chicks in the identification and selection of pigeon chick numbers.

[0009] Preferably, the number of pigeon chicks is identified and selected by detecting SNP molecular markers related to the number of pigeon chicks. The reagent for detecting SNP molecular markers related to the number of pigeon chicks includes a specific primer pair, which consists of an upstream primer of the nucleotide sequence shown in SEQ ID NO. 1 and a downstream primer of the nucleotide sequence shown in SEQ ID NO. 2.

[0010] A third aspect of the present invention provides a specific primer pair for detecting the SNP molecular markers associated with pigeon hatching numbers, characterized in that the specific primer pair is used to detect SNP molecular markers associated with pigeon hatching numbers, and the specific primer pair consists of an upstream primer of the nucleotide sequence shown in SEQ ID NO. 1 and a downstream primer of the nucleotide sequence shown in SEQ ID NO. 2. The specific primer pair is capable of amplifying the molecular markers. This specific primer pair can be included in a kit to identify the pigeon hatching number trait to be tested.

[0011] A fourth aspect of the invention provides the application of the specific primer pair described above in the identification and selection of pigeon hatching numbers.

[0012] The fifth aspect of the present invention provides a method for identifying or selecting the number of chicks hatched in pigeons, characterized by comprising the following steps: (1) Obtain the genomic DNA of the pigeon to be tested; (2) Using the specific primer pair described above to detect the genotype of SNP molecular markers in the genomic DNA, the number of hatching individuals with CC genotype is significantly higher than that of individuals with TC and TT genotypes. Select individuals with CC genotype and eliminate individuals with TC and TT genotypes.

[0013] The beneficial effects of this invention are as follows: (1) The SNP molecular markers related to the number of pigeons hatched can be used to perform molecular marker-assisted selection to effectively increase the number of pigeons hatched; (2) The present invention also provides the sequence of the SNP molecular marker and the primers for identification. With the molecular marker and primers, a rapid, efficient and accurate molecular marker-assisted breeding technology can be established using PCR technology and direct sequencing method to carry out early selection and breeding of Shiqi pigeons, reduce feeding costs and improve production efficiency. Attached Figure Description

[0014] Figure 1 A to Figure 1 C shows the sequencing peak diagrams for the three genotypes.

[0015] Figure 2 The figure shows the results of a significance test between the SNP locus typing results and the number of chicks hatched in Shiqi pigeons. Detailed Implementation

[0016] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below with reference to specific embodiments.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains, and all materials publicly cited herein and referenced by them are incorporated herein by reference.

[0018] Those skilled in the art will recognize, or can learn through routine experimentation, many equivalents of the specific embodiments of the invention described herein. These equivalents will be included in the claims.

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0020] In the following examples, the number of chicks hatched by each 2-year-old Shiqi pigeon in one year was counted. The experiment was conducted at the Yizheng Experimental Base of Jiangsu Provincial Institute of Poultry Science, and all pigeons maintained the same environmental and nutritional conditions throughout the entire rearing period.

[0021] Example 1: Genome-wide association analysis (1) Wing vein blood was collected from 280 two-year-old female Shiqi pigeons, and genomic DNA was extracted using the standard phenol-chloroform method. DNA quality testing and concentration determination were performed according to standard procedures, and the final selection was based on an OD260 / 280 ratio between 1.8 and 2.0 for subsequent experiments.

[0022] (2) The qualified genomic DNA was randomly fragmented using enzymes. After end repair, poly A tailing, and the addition of DNBseq-specific adapters, the DNA fragments were amplified and enriched by PCR to construct a DNA library. The double-stranded target region library was denatured, circularized, and digested to obtain single-stranded circular DNA. The single-stranded circular DNA was amplified using rolling circle amplification technology to obtain DNA nanospheres. After library construction, quantification and quality control were performed using Qubit. Once the library quality was qualified, it was sequenced.

[0023] (3) Filter the raw data to remove reads with adapters; remove paired reads when the N content in a sequencing read exceeds 1% of the total number of bases in that read; remove paired reads when the number of low-quality (Q<=5) bases in a sequencing read exceeds 50% of the total number of bases in that read. Use BWA 0.7.12 alignment software with the mem algorithm to align the filtered reads to the pigeon reference genome (GCA_028654425.1_ASM2865442v1_genomic). Use GATK 3.4-46 software to perform population SNP detection, and use ANNOVAR to perform functional annotation on the detected variant sites.

[0024] (4) The GWAS mixed linear model was calculated using GEMMA software. Loci with P-values ​​less than a given threshold (1 / number of SNPs) were selected as significant loci. GWAS analysis revealed that the SNP molecular marker most significantly correlated with the number of pigeon chicks was T14891013C located on chromosome 11, with P = 9.08 × 10⁻⁶. -8 .

[0025] Example 2: Establishment of a method for allele detection of hatchling number (1) For the SNP sites screened in Example 1, primers were designed to amplify a 468 bp nucleotide fragment on the genome. The upstream and downstream primers for sequence amplification were: Upstream primer CCS-F: 5' – GCTGTAGTGCTACGCTCTGAA - 3' (SEQ ID NO. 1) Downstream primer CCS-R: 5' – GACCACAGGAGCCTTGTAG - 3' (SEQ ID NO. 2) (2) PCR amplification: In this embodiment, the reagents were obtained from Nanjing Novizan Biotech Co., Ltd., and the primer synthesis and sequencing were completed by Shanghai Sangon Biotech Co., Ltd.

[0026] Using the obtained pigeon genomic DNA as a template, PCR amplification was performed using primers CCS-F and CCS-R.

[0027] The amplification system is as follows: (3) Sequencing and identification The PCR amplification product CCS SEQ obtained in (2) was purified and subjected to Sanger sequencing to obtain the corresponding SNP marker site mutations. Genotyping was performed based on the sequencing results, as shown in the figure. Figure 1 A to Figure 1 As shown in C.

[0028] The base sequence of CCS SEQ is shown as follows (SEQ ID NO.3 or SEQ ID NO.4): GCTGTAGTGCTACGCTCTGAAATTCCAGGAAGGGGGGAAAAGACACAGGAGACTTAATTGCCTGAAGAGACTTGCTTTTCTTCAGCCAACAAAAAATCTGATCAGATGCTGTGAATAGTCTCTCTCTGTGCCATGGACATGGGTGACTGATTCTGTGCTCATGTGACAATCGAAGTCTTGCAGTAACATCAGCACAATACCAGGGTAGCCTAACAGATCCCAAGCTTTCTTCTTTAAAGTTAGCATTTTA X[T] AAGCCAGGGATATTTTTCTGGTGGCATGGAAATGTCCTAGACAAAAAGGTTTTACTGAGGATTTTAACTAAAGTTTTATTCAAAATCCCCCTCCCTACTCATATGCCAAAATCATATGCTTAAAATCCAATTATTTCTACTTGTTTCTGAAGTTTTACTATTTTAAATGGTCCAATGTGAAGGGATATTTATGCAAATCTACAAGGCTCCTGTGGTC (SEQ ID NO.3); GCTGTAGTGCTACGCTCTGAAATTCCAGGAAGGGGGGAAAAGACACAGGAGACTTAATTGCCTGAAGAGACTTGCTTTTCTTCAGCCAACAAAAAATCTGATCAGATGCTGTGAATAGTCTCTCTCTGTGCCATGGACATGGGTGACTGATTCTGTGCTCATGTGACAATCGAAGTCTTGCAGTAACATCAGCACAATACCAGGGTAGCCTAACAGATCCCAAGCTTTCTTCTTTAAAGTTAGCATTTTA X[C]AAGCCAGGGATATTTTTCTGGTGGCATGGAAATGTCCTAGACAAAAAGGTTTTACTGAGGATTTTAACTAAAGTTTTATTCAAAATCCCCCTCCCTACTCATATGCCAAAATCATATGCTTAAAATCCAATTATTTCTACTTGTTTCTGAAGTTTTACTATTTTAAATGGTCCAATGTGAAGGGATATTTATGCAAATCTACAAGGCTCCTGTGGTC (SEQ ID NO. 4).

[0029] Note: X marks in the sequence indicate mutation sites, shown in bold and underlined (the mutated bases in parentheses represent allele mutations), and the bolded portions at the beginning and end of the sequence are primer sequences.

[0030] Example 3: Effect analysis of the molecular marker SNP T14891013C mutation This invention provides a SNP molecular marker to increase the number of chicks hatched in pigeons. 280 two-year-old female Shiqi pigeons collected in Example 1 were classified according to different genotypes. The number of chicks hatched per individual per year was counted. Excel was used to organize and analyze the annual number of chicks hatched by different genotypes of Shiqi pigeons. One-way ANOVA analysis was performed using SPSS software, and multiple comparisons were conducted using the LSD method. The association between the SNP T14891013C mutation site and the annual number of chicks hatched in pigeons was analyzed. The number of chicks hatched by individuals with the CC genotype was significantly higher than that of individuals with the TT and TC genotypes. P <0.05), there was no significant difference in the number of chicks between individuals with the TC and CC genotypes ( P ≥0.05), specific data are shown in Table 1. Therefore, during the breeding process, individuals with the CC genotype are selected, while individuals with the TT and TC genotypes are eliminated, such as... Figure 2 As shown.

[0031] In this specification, the invention has been described with reference to specific embodiments thereof. However, it will be apparent that various modifications and variations can be made without departing from the spirit and scope of the invention. Therefore, the specification and drawings should be considered illustrative rather than restrictive.

Claims

1. A reagent for detecting SNP molecular markers associated with the number of pigeon chicks, used in identifying the number of chicks hatched in Shiqi pigeons and selecting Shiqi pigeons with high chick counts, characterized in that... The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, with the 251st base being T or C, wherein the number of offspring of individuals with the CC genotype is higher than that of individuals with the TC and TT genotypes.

2. The application according to claim 1, characterized in that, The reagent for detecting SNP molecular markers associated with pigeon hatching numbers includes a specific primer pair consisting of an upstream primer of the nucleotide sequence shown in SEQ ID NO. 1 and a downstream primer of the nucleotide sequence shown in SEQ ID NO.

2.

3. A method for breeding Shiqi pigeons with a high number of chicks, characterized in that, Includes the following steps: (1) Obtain the genomic DNA of the Shiqi pigeon to be tested; (2) Using the specific primer pair in claim 2, detect the genotype of the SNP molecular marker in the genomic DNA as described in claim 1, select individuals with the CC genotype, and eliminate individuals with the TC and TT genotypes.

4. A method for determining the number of chicks hatched in Shiqi pigeons, characterized in that, Includes the following steps: (1) Obtain the genomic DNA of the Shiqi pigeon to be tested; (2) Using the specific primer pair in claim 2, detect the genotype of the SNP molecular marker in the genomic DNA as described in claim 1, identify individuals with the CC genotype as individuals with a high number of chicks hatched from Shiqi pigeons, and identify individuals with the TC and TT genotypes as individuals with a low number of chicks hatched from Shiqi pigeons.

Images