A SNP molecular marker related to milk protein rate in dairy cows, a detection product and its application

Abstract

The present invention discloses a SNP molecular marker related to the milk protein rate of dairy cows, a detection product and an application, which belong to the field of molecular biology and genetic breeding technology. The SNP molecular marker related to the milk protein rate of dairy cows is located at chr3:15545177 in the dairy cow genome, the polymorphism is A or G, and the coordinate position is based on the reference genome ARS-UCD2.0. When the polymorphism is A, the milk protein rate of the milk produced by the dairy cow is higher. The above-mentioned SNP molecular marker provided by the present invention can be used to identify and screen dairy cow individuals with high milk protein rates, as well as to assist breeding, which is conducive to increasing the frequency of high-yield advantage individuals containing the molecular marker in the dairy cow population, thereby increasing the milk protein rate of the population and increasing economic benefits.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology and genetic breeding technology, and in particular to a SNP molecular marker associated with milk protein rate in dairy cows, a detection product and an application thereof. Background Art

[0002] In the dairy cattle farming industry, milk protein content—the percentage of milk protein in milk—is a core production trait for dairy cows. Its level directly impacts the economic benefits of the ranch, making improving milk protein content a key target for genetic improvement. The regulatory mechanism of this trait involves the interaction of multiple factors, including genetic basis, nutritional management, disease prevention and control, environmental adaptation, and parity effects, resulting in a complex quantitative genetic profile. In the current context of industrial upgrading, traditional breeding methods face technical bottlenecks in preserving genetic diversity, precisely improving traits, and enhancing production efficiency. There is an urgent need to develop innovative breeding systems that integrate modern biotechnologies such as genomics and bioinformatics.

[0003] Traditional dairy cow breeding techniques, based on pedigree analysis and phenotypic screening, have achieved practical success, but their technical bottlenecks remain significant. Specifically, due to the long generation intervals between cattle and the ample room for improvement in milk protein traits, traditional methods require multiple generations of breeding to demonstrate genetic gains. Of particular concern is that milk protein content, a complex trait regulated by multiple genes, still has significant shortcomings in its genetic analysis. In particular, a systematic molecular marker system for key functional genes has not yet been established, and breakthroughs in related basic research are urgently needed.

[0004] Genome-wide association studies (GWAS) have become an important method for studying the relationship between genetic variation and complex traits. By performing association analysis on large-scale genome-wide typing and phenotypic data, GWAS can identify genes and mutations associated with specific phenotypic traits. The introduction of GWAS has greatly advanced our understanding of the genetic basis of complex traits. Mixed linear models are a common approach for conducting GWAS. These models combine fixed and random effects to control for the influence of potential population structure and kinship on the data. In GWAS, mixed linear models provide more accurate association analysis results by accounting for genetic correlations between and within individuals. Mixed linear models can help account for genetic heterogeneity and correlations between samples, thereby reducing false positives and improving study reliability. Furthermore, they can model the contribution of genetic variation and assess the influence of each locus on phenotypic traits.

[0005] In general, the use of GWAS technology to explore molecular markers related to milk protein rate is of great significance for breeding high-yield dairy cow breeds and improving the production efficiency of animal husbandry. Summary of the Invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to milk protein rate in dairy cows, a detection product, and an application, which can effectively identify dairy cows with high milk protein rate and then be used for herd optimization and assisted breeding.

[0007] The technical solution of the present invention is described in detail as follows:

[0008] In a first aspect, the present invention provides a SNP molecular marker associated with milk protein rate in dairy cows. The SNP molecular marker is located at chr3:15545177 in the dairy cow genome, the polymorphism is A or G, and the coordinate position is based on the reference genome ARS-UCD2.0.

[0009] The SNP molecular marker is the 85th nucleotide of SEQ ID NO: 1 in the sequence list, and the polymorphism is A or G.

[0010] In a second aspect, the present invention provides the use of the above-mentioned SNP molecular marker in identifying dairy cows with high milk protein rate. When the polymorphism of the SNP molecular marker is A, the milk produced by the dairy cow has the trait of high milk protein rate.

[0011] Optionally or preferably, in the above application, the method for identifying a dairy cow with a high milk protein rate comprises the following steps:

[0012] (1) Extracting genomic DNA from the cow to be identified;

[0013] (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NOs: 2-3 as primers, PCR amplification was performed to obtain an amplified product containing a SNP molecular marker. The amplified product was 363 bp, and the 85th position was a SNP molecular marker;

[0014] (3) The amplified products were sequenced, and the SNP molecular marker genotype combinations from high to low milk protein rates were AA, AG, and GG.

[0015] In a third aspect, the present invention provides an application of the above-mentioned molecular marker in assisted breeding of dairy cows. When the polymorphism of the SNP molecular marker is A, the milk produced by the dairy cow has a high milk protein rate trait.

[0016] In a fourth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, wherein the product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0017] In a fifth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular markers, which is a detection kit. The detection kit includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0018] In a sixth aspect, the present invention provides the use of the above-mentioned product for detecting SNP molecular markers in identifying dairy cows with high milk protein rates. When the polymorphism of the SNP molecular marker is A, the milk produced by the dairy cow has the trait of high milk protein rate.

[0019] In a seventh aspect, the present invention provides the use of the above-mentioned product for detecting SNP molecular markers in assisted breeding of dairy cows. When the polymorphism of the SNP molecular marker is A, the milk produced by the dairy cow has a high milk protein rate trait.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention uses GWAS technology to identify a single-nucleotide polymorphism (SNP) molecular marker associated with milk protein content in dairy cows, specifically chr3:15545177 (A>G) (reference genome ARS-UCD2.0). The polymorphism of this molecular marker is either A or G. When the polymorphism is A, the milk produced by the cow has a higher milk protein content. Based on this, the SNP molecular marker provided by the present invention can be used to identify and screen individual dairy cows with high milk protein content, retain the dominant genotype, and increase the frequency of the high-yield, dominant SNP containing this molecular marker in the dairy cow population, thereby improving the milk protein content of the population and increasing economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the sequencing peak diagram of the chr3:15545177 (A>G) site polymorphism. DETAILED DESCRIPTION

[0023] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0024] Example 1

[0025] 1. Gene collection and SNP identification

[0026] (1) Blood or hair follicle samples were collected from 1,860 Holstein cows in six large-scale farms.

[0027] Holstein cattle samples were collected from six ranches across the country. The location of the ranches and the number of samples collected from each ranch are shown in Table 1 .

[0028] Table 1 Location of the ranches where samples were collected and the number of samples collected

[0029]

[0030] (2) The genotypes of the collected samples were determined using the Illumina BovineSNP50 chip. Genotyping was performed by Newgene Biotech (Shanghai) Co., Ltd., and a total of 47,843 SNP marker loci were genotyped.

[0031] (3) The genomic estimated breeding value of milk protein content for each individual is estimated based on the genotype. The genomic estimated breeding value is provided by the United States Dairy Cattle Genetics and Breeding Committee (CDCB).

[0032] Genomic Estimated Breeding Value (GEBV) is a genetic potential prediction indicator calculated by the United States Dairy Cattle Genetics and Breeding Committee (CDCB) by integrating genomic data, production performance records and multidimensional genetic evaluation models.

[0033] (4) A genome-wide association analysis of the genomic breeding value for milk protein content was performed using GEMMA software based on genotype data. A mixed linear model was used as the analysis model, with pasture and cow age as covariates. The FDR method was used to correct for multiple testing. The association analysis results showed that the most significant SNP site (chr3:g15545177 (A>G)) was significant, with a P value of 0.01 after FDR correction.

[0034] 2. Identification of dominant alleles

[0035] Among the 1,860 Holstein cattle collected, the present invention compared the genomic estimated breeding values ​​of milk protein rate of different genotypes of the SNP site chr3:g15545177A>G. The results are shown in Table 2.

[0036] Table 2 Genomic estimated breeding values ​​of milk protein content in dairy cows with different genotypes of chr3:g15545177A>G

[0037]

[0038] For chr3:g15545177A>G, the genomic estimated breeding values ​​for milk protein percentage are A / A: 0.012, A / G: 0.018, and G / G: 0.026, respectively. Because a larger genomic estimated breeding value for milk protein percentage indicates a higher milk protein percentage, the dominant allele at the chr3:g15545177A>G locus is G.

[0039] 3. Sequence amplification

[0040] (1) Blood collection from the cattle tail vein

[0041] Holstein cattle were selected as experimental materials, and blood was collected from the tail vein of the cattle.

[0042] (2) Genomic DNA extraction

[0043] Take 500 μL of whole blood and add 500 μL of STE lysis buffer, followed by 50 μL of 10% SDS and 5 μL of proteinase K (20 mg / ml). Lyse at 56°C for approximately 3 hours until the lysate is clear. Add the same volume of saturated phenol (250 μL) and chloroform / isoamyl alcohol (24:1) (250 μL). Gently shake for 20 minutes and centrifuge at 12,000 rpm for 10 minutes. Remove the supernatant and repeat the above steps until no protein layer remains between the aqueous and organic phases. Remove the supernatant and add the same volume of chloroform / isoamyl alcohol. Gently shake for 20 minutes and centrifuge at 12,000 rpm for 10 minutes. Remove the supernatant and add 1 / 10 volume of 3M NaAc (pH 5.2) and 2 volumes of cold anhydrous ethanol. Shake well, let stand at -20°C for 20 minutes, and centrifuge at 12,500 rpm for 20 minutes. Precipitate the nucleic acids at the bottom of the tube. Discard the supernatant and wash the pellet with 70% ethanol. Collect the pellet and air-dry until all the ethanol has evaporated. Dissolve the DNA in 20 μL of TE (containing RNase A). Incubate at 37°C for approximately 30 minutes and then store at 4°C. Analyze the DNA sample by 1% agarose gel electrophoresis and determine its concentration and purity using a UV spectrophotometer.

[0044] (3) Primer design

[0045] According to the gene sequence where the SNP site is located, a pair of specific primers are designed.

[0046] Forward primer F is: 5'-CTGGTGCTGCAAAATCGCTC-3' (SEQ ID NO: 2),

[0047] The reverse primer R is: 5'-ACGAGGCATGGAGCTTGTAA-3' (SEQ ID NO: 3).

[0048] (4) Polymerase chain reaction

[0049] PCR amplification was performed using the above primers. The reaction system was as follows: 10× Buffer 1 μL, 2.5 mM dNTP 0.8 μL, 2.5 mM MgCl2 0.6 μL, forward primer F (10 μM) 0.1 μL, reverse primer R (10 μM) 0.5 μL, Taq enzyme (5 U / μL) 0.1 μL, template DNA 0.5 μL, LC Green saturated fluorescent dye 0.7 μL, and H2O was added to make up to 10 μL.

[0050] Amplification reactions were performed on an Applied Biosystems PCR system using the following reaction conditions: 95°C for 5 min, 35 cycles of 95°C for 30 s, 59°C for 30 s, and 72°C for 1 min, and 72°C for 5 min. The genotypes of the PCR products were determined by Sanger sequencing.

[0051] The amplified product is 363 bp, and the specific nucleotide sequence is as follows:

[0052] CTGGTGCTGCAAAATCGCTCCGTGAGCAGGAACTATCGTTACTATGAGCCAATAGTTCTGAGGGCCAGGGGGCCAACCCGGGA A CAACAGAAGCCCAGCCCTCCTGCCTTCCCTCCTCACCCGGTGAGTGTGACGCTGTCCCAGGGAGGGCTCCGGTAGAGCCTGAGGGAGCACAGATGTAGGCCAGCTCAGGGCACAAGTGTGGCGTGGCAGGAGGAGGTCTTGGATCCGGGAGACAACTGGGGGACCCTGAAGGTCCCTGGGCCCCAGCTCCACAGAGTAGCTTCTCTCTGGGGACAGGATCACTAAGCCCCTAAGCAAAGATGCAGGAAGTCAGAAAGCTTACAAGCTCCATGCCTCGT (SEQ ID NO: 1), wherein the polymorphism at position 85 (underlined) is A or G. See the sequencing peak diagram of the polymorphism at chr3:15545177 (A>G) for details. Figure 1 .

[0053] By selecting individuals from the core group of dairy cows and using the above-mentioned molecular biology-related technologies to detect the genotype of the chr3:g15545177A>G site, and selecting favorable individuals for breeding, the milk protein rate trait of the dairy cow group can be improved, breeding efficiency can be improved, breeding costs can be reduced, breeding income can be increased, and the foundation for breeding new excellent dairy cow breeds with high milk protein rates can be laid.

[0054] Example 2

[0055] To verify the relationship between the chr3:g15545177A>G site and the milk protein rate of Holstein cows, the genotype of the chr3:g15545177A>G site in 174 Holstein cows from a Holstein herd was identified by Sanger sequencing (using the primer pair of Example 1), and the milk protein rates of individuals with different genotypes were compared. The results are shown in Table 3.

[0056] Table 3 Average milk protein rates of individuals with different genotypes at the chr3:g15545177A>G locus in the validation population

[0057]

[0058] Note: The average milk protein rate is calculated as follows: each cow begins to lactate after the first calving. From the first month after calving to the tenth month after calving, milk samples are collected once a month and the milk protein rate is measured using a milk component analyzer. A total of 10 milk protein rate measurements are obtained for each cow, and the average value is taken as the milk protein rate value of the cow; the milk protein rate values ​​of 58 cows of the same genotype are then averaged to obtain the average milk protein rate of individuals with that genotype.

[0059] The test results showed that three genotypes were present in the Holstein cow population tested. Among all the groups tested, the average daily milk protein rate of cows with the GG genotype was 3.47%, the average daily milk protein rate of cows with the G / A genotype was 3.36%, and the average daily milk protein rate of cows with the A / A genotype was 3.27%. This result is consistent with the conclusion in Example 1, with individuals with the GG genotype having the highest milk protein rate, followed by individuals with the GA genotype, and individuals with the AA genotype having the lowest milk protein rate.

[0060] One-way ANOVA revealed that there were significant differences in the mean milk protein rates among different genotypes, with a significant P value of 2.43E-06 (Table 4).

[0061] Table 4 Results of one-way ANOVA of milk protein rates of individuals with different genotypes at the chr3:g15545177A>G locus in the validation population

[0062]

[0063] A one-way ANOVA was performed on the average milk protein rates of individuals with three genotypes at the chr3:g15545177A>G site in the validation population in Table 3. It was found that there were statistically significant differences in the means among different groups, indicating that the polymorphism of the chr3:g15545177A>G site was significantly correlated with the average milk protein rate trait.

[0064] The present invention identifies a SNP site associated with the milk protein rate of dairy cows, detects the genotype of individual dairy cows at this site through molecular biology-related techniques, and selects individuals with favorable genotypes for breeding through association analysis with the estimated breeding value of the milk protein rate trait of dairy cows. This can increase the frequency of the dominant milk protein rate allele in the dairy cow population, reduce pasture feeding costs, and improve breeding efficiency, providing a new method for the genetic improvement of the milk protein rate trait of dairy cows.

[0065] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.

Claims

1. The use of primers for detecting SNPs associated with milk protein rate in dairy cows in assisting the identification of high milk protein rate dairy cows, characterized in that: The SNP is located at chr3:15545177 in the cow genome, and the coordinate position is based on the reference genome ARS-UCD2.

0. The cows are Holstein cows, and the milk protein rate of individuals with GG genotype is the highest, followed by individuals with GA genotype, and the milk protein rate of individuals with AA genotype is the lowest.

2. The use according to claim 1, characterized in that The method for assisting in identifying high milk protein rate dairy cows comprises the following steps: (1) Extracting genomic DNA from the cow to be identified; (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NOs: 2-3 as primers, PCR amplification was performed to obtain a 363 bp amplified product; (3) The amplified products were sequenced. The milk protein rate of individuals with GG genotype was the highest, followed by individuals with GA genotype, and the milk protein rate of individuals with AA genotype was the lowest.

3. Application of primers for detecting SNPs related to milk protein rate in dairy cow assisted breeding, characterized in that: The SNP is located at chr3:15545177 in the dairy cow genome, and the coordinate position is based on the reference genome ARS-UCD2.0; the dairy cows are Holstein cows, and the milk protein rate of individuals with the GG genotype is the highest, followed by individuals with the GA genotype, and the milk protein rate of individuals with the AA genotype is the lowest; the milk produced by the breeding cows has a high milk protein rate trait.

4. The use of a primer pair for detecting SNPs associated with milk protein rate in dairy cows in the preparation of a primer for assisting in the identification of high milk protein rate dairy cow products, characterized in that: The nucleotide sequence of the primer pair is shown in SEQ ID NO: 2~3; the SNP is located at chr3: 15545177 in the dairy cow genome, and the coordinate position is based on the reference genome ARS-UCD2.0; the dairy cows are Holstein cows, and the milk protein rate of individuals with the GG genotype is the highest, followed by individuals with the GA genotype, and the milk protein rate of individuals with the AA genotype is the lowest.

5. Use of a detection kit for detecting SNPs associated with milk protein rate in dairy cows in the preparation of dairy cow assisted breeding products, characterized in that: The detection kit includes a primer pair, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2~3; the SNP is located at chr3: 15545177 in the dairy cow genome, and the coordinate position is based on the reference genome ARS-UCD2.0; the dairy cows are Holstein cows, the GG genotype individuals have the highest milk protein rate, the GA genotype individuals have the second highest milk protein rate, and the AA genotype individuals have the lowest milk protein rate; the milk produced by the breeding dairy cows has a high milk protein rate trait.

Images