Plant saline-alkaline tolerant gene and application thereof

Abstract

Relates to a plant saline-alkaline tolerance related gene AT1 and a homologous gene thereof, and applications thereof in cultivation of saline-alkaline tolerant plants. The invention further relates to a method for cultivating the saline-alkaline resistant plant, the obtained saline-alkaline resistant plant and a plant material thereof. When coding in a plant comprises at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity with SEQ ID NO: 15, or to less than about 60% similarity, preferably at least about 70%, about 80%, or about 85% similarity, or to less than about 70% similarity, preferably at least about 70%, about 80%, or about 85% similarity with SEQ ID NO: 15. More preferably, when the expression level of all alleles of a protein of at least about 90% or about 95% similar amino acid sequence is reduced or not expressed, the saline-alkaline resistance of the plant is improved; when coding in a plant comprises at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity with SEQ ID NO: 15, or to less than about 60% similarity, preferably at least about 70%, about 80%, or about 85% similarity, or to less than about 70% similarity, preferably at least about 70%, about 80%, or about 85% similarity with SEQ ID NO: 15. More preferably, when the expression level of the gene of the protein of the amino acid sequence similar to at least about 90% or about 95% is increased, the salt and alkali sensitivity of the plant is improved.

Description

Plant salt-alkali tolerance gene and its use

[0001] Priority information

[0002] This application claims priority to Chinese patent application No. 202210968618.1 filed on August 12, 2022 and Chinese patent application No. 202211198322.2 filed on September 29, 2022, and the entire contents of the two prior applications are incorporated herein by reference. Technical Field

[0003] The present invention relates to a plant salt-alkali tolerance related gene AT1 and its homologous genes and their use in cultivating salt-alkali tolerance plants. The present invention also relates to a method for cultivating salt-alkali tolerance plants, the obtained salt-alkali tolerance plants and plant materials thereof. Background Art

[0004] Food security is impacted by the potential negative impacts of global population growth and climate change on agricultural production. Drought, rising groundwater levels, and low-lying terrain with no drainage outlets are all contributing factors to land salinization. Furthermore, the extensive use of chemical fertilizers could cause 50% of fertile farmland to become saline-alkali land in the near future, posing a serious threat to food production (A. Kumar, S. Singh, A. K. Gaurav, S. Srivastava, J. P. Verma, Plant growth-promoting bacteria: Biological tools for the mitigation of salinity stress in plants. Front. Microbiol. 11, 1216 (2020). doi: 10.3389 / fmicb.2020.01216). Soil salinization and secondary salinization are global ecological and resource problems and are one of the important abiotic stress factors causing crop yield reduction (Yamaguchi, T. and Blumwald, E. Developing salt-tolerant crop plants: challenges and opportunities. (2005). Trends in Plant Science 10: 615-620).

[0005] According to a 2015 survey by the Food and Agriculture Organization of the United Nations (FAO), approximately 20% of the world's arable land and 50% of its irrigated land are affected by varying degrees of salinization. This affects over 1 billion hectares of land, with approximately 60% of the estimated area classified as alkaline (i.e., land with a high pH due to a high alkaline content, primarily NaHCO₃ and Na₂CO₃). Approximately 25-33% of irrigated land worldwide is affected by secondary salinity (B.P. Singh, A.L. Cowie, K.Y., and Chan, Soil health and climate change. New York: Springer-Verlag Berlin Heidelberg 29, (2011). doi:10.1007 / 978-3-642-20256-8). Since it's difficult for ordinary crops to survive on saline-alkali land, saline-alkali land is difficult to cultivate unless it undergoes complex and tedious desalination treatments.

[0006] Salinized soil generally refers to a type of soil affected by salt and alkali, including saline soil and alkaline soil. Saline soil refers to soil with a soluble salt content exceeding 2‰, while alkaline soil refers to soil with an exchangeable sodium ion to soluble cation ratio (ESP) greater than 20% and a pH greater than 8.0 (Yang Jinsong (2008). Development and Prospects of Saline Soil Research in China. Acta Pedologica Sinica 45:837-845). In areas with saline-alkali land, crops suffer varying degrees of saline-alkali stress throughout their growth period. This is particularly true in spring, when the ground surface experiences a "return of salt." This is due to intense surface water evaporation, which causes salt in groundwater to accumulate in the soil surface as capillary water rises. Spring is the time for crop sowing, and saline-alkali stress is extremely damaging to crops during their germination period. To address the issue of converting saline-alkali land into fertile farmland, various technologies have been applied to improve soil salinization, such as chemical and physical methods to reduce the degree of salinization, or agricultural practices to improve saline-alkali land. While both methods can improve soil physical and chemical properties and texture, they are time-consuming and costly. Therefore, effectively utilizing saline-alkali land can only be fundamentally addressed by understanding the molecular mechanisms of plant responses to saline-alkali stress and cultivating salt-tolerant varieties through molecular biology (Glenn, EP, Brown, JJ, and Blumwald E. (1999). Salt tolerance and crop potential of halophytes. Critical Reviews in Plant Sciences 18:227-255; Qian, Qi, Xiaoquan, Lin, Rongcheng, Yang, Shuhua, Dong, Aiwu, Zuo, Jianru, Chen, Fan, Xiao, Langtao, Gu, Hongya, Chen, Zhiduan, Bai, Yongfei, and Wang, Tai. (2019). Important Research Progress in Several Fields of Chinese Plant Sciences in 2018. Acta Botanica Sinica 54:405-440).

[0007] In addition, by analyzing the papers published in the Web of Science (http: / / www.webofscience.com / ) in the past 20 years, there are as many as 22,614 papers related to salt tolerance, while there are only 457 papers related to alkalinity tolerance. Due to people's lack of understanding of alkaline stress, the cultivation of alkaline-tolerant / salt-alkali-tolerant crops and the development of saline-alkali crop yield-increasing technologies are restricted. In fact, plant salt tolerance and alkali tolerance are two different traits. According to FAO statistics in 2015, 60% of the more than 1 million hectares of saline-alkali land surveyed can actually be defined as land alkalinization caused by Na2CO3 or NaHCO3. Unlike neutral salinity (pH of about 7) which only has ion toxicity, alkaline saline soil has a high pH value, which reduces the plant's absorption rate of essential nutrients and the absorption of sodium ions (Na +Compared with salinity alone, alkaline saline soil has a more negative impact on plant growth by inducing high cellular oxidative stress (M. Javid, R. Ford, M. E. Nicolas, Tolerance responses of Brassica juncea to salinity, alkalinity and alkaline salinity. Funct. Plant Biol. 39, 699-707 (2012). doi: 10.1071 / FP12109).

[0008] Therefore, soil salinization may become a global problem affecting plant growth and crop production. Utilizing these saline-alkali lands for crop production will help meet future food needs. Therefore, studying the mechanisms of crop alkali / salt-alkali tolerance will aid in the management of alkaline / salt-alkali lands. Breeding new alkali / salt-alkali-tolerant crop varieties can also expand arable land and is an effective measure to increase overall crop yields. Researching the mechanisms of crop salt-alkali tolerance and breeding more salt-alkali-tolerant crops may be priorities for future agriculture.

[0009] Summary of the Invention

[0010] The purpose of the present invention is to study the mechanism of plant alkali / salt-alkali tolerance at the genetic level, develop methods for cultivating salt-alkali tolerant plants, and cultivate plants with higher salt-alkali tolerance.

[0011] In their research, the inventors have identified and demonstrated that natural alleles of AT1, an atypical G protein gamma subunit (Gγ subunit), contribute to alkaline tolerance in five different monocotyledonous crops: sorghum, millet, rice, maize, and wheat. The N-terminal domain of AT1 and its homologs plays a negative regulatory role in alkaline stress tolerance. Crops containing C-terminally truncated AT1 proteins are highly sensitive to alkaline stress. This may be due to the inhibitory effect of the C-terminal domain, which is essential for protein degradation in its rice homolog (S.Sun, L.Wang, H.Mao, L.Shao, X.Li, J.Xiao et al.,A G-protein pathway determines grain size in 45rice.Nat.Commun.9,851(2018).doi:10.1038 / s41467-018-03141-y,W.Yang,K.Wu,B.Wang,H.Liu,S.Guo,X.Guo et al.,The RING E3 ligase CLG1 targets GS3 for degradation via the endosome pathway to determine grain size in rice.Mol.Plant 14,1699-1713(2021).doi:10.1016 / j.molp.2021.06.027). Thus, overexpression of the entire AT1 protein results in higher levels of the protein, leading to increased sensitivity to alkaline stress, while overexpression of a C-terminally truncated protein leads to even higher sensitivity to alkaline stress. In contrast, high tolerance to alkalinity / salinity was observed in all five crops due to knockout of the gene / natural variation with a non-functional allele, resulting in the absence of the N-terminal GGL domain. Based on this finding, the inventors completed the present invention.

[0012] In a first aspect, the present invention provides use of AT1 or a homologous gene thereof in regulating the salt-alkali tolerance of a plant or cultivating a plant with salt-alkali tolerance or salt-alkali sensitivity.

[0013] In some embodiments, the AT1 or a homolog thereof comprises a GGL domain or a GGL-like domain comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15.

[0014] In some embodiments, the GGL domain or GGL-like domain comprises the amino acid sequence of any one of SEQ ID NOs: 15 and 86-96.

[0015] In some embodiments, increasing the expression level (eg, overexpressing) of AT1 or a homologous gene thereof in a plant, or expressing or overexpressing a C-terminally truncated protein encoded by a variant of AT1 or a homologous gene thereof, can increase the salt-alkali sensitivity of the plant.

[0016] In some embodiments, reducing the expression level of all alleles of AT1 or its homologous genes in a plant (for example, by gene editing, targeted mutagenesis, chemical induction, radiation induction, natural mutation, RNAi, or adding substances that inhibit the expression of the target gene) or preventing the expression of all alleles can improve the salt-alkali tolerance of the plant.

[0017] The salt-alkali tolerant plants of the present invention grow better than wild plants under saline-alkali conditions, wherein the saline-alkali conditions include pH>7.5, Na + Growth conditions with concentrations > 75 mM or pH > 8.0, Na + Growth conditions with concentrations >50 mM.

[0018] In some embodiments, knocking out the N-terminal GGL domain or GGL-like domain of all alleles of AT1 or its homologous genes, or knocking out the first N-terminal exon in plants can improve the salt-alkali tolerance of plants.

[0019] In some embodiments, the N-terminal GGL domain or GGL-like domain of AT1 or a homolog thereof is conserved.

[0020] In some embodiments, the present invention provides a nucleic acid molecule encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity to SEQ ID NO: 15, or having at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity, which is used to regulate the salt-alkali tolerance of plants, or to cultivate plants with salt-alkali tolerance or salt-alkali sensitivity.

[0021] In some embodiments, the nucleic acid molecule encodes a protein comprising the amino acid sequence of any one of SEQ ID NOs: 15 and 86-96.

[0022] In some embodiments, the nucleic acid molecule encodes an amino acid sequence selected from the group consisting of:

[0023] (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions;

[0024] (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function;

[0025] (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function;

[0026] (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function;

[0027] (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or

[0028] (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function.

[0029] The present invention also provides a mutant protein, which is encoded by a variant nucleic acid molecule after a frameshift mutation occurs in a nucleic acid molecule encoding the following amino acid sequence:

[0030] (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions;

[0031] (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function;

[0032] (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function;

[0033] (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function;

[0034] (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or

[0035] (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function;

[0036] Compared with the protein encoded by the nucleic acid molecule before the frameshift mutation, the activity of the mutant protein is reduced or no activity.

[0037] In some embodiments, the frameshift mutation comprises an insertion or deletion of one or more (not 3 or a multiple of 3) nucleotides. The frameshift mutation may occur at any position in the target coding sequence.

[0038] The present invention also provides a nucleic acid molecule encoding the mutant protein.

[0039] In some embodiments, the present invention provides an expression cassette comprising a nucleic acid molecule of the present invention.

[0040] In some embodiments, the present invention provides a recombinant vector comprising the nucleic acid molecule or expression cassette of the present invention.

[0041] In some embodiments, the present invention provides a cell comprising the nucleic acid molecule, expression cassette or recombinant vector of the present invention.

[0042] In some embodiments, the cell is selected from a prokaryotic cell, such as a bacterial cell or a fungal cell, such as, but not limited to, an Escherichia coli cell, a yeast cell, or an Agrobacterium cell; or a eukaryotic cell, such as a plant cell.

[0043] In a second aspect, the present invention provides a method for cultivating salt-alkali tolerant plants, the method comprising:

[0044] reducing the expression level of or eliminating the expression of all alleles in a plant that encode a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or to at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15,

[0045] wherein the salt-alkali tolerant plants grow better than wild-type plants under saline-alkali conditions,

[0046] The saline-alkaline conditions include pH>7.5, Na + Growth conditions with concentrations > 75 mM or pH > 8.0, Na + Growth conditions with concentrations >50 mM.

[0047] In some embodiments, the expression levels of all the alleles in the plant are reduced or all the alleles are not expressed by gene editing methods, targeted mutagenesis, chemical induction, radiation induction, natural mutation, RNAi or the addition of substances that inhibit the expression of the target gene.

[0048] In some embodiments, all alleles of the gene are knocked out or mutated in the plant, for example, by knocking out the GGL domain or GGL-like domain of the gene by homologous recombination, or editing the GGL domain or GGL-like domain of the gene by CRISPR technology.

[0049] In some embodiments, the N-terminal first exon portion of all the alleles is knocked out or mutated, so that the activity of the encoded protein is reduced or inactive.

[0050] In some embodiments, the GGL domain or GGL-like domain, or the first N-terminal exon portion of all alleles is knocked out or mutated, such that the activity of the encoded protein is reduced or inactive.

[0051] In some embodiments, the expression level of the gene is reduced by at least 51%, preferably by 60%, 70% or 80%, more preferably by 85%, 90% or 95%, or even not expressed compared to wild-type control plants.

[0052] In some embodiments, the plant is a monocot or dicot, e.g., a grass, such as, but not limited to, sorghum (e.g., sorghum), oryza (e.g., rice), millet, corn, wheat, or soybean.

[0053] In some embodiments, the method further comprises identifying a parent plant comprising a knockout or mutation of all said alleles, or comprising a non-functional allele, and self-pollinating or hybridizing the parent plant with another parent plant comprising a knockout or mutation of said gene, or comprising a non-functional allele to obtain one or more generations of offspring plants, wherein the knockout or mutation of all said alleles results in reduced activity or no activity of the proteins encoded by said alleles.

[0054] In some embodiments, the GGL domain or GGL-like domain, or the N-terminal first exon portion of all alleles of a gene encoding an amino acid sequence selected from the group consisting of:

[0055] (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions;

[0056] (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function;

[0057] (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function;

[0058] (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function;

[0059] (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or

[0060] (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function.

[0061] In some embodiments, the saline-alkali tolerant plants bred by the methods of the present invention have increased survival rate, increased yield, increased plant height or fresh weight under saline-alkali growth conditions compared to corresponding wild-type controls.

[0062] In some embodiments, the saline-alkaline growth conditions include pH>7, Na + Culture conditions with concentrations >50 mM.

[0063] In a third aspect, the present invention provides a plant or plant material, wherein all alleles encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity or more preferably at least about 90% or about 95% identity to SEQ ID NO: 15, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15 are knocked out or mutated, preferably, wherein the GGL domain or GGL-like domain, or the N-terminal first exon portion of all alleles of the gene is knocked out or mutated,

[0064] The knockout or mutation of all the alleles results in reduced or no activity of the proteins encoded by all the alleles.

[0065] In some embodiments, the plant or plant material comprises a non-functional allele of the gene.

[0066] In some embodiments, the plant is a monocot or dicot, e.g., a grass, such as, but not limited to, sorghum (e.g., sorghum), oryza (e.g., rice), millet, corn, wheat, or soybean.

[0067] In some embodiments, the plant material is a plant part, plant organ, plant tissue, seed, plant protoplast, or plant cell, for example, an embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, plant cell culture, or plant callus.

[0068] In some embodiments, in the plant or plant material, the GGL domain or GGL-like domain, or the first N-terminal exon portion of all alleles of the gene encoding the following amino acid sequences is knocked out or mutated:

[0069] (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions;

[0070] (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function;

[0071] (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function;

[0072] (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function;

[0073] (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or

[0074] (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function.

[0075] In a fourth aspect, the present invention provides a method for preparing hybrid plant seeds, the method comprising:

[0076] (i) crossing a first parent plant with a second parent plant, wherein in said first parent plant and said second parent plant, all alleles encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15 are knocked out or mutated; and

[0077] (ii) harvesting seeds of the hybrid plants or their progeny.

[0078] In some embodiments, the first parent plant and / or the second parent plant comprises a non-functional allele of the gene.

[0079] In some embodiments, the first parent plant and / or the second parent plant is an inbred plant.

[0080] The present invention also provides a method for preparing conventional planting seeds, the method comprising:

[0081] Propagating parental seeds to harvest progeny seeds thereof, wherein in the parental seeds, all alleles encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15 have been knocked out or mutated such that the protein is not expressed or is expressed at a reduced level compared to wild-type plants.

[0082] In some embodiments, in the parental seed, all alleles encoding the following amino acid sequence have been knocked out or mutated:

[0083] (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions;

[0084] (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function;

[0085] (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function;

[0086] (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function;

[0087] (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or

[0088] (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function.

[0089] In a fifth aspect, the present invention provides a plant grown from the seed of the fourth aspect, or plant material thereof.

[0090] In a sixth aspect, the present invention provides a method for cultivating saline-alkali sensitive plants, the method comprising:

[0091] Increasing the expression level of a gene encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15 in a plant, or expressing or overexpressing a C-terminally truncated protein encoded by a mutant of the gene in a plant.

[0092] In some embodiments, the expression level of the gene of interest is increased by introducing into the plant an exogenous nucleic acid molecule encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15.

[0093] In some embodiments, genetic material carrying the nucleic acid molecule is introduced into cells or tissues of the plant, and the genetic material exists in the plant in the form of free or integrated into the chromosomes of the plant. The cells or tissues into which the genetic material has been introduced are then cultured into complete plants to obtain the salt-alkali sensitive plant.

[0094] In the present invention, the saline-alkaline conditions include pH>7.5, Na + Growth conditions with concentrations > 75 mM or pH > 8.0, Na + Growth conditions with concentrations >50 mM.

[0095] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples. However, it will be understood by those skilled in the art that the following drawings and examples are intended only to illustrate the present invention and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art based on the following detailed description of the accompanying drawings and preferred embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] Figure 1. Evaluation conditions and phenotypic variation for salt-alkali tolerance in different sorghum cultivars. (A) Survival analysis of 16 sorghum cultivars under different salinity-alkali stress concentrations at the germination stage. (BF) Treatment of sorghum cultivars with a 75 mM mixed alkali solution (i.e., NaHCO₃:Na₂CO₃ at a molar ratio of 5:1, pH = 9.2-9.4). (B) Relative survival rate (RSR) analysis of the 16 sorghum cultivars under 5 weeks of alkali stress. (C) Phenotypic observations of representative sorghum cultivars treated with alkali stress for 3 weeks or without alkali stress (i.e., CK, control). Scale bars represent 5 cm. (D) Number of sorghum accessions from the sorghum association panel (SAP) with varying relative survival rates 21 days after treatment with a 75 mM mixed alkali solution. (E) Relative survival rates of 352 accessions of grain sorghum from a natural population under control (CK) and alkali treatment (75 mM mixed alkali). Accessions with low germination rates (<80%) in the control were excluded from the counts. (F) QQ-plot analysis of saline-alkali tolerance in the SAP population.

[0097] Figure 2. Phenotypic changes of sorghum under different salinity and alkali treatments. (A) Statistical analysis of seedling establishment rates of 16 test accessions under different concentrations of mixed alkali stress; (B) Relative survival rate analysis of 16 test accessions under 75 mM mixed alkali stress and control conditions at different days. CK represents the survival rate under control conditions, T represents the survival rate under 75 mM mixed alkali stress, and T_CK represents the relative survival rate.

[0098] Figure 3. Natural variation in the SbAT1 gene, associated with salt and alkaline tolerance, in sorghum. (A) Manhattan plot of a genome-wide association study (GWAS) for alkaline tolerance in a natural sorghum population. Sex-pair survival was obtained from sorghum plants sown and grown for 21 days with (alkaline stress) and without (control) the addition of a 75 mM mixed alkali solution. The arrows in the figure indicate the major loci of the SbAT1 gene. (B) Scatter plot of the genomic region approximately 10 Mb before and after the SbAT1 locus on chromosome 1. (C) SbAT1-based association mapping between 29 detected sequence variants in the SbAT1 gene region and alkaline tolerance in 37 sequenced sorghum accessions. LD analysis between the 29 causal sites showed linkage association signals. Five major variant sites (red dots) showed strong association signals with strong LD and are highlighted with black lines. (D) Two representative haplotypes (Hap1 and Hap2) of SbAT1 were detected based on five major variant sites. The frameshift mutation in Hap2 (from "G" to "GGTGGC") is highlighted in red. (E) Relative survival rates of 20 sorghum accessions in Hap1 and 17 sorghum accessions in Hap2 after alkaline stress (75 mM mixed alkali treatment). n represents the number; statistical P values ​​were determined using a two-tailed unpaired t-test. (F) Relative expression levels of SbAT1 in alkali-tolerant (T) and alkali-sensitive (S) sorghum plants treated with 75 mM mixed alkali for 5 and 8 days, as well as in the corresponding control (CK) conditions. Statistical significance was determined by one-way ANOVA with Tukey's multiple comparison test. NS indicates not significant.

[0099] Figure 4. Schematic diagram of the protein structure of sorghum AT1 and its mutant at1.

[0100] Figure 5. Phenotypes of sorghum NIL parental lines and SbAT1 transgenic plants under alkali and / or salt stress. (A) Phenotypes of the NIL parental lines SN010 (NIL-AT1) and M-81E (NIL-at1) under alkali stress. SN010 (NIL-AT1) and M-81E (NIL-at1) seeds were sown in soil without or with 75 mM mixed alkali, and photographed 17 days later. Scale bars represent 5 cm. (B and C) Statistical analysis of relative survival (B) and relative plant height (C) of SN010 (NIL-AT1) and M-81E (NIL-at1) under alkali treatment compared to no alkali treatment (CK). (D) Phenotypes of the sorghum NIL parental lines SN010 (NIL-AT1) and M-81E (NIL-at1) under salt stress. SN010 (NIL-AT1) and M-81E (NIL-at1) seeds were sown in neutral pH soil containing 75, 100, 150, and 200 mM NaCl, and photographed after 14 days. The scale bar represents 5 cm. (E and F) Statistical analysis of relative survival rate (B) and relative plant height (C) of SN010 (NIL-AT1) and M-81E (NIL-at1) under salt treatment (D). (G) qRT-PCR analysis of SbAT1 expression in the T0 generation of SbAT1 overexpressing (SbAT1-OE) plants. (H) Under control (CK) and 75 mM mixed alkali stress, SbWT, SbAT1-OE, and SbAT1 ko Phenotypic analysis. Photos were taken 14 days after sowing; scale bars represent 5 cm. (K) Western blot analysis of SbAT1 and Sbat1. The top panel shows a schematic diagram of SbAT1 and its truncated form, Sbat1, fused to GFP at the C-terminus. The large subunit of ribosomal-1,5-bisphosphate carboxylase / oxygenase (RbcL) was used as a loading control.

[0101] Figure 6. Function of SbAT1 in alkali tolerance in sorghum. (A) Schematic representation of SbAT1 and its truncated form Sbat1 in sorghum NIL-AT1 and NIL-at1 plants. (B) Phenotypic analysis of sorghum NIL seedlings under alkali stress. Photos were taken 14 days after seed sowing (CK, no alkali stress; 75 mM mixed alkali), and the scale bar represents 5 cm. (C) Statistical analysis of the relative survival rate of seedlings in (B). (D) Statistical analysis of the relative survival rate of SbWT, SbAT1 overexpression (SbAT1-OE), and SbAT1 gene knockout (SbAT1 ko ) Schematic diagram of SbAT1 and its non-functional version in plants with WT, SbAT1 overexpression (SbAT1-OE) and SbAT1 knockout (SbAT1 ko(A) Representative photos of seedlings at day 14 after treatment with no alkali stress (CK) and 75 mM mixed alkali stress. Scale bars represent 5 cm. (F) Statistical analysis of relative survival rates of seedlings in (E).

[0102] Figure 7. Field performance of sorghum near-isogenic lines sown in saline-alkali soils of Ningxia, northwest China.

[0103] Figure 8. Soil physical and chemical properties and corresponding seedling survival statistics of near-isogenic lines on saline-alkali soils in different regions of Ningxia, China. (A) and (B) show the soil physical and chemical properties of saline-alkali soils in Huiwei and Dongfeng villages, respectively. (C) and (D) show the survival statistics of near-isogenic lines on saline-alkali soils in Huiwei and Dongfeng villages, respectively.

[0104] Figure 9. Construction and gene editing identification results of sorghum overexpression transgenics and mutants.

[0105] Figure 10. Construction of foxtail millet mutants and identification of gene-edited materials.

[0106] Figure 11. Phenotypic identification and concentration screening of transgenic sorghum and millet. (A) Growth of transgenic sorghum and millet genetic materials on day 14 after treatment with the control (CK) and different mixed alkaline stress conditions. (B) Statistical analysis of the survival rates of transgenic sorghum and millet genetic materials under different mixed alkaline stress conditions. The upper figure shows the survival rate of transgenic sorghum, and the lower figure shows the survival rate of transgenic millet.

[0107] Figure 12. AT1 homolog Gγ-like subunits have conserved functions in alkaline tolerance in millet, rice, and maize. (A) Schematic diagram of millet SiAT1 and its truncated or nonfunctional versions in SiAT1 genetic plants. SiWT represents wild-type millet Ci846. (B) Photographs of representative SiAT1 genetic plants 14 days after sowing in the absence or presence of 75 mM mixed alkali stress, with scale bars representing 5 cm. (C) Statistical analysis of relative survival rates in millet in (B). (D) Schematic diagram of rice OsGS3 and its truncated or nonfunctional versions in OsGS3 genetic plants. OsWT is wild-type rice ZH11. (E) Photographs of representative OsGS3 genetic plants 21 days after sowing in the absence or presence of 75 mM mixed alkali stress, with scale bars representing 5 cm. (F) Statistical analysis of relative survival rates in rice in (E). (G) Statistical analysis of relative survival rates of wild-type ZmGS3 and ZmGS3 in wild-type maize ZmWT. ko Schematic representation of the non-functional versions in maize. ZmWT is the wild-type maize KN5585. (H) ZmWT and ZmGS3 koPhotographs of maize plants 14 days after sowing without or with 75 mM mixed alkali stress, scale bar represents 5 cm. (I) Statistical analysis of relative survival rate of maize plants at 50 days after sowing (H).

[0108] Figure 13. AT1 gene editing information in millet and maize and the phenotype of transgenic plants in response to alkaline stress. (A) Different SiAT1 124 Overexpression (SiAT1 124 -OE) strain T0 generation Myc-SiAT1 124 Western blot analysis of expression. (B) Foxtail millet SiAT1 102 Target sequence location and gene editing information of AT1 in plants. 102 A single base insertion occurs, leading to a frameshift mutation and termination of translation. 102 The protein with the predicted C-terminal truncated amino acids 1-102 was retained. (C) SiWT, SiAT1 124 -OE、SiAT1 102 and SiAT1 ko Phenotypic analysis and relative plant height statistical analysis of millet plants under alkaline stress. Millet seeds were sown in soil without or with 75 mM mixed alkali and photographed on the 14th day after sowing. The scale bar represents 5 cm. (D) Rice OsWT, OsGS3-1OE, OsGS3-4OE, OsGS3 ko Growth morphology of ZmGS3Ri and OsGS3Ri under no or 75 mM mixed alkali stress treatment. Photos were taken on the 29th day after sowing, and the scale bar represents 5 cm. (E and F) Statistical analysis of relative plant height (E) and relative chloroplast content (F) of rice lines in (D). Data are mean ± SEM of 4 representative plants for each line. Statistical significance was determined by one-way ANOVA with Tukey's multiple comparison test. (G) ZmGS3 and ZmGS3 ko Target sequence location and gene editing information in maize plants. ko A 34-bp deletion and a single base mutation occurred in maize plants, leading to a frameshift mutation and premature translation termination. (H) Maize ZmWT and ZmGS3 ko Phenotypic analysis and relative plant height statistical analysis of plants under alkaline stress. Corn seeds were sown in soil without (CK) or with 75 mM mixed alkali and photographed 14 days after sowing. The scale bar represents 5 cm. The right panel shows the relative height of corn ZmWT and ZmGS3. ko Statistical analysis of plant height under 75 mM mixed alkali stress. Statistical differences were determined by two-tailed unpaired t-test. (I) ZmWT and ZmGS3 maize koPhenotypes of plants under 75 mM mixed alkali stress. Photographs were taken 50 days after sowing. Scale bars represent 5 cm.

[0109] Figure 14. Construction results of transgenic plants overexpressing rice GS3-1 or GS3-4 and suppressing GS3 expression. (A) Schematic diagram of the overexpression vector; (B) Schematic diagram of the suppression vector; (C) Expression level detection results of the overexpression and suppression transgenic plants.

[0110] Figure 15. Schematic diagram of the construction process of the rice GS3 CRISPR knockout vector pYL-Cas9-gRNA-OsGS3, (A) Schematic diagram of the structure of the rice GS3 gene and the location of the CRISPR target sites; (B) The two target sites T1 and T2 were inserted into pYL-OsU3-gRNA and pYL-OsU6a-gRNA by PCR, respectively, to obtain pYL-OsU3-T1-gRNA and pYL-OsU6a-T2-gRNA; (C) Schematic diagram of the structure of the expression vector pYL-Cas9-gRNA-OsGS3.

[0111] Figure 16. Results of mutation site detection in the T1 generation of rice GS3 CRISPR knockout transgenic plants.

[0112] Figure 17. Schematic diagram of the construction process of the maize ZmGS3 CRISPR knockout vector pYL-Cas9-gRNA-ZmGS3. (A) Structure of the maize ZmGS3 gene and schematic diagram of the CRISPR target site; (B) Mutation site detection results of the T1 generation of maize ZmGS3 CRISPR knockout transgenic plants.

[0113] Figure 18. Schematic diagram of the TaGS gene structure and target setting using CRISPR / Cas9 technology according to Example 4.1 of the present invention.

[0114] Figure 19 is a schematic diagram of the sequencing results of the T2 generation mutant of the TaGS gene of the transgenic wheat plant E5 according to Example 4.2 of the present invention; wherein WT represents the wild-type gene sequence, "-" represents the sequence with a deletion mutation, and the number after "-" represents the number of deleted or inserted nucleotides.

[0115] Figure 20. Salt-alkali tolerance phenotype of wheat under salt-alkali stress according to Example 4.3 of the present invention. A represents water treatment; B represents treatment with a 75 mM mixed alkaline solution (NaHCO₃:Na₂CO₃ at a molar ratio of 5:1). The three plants on the left in A and B represent wild-type Fielder wheat (i.e., target wheat), labeled WT; the three plants on the right represent the wheat TaGS gene triple mutant E5, labeled E5.

[0116] Figure 21. Gene editing information of TaAT1 (also known as TaGS) in wheat and the corresponding alkaline stress phenotypes of transgenic wheat plants. (A) Schematic diagram of the T-DNA structure in the CRISPR / Cas9 construct. (B) CRISPR / Cas9-induced mutagenesis of the target gene. The target sequence and PAM sequence are shown in blue and red, respectively. The mutation site is shown in dotted lines. (C) Wild-type wheat TaWT and TaAT1 knockout (TaAT1 ko ) Phenotypic analysis of plants under alkaline stress. Wheat seeds were sown in soil without or with 125 mM mixed alkali, and photographs were taken on the 21st day after sowing. The scale bar represents 5 cm. (D) Statistical analysis of the relative survival rate of wheat lines in (C). (E) Representative seedlings of TaAT1 genetic plants under 125 mM mixed alkali stress treatment on the 21st day after sowing. (F) Statistical analysis of the relative plant height of wheat lines in (E). The data are the mean ± SEM of three representative plants of each line. (G) Statistical analysis of the relative plant height of wild-type wheat TaWT and TaAT1 knockout (TaAT1 ko ) DAB staining of plant leaves. Scale bars represent 1 cm. 10-day-old seedlings were treated with or without 250 mM mixed alkali for 60 h and used for analysis. (H) H2O2 levels detected in the root tips of TaAT1-related genetic plants using a ROS detection probe (H2DCFDA). 10-day-old seedlings were treated with or without 250 mM mixed alkali for 48 h and used for analysis. Scale bars represent 100 μm. (I) Statistical analysis of H2O2 concentrations measured in (H). Data are mean ± SEM (n = 6 plants).

[0117] Figure 22. OsGS3 non-functional allele contributes to alkaline tolerance in rice. (A) KY treated with or without 75 mM mixed alkali. NIL (GS3) and KY NIL (gs3 - ) Phenotype of seedlings on day 21 after sowing. Scale bars represent 5 cm. The right panel shows statistical analysis of relative plant height of rice under alkali treatment compared with no alkali treatment. (B) KY rice grown in soil NIL (GS3) and KY NIL (gs3 - ) phenotype. The scale bar represents 5 cm. The right figure shows the statistical analysis of relative survival rate. The data are the mean ± SEM of four replicates for each treatment, and 40 plants were tested in each replicate. (C) Relative survival rate and grain yield of rice NILs grown in naturally alkaline soil (pH 9.45) and near-neutral soil (pH 7.74) in a greenhouse in Jilin Province, China. The number of panicles represents the number of rice panicles per plant, and the data are the mean ± SEM (n = 3 small experimental plots). (D) KY in alkaline soil (pH 9.17) in Jilin Province, China in 2021 NIL(GS3) and KY NIL (gs3 - ) seedling phenotypes. (E) KY in alkaline soil (pH 9.17) in Jilin Province, China in 2021 NIL (GS3) and KY NIL (gs3 - ) Representative rice ears. Scale bars represent 2 cm. (F) KY rice grown in a field (pH 5.58) in Heilongjiang Province, China in 2021. NIL (GS3) and KY NIL (gs3 - ) grain number per panicle. Data are mean ± SEM (n = 28). (G and H) KY rice grown in alkaline soil (pH 9.10) in Jilin Province and fields (pH 5.58) in Heilongjiang Province, China, in 2022. NIL (GS3) and KY NIL (gs3 - ). Data are mean ± SEM (n = 5 plots). (I and J) KY rice grown in 2022 on alkaline-free fields (pH 7.20) in Beijing and alkaline fields (pH 9.10) in Jilin Province, China. NIL (GS3) and KY NIL (gs3 - ) grain length (I) and grain width (J). Data are mean ± SEM (n = 100). (K) Grain yield of Zhongkefa5 (ZKF5), an improved elite rice variety with a non-functional allele of OsGS3. The rice was grown in high-sodium soil (pH 8.5-8.7) and low-sodium soil (pH 7.4-7.6) in Jilin Province, China in 2021. (L) OsWT and OsGS3 grown in natural alkaline soil (pH 9.45) and near-neutral soil (pH 7.74) in a greenhouse in Jilin Province, China. ko Statistical analysis of relative survival rates. Data are mean ± SEM (n = 3 small experimental plots).

[0118] Figure 23. AT1 / GS3 knockout and natural non-functional alleles improve crop yield in saline-alkali soil. (A) KY rice grown on alkaline soil (pH 9.17) in Jilin Province, China in 2021. NIL (GS3) and KY NIL (gs3 - ) phenotypes and grain yield. The first figure shows the phenotypes of rice plants during the reproductive stage (3 months after planting in the field). The panicle number represents the number of panicles per rice plant. Data are mean ± SEM (n = 3 plots). (B) Sorghum SbWT and SbAT1 grown on alkaline soil (pH 9.10) in Ningxia Autonomous Region, China in 2021. koPhenotype, survival rate, grain yield, and total biomass of sorghum NIL-SbAT1 and NIL-Sbat1 seedlings grown on alkaline soil (pH 9.10) in Ningxia Autonomous Region, China in 2021. (D) Phenotype, survival rate, and grain yield of millet lines grown on alkaline soil (pH 9.10) in Ningxia Autonomous Region, China in 2021. Data are mean ± SEM (n = 3 plots). (E) Maize ZmWT and ZmGS grown on alkaline soil (pH 9.10) in Ningxia Autonomous Region, China in 2021. ko Statistical analysis of plant survival. Data are mean ± SEM (n = 3 plots). In (AE), statistical significance was determined by a two-tailed unpaired t-test. *P < 0.05 and **P < 0.01, ***P < 0.001 and ****P < 0.0001.

[0119] Figure 24. A proposed model for the Gγ subunit AT1-mediated alkaline stress response in plants. Under alkaline stress, PIP2s functions as a H2O2 exporter. The Gγ subunit AT1 likely pairs with Gβ to negatively regulate PIP2s phosphorylation, thereby reducing PIP2s' H2O2 export capacity, leading to excessive H2O2 accumulation and plant sensitivity to alkaline stress. A truncated form of AT1, at1, further inhibits H2O2 export activity and contributes to plant hypersensitivity to alkaline stress. However, a naturally nonfunctional form of AT1 or knockout of the AT1 homolog releases the inhibitory effect on PIP2s and effectively improves alkaline stress tolerance in crops.

[0120] Figure 25. Amino acid sequence alignment of AT1 homologous genes from sorghum (Sb), rice (Os), millet (Si), cultivated soybean (Gm), and wild soybean (Gs). The red box indicates the predicted conserved GGL domain.

[0121] Description of Sequence Listing

[0122] Table A. Brief description of the sequences in the present invention

[0123] Detailed Description of the Invention

[0124] It will be understood by those skilled in the art that the present invention is not limited to the specific methodology, embodiments and reagents described herein, as these are exemplary illustrations. It will also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of the present invention, which is limited only by the appended claims.

[0125] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0126] Furthermore, unless the context requires otherwise, terms in the singular shall include pluralities and terms in the plural shall include the singular. More specifically, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0127] definition

[0128] The following definitions and methods are provided to better define this application and to guide those skilled in the art in practicing this application. Unless otherwise noted, terms are to be understood according to conventional usage by those skilled in the relevant art. All patent documents, academic papers, industry standards, and other publications cited herein are hereby incorporated by reference in their entirety.

[0129] As used herein, "plant" broadly includes reference to whole plants, plant organs, plant tissues, seeds and plant cells and their progeny. Plant cells include, but are not limited to, cells from seeds, suspension cultures, embryos, meristematic regions, callus, leaves, roots, seedlings, gametophytes, sporophytes, pollen and microspores. "Progeny" comprises any subsequent generation of a plant. "Rice" or "corn" is any rice or corn plant and includes all plant varieties that can be bred with rice or corn, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures, plant callus, plants or plant parts from which plants can be regenerated, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc.

[0130] As used herein, the terms "salt-alkali land", "sodium soil" or "alkaline soil" refer to soil types where salts accumulate, meaning that the salt content in the soil affects the normal growth of plants (e.g., crops). The formation of alkaline soil and alkaline soil is mostly related to the accumulation of carbonates in the soil, so the alkalinity is generally high, and plants can hardly survive in areas with severe saline-alkali soil. Based on the soil salt content and pH value, saline-alkali land is divided into light saline-alkali land, moderate saline-alkali land and heavy saline-alkali land. Among them, light saline-alkali land refers to land with a germination rate of 70%-80% when planting crops and a salt content of less than 0.3%; heavy saline-alkali land refers to land with a salt content of more than 0.6% and a germination rate of less than 50%; moderate saline-alkali land is between light saline-alkali land and heavy saline-alkali land; expressed in pH value: light saline-alkali land has a pH value of 7.1-8.5, moderate saline-alkali land has a pH value of 8.5-9.5, and heavy saline-alkali land has a pH value of 9.5 or above. Mixed sodium salts (eg, sodium carbonate and sodium bicarbonate) are often used in the laboratory to simulate "sodium soil."

[0131] In the present application, the words “comprise”, “include” or variations thereof should be understood as including other elements, numbers or steps in addition to the elements, numbers or steps described.

[0132] Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino to carboxyl orientation. Amino acids may be referred to herein by either their commonly known three-letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by their generally accepted single-letter codes. Numerical ranges are inclusive of the numbers defining the range.

[0133] As used herein, "nucleic acid" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single- or double-stranded form, and, unless otherwise limited, includes known analogs having the essential properties of natural nucleotides (e.g., peptide nucleic acids) that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides.

[0134] As used herein, the terms "encoding" or "encoded" when used in the context of a specific nucleic acid refer to the nucleic acid containing the necessary information to direct the translation of the nucleotide sequence into a specific protein. Codons are used to represent the information encoding the protein. As used herein, "full-length sequence" in reference to a specific polynucleotide or the protein it encodes refers to the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. A full-length polynucleotide encodes the full-length, catalytically active form of the specific protein.

[0135] The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues is an artificial chemical analog of a corresponding naturally occurring amino acid. The term also applies to naturally occurring amino acid polymers.

[0136] The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid can be a naturally occurring amino acid and, unless otherwise limited, can include known analogs of a naturally occurring amino acid that can function in a manner similar to the naturally occurring amino acids.

[0137] In some embodiments, the nucleotide sequences of the present application can be altered to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequences of the present application can be substituted without changing the amino acid sequence according to the disclosed monocot codon preferences, for example, codons encoding the same amino acid sequence can be replaced with codons preferred by monocots without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, part of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode the amino acid sequence of one of the proteins of the embodiments due to the degeneracy of the genetic code. In some embodiments, part of the nucleotide sequence in the present application is replaced according to the monocot codon preference. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of the amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituents. Exemplary amino acid substitution groups having various of the aforementioned contemplated properties are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions, such as exchanging one amino acid for another with similar properties, can be made. "Conservative amino acid substitutions" are those substitutions that replace an amino acid with a different amino acid where the substitution is predicted to have the least effect on the properties of the reference polypeptide. In other words, conservative amino acid substitutions substantially preserve the structure and function of the reference polypeptide. Table B below provides a list of exemplary conservative amino acid substitutions contemplated herein.

[0138] Table B. Exemplary conservative amino acid substitutions

[0139] With respect to proteins, a "deletion" refers to a change in the amino acid sequence that results in the absence of one or more amino acid residues. A deletion can remove at least 1, 2, 3, 4, 5, 10, 20, 50, 100, 200 or more amino acid residues. Deletions can include internal deletions and / or terminal deletions (e.g., N-terminal truncation, C-terminal truncation, or both of a reference polypeptide). A "variant," "mutant," or "derivative" of a reference polypeptide sequence can include deletions relative to the reference polypeptide sequence.

[0140] With respect to proteins, a "fragment" is a portion of an amino acid sequence that is identical in sequence to a reference sequence but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one amino acid residue. For example, a fragment may comprise 5 to 1000 consecutive amino acid residues of a reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 consecutive amino acid residues of a reference polypeptide. Fragments may be preferentially selected from certain regions of a molecule. The term "at least one fragment" includes the full-length polypeptide. Relative to the full-length protein, a fragment may comprise an N-terminal truncation, a C-terminal truncation, or both. A "variant," "mutant," or "derivative" of a reference polypeptide sequence may include a fragment of a reference polypeptide sequence.

[0141] With respect to proteins, the terms "insertion" and "addition" refer to changes in the amino acid sequence that result in the addition of one or more amino acid residues. An insertion or addition can refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200 or more amino acid residues. A "variant," "mutant," or "derivative" of a reference polypeptide sequence can include insertions or additions relative to the reference polypeptide sequence. Variants of a protein can have N-terminal insertions, C-terminal insertions, internal insertions, or any combination of N-terminal insertions, C-terminal insertions, and internal insertions.

[0142] With respect to proteins, the terms "percent identity" and "% identity" refer to the percentage of residue matches between at least two amino acid sequences aligned using a standardized algorithm. Methods of amino acid sequence alignment are well known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail below, generally retain the charge and hydrophobicity at the substitution site, thereby retaining the structure (and therefore the function) of the polypeptide. The percent identity of an amino acid sequence can be determined as understood in the art (see, e.g., U.S. Patent No. 7,396,664, which is incorporated herein by reference in its entirety). The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) provides a set of commonly used and freely available sequence comparison algorithms that are available from multiple sources, including NCBI, Bethesda, Md., on its website. The BLAST software suite includes various sequence analysis programs, including "blastp," which is used to compare a known amino acid sequence with other amino acid sequences from various databases.

[0143] With respect to proteins, percent identity can be measured over the length of an entire defined polypeptide sequence (e.g., as determined by a particular SEQ ID number), or can be measured over a shorter length, for example, the length of a fragment taken from a larger, defined polypeptide sequence (e.g., a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70, or at least 150 contiguous residues. Such lengths are exemplary only, and it will be understood that any fragment length supported by the sequences shown herein in the tables, figures, or sequence listing can be used to describe the length over which percent identity can be measured.

[0144] With respect to nucleic acids and proteins, the term "similarity" refers to the proportion of identical bases or amino acids between the detected sequence and the reference sequence in the entire sequence (a relatively macroscopic description). In amino acid sequence alignment, similarity also includes, in addition to identical residues, whether the two residues at corresponding positions have similar properties, such as the size, charge, hydrophilicity, and hydrophobicity of the side chain groups. In other words, for proteins, "identity" requires that the amino acids at the aligned positions are exactly the same, while "similarity" does not require that the amino acids at the aligned positions are exactly the same. If the amino acid at the aligned position belongs to a conservatively substituted residue, the amino acid at that position is considered to be similar.

[0145] A "protein tag" refers to a polypeptide or protein that is fused to a target protein using in vitro DNA recombination techniques to facilitate expression, detection, tracing, and / or purification of the target protein. Protein tags include, but are not limited to, Flag tags, His tags, MBP tags, HA tags, myc tags, GST tags, and / or SUMO tags.

[0146] As used herein, "nucleic acid sequence identity" refers to the sequence similarity between two polynucleotide sequences. When a position in the two compared sequences is occupied by the same base, for example, if every position in two DNA molecules is occupied by adenine, then the molecules are identical at that position. The percent identity between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of compared positions × 100.

[0147] The identification of nucleic acid sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences, which are present in cloned genomic DNA fragments or cDNA fragment populations (i.e., genomic libraries or cDNA libraries) from a selected organism. The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment, or other oligonucleotides and can be labeled with a detectable group such as 32P or other detectable markers. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on the embodiment sequence. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences can be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" refers to conditions under which, relative to hybridization with other sequences, the probe will hybridize to its target sequence to a detectable greater degree (e.g., at least 2 times, 5 times, or 10 times the background). Stringent conditions are sequence-dependent and vary in different environments. By controlling hybridization stringency and / or controlling cleaning conditions, a target sequence that is 100% complementary to the probe can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow some sequence mismatches to detect lower similarities (heterologous probe method). Typically, the probe length is less than about 1000 or 500 nucleotides. Typically, stringent conditions are conditions in which the salt concentration is less than about 1.5M Na ions, typically about 0.01M to 1.0M Na ion concentration (or other salts), at pH 7.0 to 8.3, and the temperature is at least about 30°C when used for short probes (e.g., 10 to 50 nucleotides); at least about 60°C when used for long probes (e.g., greater than 50 nucleotides). Stringent conditions can also be achieved by adding a destabilizing agent such as formamide. Exemplary low stringency conditions include hybridization at 37°C using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate), and washing in 1× to 2× SSC (20× SSC = 3.0M NaCl / 0.3M trisodium citrate) at 50°C to 55°C. Exemplary moderate stringency conditions include hybridization at 37°C in 40% to 45% formamide, 1.0M NaCl, 1% SDS, and washing in 0.5× to 1× SSC at 55°C to 60°C. Exemplary high stringency conditions include hybridization at 37°C in 50% formamide, 1M NaCl, 1% SDS, and a final wash in 0.1× SSC at 60°C to 65°C for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. Duration of hybridization is typically less than about 24 hours, typically about 4 hours to about 12 hours. Specificity is often dependent on post-hybridization washes, with the critical factors being the ionic strength and temperature of the final wash solution.The Tm (thermodynamic melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% formamide) - 500 / L, where M is the molar concentration of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, "% formamide" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Washing is typically performed at least until equilibrium is reached and a low level of background hybridization is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mismatch should reduce the Tm by approximately 1°C; thus, the Tm, hybridization, and / or wash conditions can be adjusted to hybridize to sequences of desired identity. For example, if sequences with ≥90% identity are desired, the Tm can be lowered by 10°C. Generally, stringent conditions are selected to be about 5°C lower than the Tm for the specific sequence and its complement at a defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C below the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C below the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C below the Tm.

[0148] The term "frameshift mutation" refers to a mutation in which one or more base pairs (not three or multiples of three) are inserted or lost at a specific site in a DNA fragment, causing a misalignment of the coding sequence following the insertion or loss site. This mutation can cause abnormalities in the entire genetic information following that site. When expressed, genes with frameshift mutations can alter the amino acid sequence that makes up the polypeptide chain, severely impacting the structure and function of proteins or enzymes.

[0149] Unless otherwise indicated, all numbers used in the specification and claims expressing amounts of ingredients, reaction conditions, and the like should be understood as being modified in all instances by the term "about." As used herein, the term "about," when referring to a measurable value such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of ±20% from the stated amount in some embodiments, ±10% from the stated amount in some embodiments, ±5% from the stated amount in some embodiments, ±1% from the stated amount in some embodiments, ±0.5% from the stated amount in some embodiments, and ±0.1% from the stated amount in some embodiments, as such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, polypeptides, and the like. Therefore, unless indicated to the contrary, the numerical parameters set forth in the specification and appended claims are approximate values ​​that may vary depending upon the desired properties sought to be obtained by the subject matter disclosed herein. Example

[0150] Below with reference to embodiment, embodiment of the present invention is described in detail, but those skilled in the art will understand that the following examples are only used to illustrate the present invention, and are not used to limit the scope of the present invention.Under the situation that does not deviate from the spirit and essence of the present invention, the modification or replacement of the inventive method, step or condition done all fall within the scope of this application.If not otherwise specified, embodiment is according to conventional experimental conditions, as the molecular cloning laboratory manual (Sambrook J&Russell DW, Molecular cloning:a laboratory manual, 2001) of Sambrook et al., or according to the conditions of manufacturer's specification sheet suggestion.If not otherwise specified, the chemical reagent used in embodiment is conventional commercial reagent, and the technical means used in embodiment is conventional means well known to those skilled in the art.

[0151] Example 1. Discovery and genetic analysis of the sorghum salt-alkaline tolerance gene AT1

[0152] 1.1 Identification of salt-alkali tolerance of sorghum natural population SAP (Sorghum Association Panel) materials

[0153] A total of 352 accessions of grain sorghum and 38 accessions of sweet sorghum were collected from the USDA-ARS (United States Department of Agriculture-Agricultural Research Service) germplasm collection system. Freshly harvested seeds were air-dried and then placed in a 55°C oven for 5-7 days to break dormancy.

[0154] To simulate the various saline conditions likely present in field saline soils, we first tested a mixture of two alkali salts (NaHCO₃ and Na₂CO₃) at varying concentrations (0, 25, 50, 75, 100, 125, and 150 mM) and examined their effects on sorghum seedling survival. Using a mixture of two alkali salts resulted in a relatively stable pH range throughout the treatment period, facilitating the experimental process. Treatments were performed at varying times. The soil matrix was treated with either the two alkali salt mixture without (control) or with varying concentrations (0, 25, 50, 75, 100, 125, and 150 mM). Plant survival was recorded 21 days after sowing for the treated seeds (Figures 1A and 2). Data are the average of three replicates per treatment, with nine plants tested in each replicate. Relative survival analysis (number of plants surviving under alkaline stress treatment / number of plants surviving without alkaline stress treatment) showed that after 21 days of treatment, 75 mM mixed alkaline solution (i.e., NaHCO3:Na2CO3 at a molar ratio of 5:1, pH = 9.2-9.4) exhibited the widest range of changes and was the most reliable treatment concentration for evaluating alkali tolerance in sorghum (Figures 1A-C).

[0155] The subsequent treatment selected a 75mM mixed alkali solution (i.e., a molar ratio of 5:1 NaHCO3:Na2CO3, pH = 9.2-9.4). First, the seeds were sown in a soil matrix of vermiculite and nutrient soil mixed in a 1:1 ratio, with 12 seeds sown per hole, and three replicates were set. Next, the soil was irrigated with a 75mM mixed alkali solution (a molar ratio of 5:1 NaHCO3:Na2CO3, pH = 9.2-9.4) until saturated as the treatment. The control (CK) was irrigated with clean water and placed on flat ground for uniform absorption. Each treatment was repeated three times. After full absorption, the hole tray was placed in a model plant glasshouse and rehydrated with clean water later. The seedling growth environment is as follows: light / dark period of 16h / 8h, day and night temperature range of 28 / 26℃, and relative humidity of 60% to 70%. On the 23rd day of cultivation, the number of seedlings was counted and the relative survival rate was calculated. The experimental results showed that the salt-alkali tolerance of different varieties during the germination period was extremely significant (Figure 1B-F).

[0156] At the same time, 16 randomly selected grain sorghum varieties were subjected to saline-alkali stress during the germination stage for dynamic monitoring of their germination rate, germination index, and alkali tolerance. Results revealed significant differences in alkali tolerance among the sorghum accessions. With increasing alkali concentrations, the seedling rate of all tested sorghum accessions decreased significantly, though to varying degrees. Statistical analysis revealed that under the control, the seedling rate of the 16 sorghum accessions was approximately 95%, with a standard deviation of 0.04 and a coefficient of variation of 0.04. These three statistical parameters remained unchanged when treated with 50 mM mixed alkali. However, when treated with 75 mM mixed alkali, the mean, standard deviation, and coefficient of variation for the seedling rate of the 16 randomly selected sorghum accessions were 0.66, 0.20, and 0.30, respectively. At concentrations above 75 mM, the seedling rate plummeted, approaching zero. It can be seen that the degree of phenotypic variation between materials is the largest when treated with 75mM mixed alkali (shown as 75mM mixed Alkaline in Figure 2) (Figure 2A). Therefore, the 75mM mixed alkali treatment is suitable for identifying the degree of alkali resistance of natural populations during the germination period. Dynamic monitoring of seedling rate is the simplest, fastest and most effective way to identify salt and alkali resistance, saving time and effort. Therefore, in subsequent experiments, the relative seedling rate was selected as a representative indicator for evaluating alkaline resistance during the germination period to evaluate the degree of salt and alkali resistance. It was subsequently found that the sorghum seedlings under alkali treatment grew better in the first two weeks, but there was a seedling burn phenomenon in the later period of alkali treatment. The 23rd day was the "watershed" of this phenomenon. Therefore, the 23rd day was selected as the time node for GWAS identification (Figure 2B).

[0157] Statistical analysis of relative seedling survival rates for 352 accessions of a natural population of grain sorghum under control (CK) and alkali treatment (75 mM mixed alkali) revealed a normal distribution of relative survival rates (Figure 1D). Survival rates were significantly affected by alkali treatment (as shown by T / CK in Figure 1E). QQ-plot analysis showed a high degree of agreement between the observed and expected values ​​(Figure 1F), indicating that the results are satisfactory and the phenotypic data are reliable for further analysis. Genotypic data for this population were obtained from open-access GBS sequencing data (Morris et al., 2013). SNPs were screened and identified for each accession using the SelectVariants and VariantFiltration methods (QD < 2.0, FS > 200.0, and ReadPosRankSum < 20.0) in GATK software (DePristo et al., 2011). SNP sites in the heterozygous state were recorded as deletions, and SNPs with a deletion rate of more than 20% and a minimum allele frequency (MAF) of less than 5% were deleted. Finally, 82,430 SNP markers were detected.

[0158] 1.2 GWAS analysis identified the gene SbAT1 associated with alkali tolerance in sorghum

[0159] A subsequent GWAS analysis of this population was conducted using the 82,430 SNP markers identified, and the results were calculated using a cMLM model (Wen et al., 2018). Results were Bonferroni-corrected and P values ​​were calculated for significant associations (Ranstam, 2016). A GWAS analysis of alkali tolerance in 352 grain sorghum accessions revealed two major loci (-log10 P>5.0) highly significantly associated with relative seedling establishment (RSE) at approximately 55 Mb on chromosome 1 in a natural population of grain sorghum (Figure 3A and Table 1). The significant SNPs in this population, S1_5577933 and S1_55779336, were directly mapped to the Sobic.001G341700 gene, which was named SbAT1 (Alkali Tolerance 1, or AT1) (Figure 3B). This suggests that SbAT1 is a major gene controlling relative seedling establishment under salinity-alkali stress in sorghum.

[0160] The genomic gene sequence of sorghum AT1 is shown in SEQ ID NO:1. The AT1 gene contains five exons, of which the first exon is located at positions 1-111 of SEQ ID NO:1; the second exon is located at positions 2447-2499 of SEQ ID NO:1; the third exon is located at positions 2846-2890 of SEQ ID NO:1; the fourth exon is located at positions 2972-3025 of SEQ ID NO:1; and the fifth exon is located at positions 4084-4417 of SEQ ID NO:1. The cDNA gene sequence of AT1 is shown in SEQ ID NO:2, and its coding sequence (CDS) is shown in SEQ ID NO:3. AT1 encodes a highly conserved protein consisting of 198 amino acids (SEQ ID NO:4). Sequence alignment of the protein product revealed that the gene shares a similar total amino acid length with the homologous AT1 protein from millet (Setaria italica), and the N-terminal conserved sequence is highly similar. Therefore, sorghum AT1 is considered to be a homolog of millet SiAT1. The genomic nucleotide sequence of the millet SiAT1 gene is shown in SEQ ID NO:5, the amino acid sequence of the millet SiAT1 protein is shown in SEQ ID NO:8, the cDNA sequence encoding the SiAT1 protein is shown in SEQ ID NO:6, and its coding sequence (CDS) is shown in SEQ ID NO:7.

[0161] Table 1. Significant SNPs associated with alkaline tolerance detected in 352 natural populations of grain sorghum

[0162] 1.3 Natural variation of the AT1 gene affects alkali tolerance in sorghum

[0163] To verify the accuracy of this candidate gene and the role of AT1 in regulating alkali tolerance in sorghum, we next identified all variants in AT1 from the 5'-UTR to the 3'-UTR, including SNPs and indels. Sequence alignment revealed three variants in exon 5, including a 5-bp insertion at nucleotide position 3271 of SEQ ID NO:1, which causes premature termination of protein translation. This 5-bp insertion is a potential site for functional variation in the AT1 protein, and sorghum containing this variant is classified as an at1 mutant (Figure 3C). Based on these eight variants in Figure 3D, 38 randomly selected sorghum accessions were divided into two haplotypes: Haplotype I (Hap1, the haplotype corresponding to the wild-type AT1 gene) exhibited significantly higher survival rates under alkali treatment than haplotype II (Hap2, the haplotype corresponding to the AT1 gene in the at1 mutant) (P value = 2.43 × 10 -10 )(Figure 3E), and its correlation with the alkali-resistant phenotype was as high as 3.31×10 -10 , therefore, haplotype I and haplotype II are alleles for alkali tolerance (AT1) and alkali sensitivity (at1), respectively (Figure 3D). Subsequently, we randomly selected eight alkali-tolerant and eight alkali-sensitive lines from a natural population of grain sorghum and measured the expression levels of AT1 after 5 and 8 days of alkali stress. We found no significant difference in the expression of the AT1 gene between the alkali-tolerant line (ARL) and the alkali-sensitive line (ASL). This indicates that, consistent with the lack of a strong correlation signal in the 5'-UTR of AT1, haplotype-based variation is indeed uncorrelated with AT1 expression levels based on RNA levels (Figure 3F). These data suggest that the alkali tolerance and alkali sensitivity phenotypes of the two AT1 haplotypes to alkali treatment are not related to the transcript levels of AT1 and its variant at1, but are more likely due to mutations that affect protein numbering within the coding region.

[0164] Finally, a naturally occurring mutation in the SbAT1 gene was detected. The Sbat1 gene (also referred to as the at1 gene) contains a five-nucleotide insertion (GTGGC) in the fifth exon of the wild-type AT1 gene (i.e., five nucleotides are inserted between positions 3271-3272 of SEQ ID NO:1). This results in a frameshift mutation at the 3' end of the AT1 gene, prematurely terminating protein translation and forming a 137-amino acid residue (shown as "at1-a" in Figure 4). The nucleotide sequence of the at1 gene cDNA is shown in SEQ ID NO:9, and the amino acid sequence of the mutated at1 protein corresponding to the AT1 gene is shown in SEQ ID NO:10.

[0165] 1.4 Role of the AT1 gene in salt-alkaline tolerance

[0166] To evaluate the allelic effect of the AT1 gene on alkaline tolerance in sorghum, we constructed and selected a pair of near-isogenic lines (NILs): NIL-AT1 and NIL-at1. These lines differ only in genotype within a 58-kb region on chromosome 1, while all other marker genes in the background region are identical. The amino acid sequence of the AT1 gene in NIL-AT1 is shown in SEQ ID NO:4; the amino acid sequence of the at1 gene in NIL-at1 is shown in SEQ ID NO:10.

[0167] The NILs are derived from a cross between two sorghum accessions, SN010 and M-81E. SN010 is haplotype Hap1 (containing wild-type AT1), while M-81E is haplotype Hap2 (containing at1). Based on our survival and plant height data (Figures 5A and 6A-C), SN010 (NIL-AT1) exhibited higher alkali tolerance than M-81E (NIL-at1). We treated the two NILs with 75 mM mixed alkali. Under alkali treatment, SN010 (NIL-AT1) exhibited a 56.1% higher relative survival rate and better growth than M-81E (NIL-at1), but no significant differences were observed between the two NILs when planted in neutral pH soil (Figures 5D-E).

[0168] As shown in Figure 5A, under normal growth conditions without saline-alkali stress (control, shown as CK in Figure 5), there was no significant phenotypic difference between the two near-isogenic lines. However, after 23 days of treatment with 75mM mixed alkali (pH 9.32) (shown as 75mM Alkali in Figure 5), nearly all NIL-at1 plants died, while only a few leaves of NIL-AT1 withered, indicating that the plants remained alive. Subsequently, analysis of their relative survival rate, plant height, fresh weight per plant, and relative chlorophyll content (SPAD) (Figures 5B, C, and J) revealed that NIL-AT1 was far more alkali-tolerant than NIL-at1, demonstrating that AT1 is indeed involved in the response to alkaline stress.

[0169] Single salt NaCl treatment of near-isogenic line materials

[0170] It is easy to understand for those skilled in the art that the treatment with 75 mM mixed alkali not only imposes alkaline stress, but also imposes Na + To distinguish whether the sorghum AT1-related stress phenotype is caused by high pH alone or high sodium ions (Na +) concentration, we replaced the mixed alkali (NaHCO₃ and Na₂CO₃) with 75, 100, 150, and 200 mM NaCl solutions and conducted similar treatments in neutral pH soil. The results showed that as salt stress intensified, both NILs became sensitive to high NaCl levels, with significant decreases in the relative survival rate and fresh weight of individual NIL lines. However, no significant differences were observed between the two NIL lines under varying salt stress conditions (P>0.05) (Figures 5D-F). This result suggests that the AT1 / at1-related stress phenotype is more likely an alkali-specific response rather than a salt stress response.

[0171] To confirm this possibility, we generated additional transgenic sorghum plants in the wheatland background (SbWT, containing the complete wild-type (WT) SbAT1 gene, a gift from the USDA, Population genomic and genome-wide association studies of agroclimatic traits in sorghum. (2013). Proceedings of the National Academy of Science of the United States of America 110:453-458.): overexpressing the SbAT1 gene or knocking out the SbAT1 gene by gene editing technology. Overexpression or knockout was confirmed by qRT-PCR or sequence analysis (Figure 5G). Unexpectedly, we found that the alkaline tolerance of plants with SbAT1 overexpression (SbAT1-OE) was reduced, while that with SbAT1 knockout (SbAT1) was reduced. ko ) plants showed greatly improved alkali tolerance (Figure 5H-J, Figure 6D-F). Under 75mM mixed alkali stress, the survival rate of SbAT1 overexpression (SbAT1-OE) plants was 13.95% lower than that of Wheatland plants (i.e., SbWT plants), while SbAT1 gene knockout (SbAT1 ko ) plants had a 17.93% higher survival rate than Wheatland plants (i.e., SbWT plants) (Figure 5F). The phenotypes of these transgenic plants prompted us to reconsider the functionality of the SbAT1 C-terminal mutation in the context of natural variation (Figures 3C-D), suggesting that the truncated mutant protein (at1) may play a negative role in alkaline tolerance. To confirm our hypothesis, we first transiently expressed two GFP fusion proteins, SbAT1-GFP and Sbat1-GFP, in plant cells to detect the protein state with higher protein accumulation (Figure 5K), indicating the translational competence of the mutant at1 gene.

[0172] Field trials

[0173] To further verify the conclusions, field experiments were conducted under saline-alkali stress conditions in a natural environment. The two sorghum NIL materials were planted in fields under low alkaline stress (pH 8.13, total salt content 7.68‰, alkalinity 10.71%) and high alkaline stress (pH 9.07, total salt content 3.18‰, alkalinity 20.92%), respectively. It was found that under low alkaline stress and high alkaline stress, the NIL-AT1 material grew better than the NIL-at1 material. The field experiment results (Figure 7) were consistent with the greenhouse results.

[0174] To adapt to actual production conditions, field trials were conducted from April to October 2020 in Huiwei Village (38°57′29″N, 106°32′39″E, 1090m above sea level) and Dongfeng Village (38°56′20″N, 106°35′26″E, 1100m above sea level), both located in abandoned saline-alkali land areas of Pingluo County, Shizuishan City, Ningxia Hui Autonomous Region, China. The area is adjacent to the Yellow River and has abundant water resources, making it suitable for agricultural development. However, due to natural and human factors such as long-term flooding, high groundwater levels, high evaporation, and unreasonable fertilization, the soil in the irrigation area has become severely salinized, and agricultural land has also experienced varying degrees of secondary salinization. A single-factor completely randomized block design was used, with three replicates in each plot, totaling six plots. The plot length was 7m, the row width was 5m, the row spacing was 0.6m, the plant spacing was 0.2m, the aisle spacing was 0.8m, and the plot area was 35m2. 2 . Double-seed hole sowing was used with a sowing depth of about 3 cm. Before sowing, seeds with full grains and uniform size were selected, basal fertilizer (N: P2O5: K2O = 15:15:15) was applied, and the land was raked and leveled. Management projects such as intertillage, weeding and fertilization were carried out on time throughout the growth period. The physical and chemical properties of the test soil are shown in Figures 8A and B. Due to the uneven distribution of saline-alkali land and the existence of "alkali spots", we found that the growth of sorghum in different plots was quite different, but the overall trend was consistent, showing that the growth state of NIL-AT1 was better than that of NIL-at1, and the seedling rate statistics of the six plots showed that NIL-AT1 far exceeded NIL-at1 (P < 0.05) (Figures 8C and D).

[0175] The method used in this embodiment is as follows:

[0176] (I) Construction of sorghum AT1 gene overexpression vector

[0177] The plant expression vector pCAMBIA2300-Ubi-Myc is preserved by our laboratory (see Liu Y, Sun J, Wu Y. Arabidopsis ATAF1 enhances the tolerance to salt stress and ABA in transgenic rice. J Plant Res. 2016 Sep; 129(5): 955-962. doi: 10.1007 / s10265-016-0833-0. Epub 2016 May 23. PMID: 27216423, wherein the vector described in lines 1-3 of Constructs and transformation in Materials and methods on the right column of page 2, i.e., a recombinant vector in which the Ubi promoter and OCS terminator are added to the pCAMBIA2300 commercial vector and also carries a Myc tag sequence, is available to the public from the applicant for replication of the present invention). First, the vector was linearized using restriction endonucleases Spe I and BamH I (both purchased from New England Biolabs) in a PCR instrument at 37°C for 2 hours. Next, the CDS coding region of the sorghum AT1 gene (nucleotide sequence shown in SEQ ID NO:3) with a stop codon was amplified using adapter-containing primers to obtain the adapter-containing target fragment. The resulting adapter-containing target fragment (gene fragment) and the linearized vector were ligated using the pEASY-Uni Seamless Cloning and Assembly Kit (CU101-01). The ligation reaction system (10 μL) of the seamless cloning kit was as follows: 5 μL of 2× Assembly Mix, the linearized vector and the adapter-containing target fragment were mixed in a 1:2 molar ratio, and ddH2O was added to make up to 10 μL. After gentle mixing, the reaction was incubated at 50°C for 15 minutes. After the reaction is completed, place the centrifuge tube on ice to cool for a few seconds. Then, the recombinant product can be transformed into Escherichia coli XL1-Blue, the plasmid can be extracted, and the positive clone recombinant plasmid pCAMBIA2300-Ubi-Myc-AT1 can be confirmed by enzyme digestion and sent to Ruibo Company for further sequencing verification.

[0178] (II) Obtaining plants overexpressing the AT1 gene

[0179] Obtaining recombinant Agrobacterium

[0180] 1 μg of the prepared recombinant vector plasmid pCAMBIA2300-Ubi-Myc-AT1 was used to transform competent cells of Agrobacterium tumefaciens EHA105. The positive bacteria obtained by PCR identification were named recombinant Agrobacterium tumefaciens EHA105 / pCAMBIA2300-Ubi-Myc-AT1 and stored at -80°C.

[0181] Recombinant Agrobacterium EHA105 / pCAMBIA2300-Ubi-Myc-AT1 contains the CDS nucleotide sequence of the sorghum AT1 gene (SEQ ID NO: 3)

[0182] Obtaining Sorghum AT1 Gene Overexpressing Plants

[0183] The recombinant Agrobacterium EHA105 / pCAMBIA2300-Ubi-Myc-AT1 was transformed into the recipient material Wheatland of sorghum through Agrobacterium-mediated method.

[0184] The sorghum genetic transformation method is as follows:

[0185] (1) Preparation of sorghum recipient material:

[0186] Wheatland sorghum plants were grown in a greenhouse. When the plants reached the 15th day of flowering, the ears were cut and the immature embryos in the grains were squeezed out as much as possible in a sterile laminar flow hood and evenly placed on callus culture medium for callus tissue culture.

[0187] (2) Preparation of infection solution:

[0188] Recombinant Agrobacterium stored at -80°C was streaked onto YEP solid medium supplemented with Kan. A single colony was inoculated into 10 mL of YEP liquid medium (containing Kan) for primary activation (28°C, 220 rpm, shaken overnight). The activated culture was inoculated into 80 mL of YEP liquid medium (containing Kan) at a ratio of 1:1000 and cultured at 28°C, 220 rpm, with shaking until the OD600nm reached 0.8-1.0.

[0189] (3) Infection process: Transfer the Agrobacterium culture solution that has reached the desired OD value to a 50 mL centrifuge tube and centrifuge at 5000 rpm for 10 min to enrich the cells. Then, fully resuspend the cells in resuspension buffer and add the grown callus to the resuspended infection solution for infection and transformation. The infected callus is transferred to differentiation and regeneration medium. After regeneration, the callus is transferred to rooting medium (containing Kan) for rooting culture. If the medium browns, multiple transfers of the rooting medium are required.

[0190] (4) Transplant the transformed T0 generation sorghum seedlings with a plant height of about 5-7 cm and good root growth into the soil, cultivate them in a greenhouse, and maintain a certain humidity to ensure the survival rate of the regenerated seedlings. After they are cultivated to maturity, the mature seeds are harvested, which are the T0 generation transgenic seeds.

[0191] (III) Construction of AT1 gene mutant plants

[0192] Construction of recombinant CRISPR-Cas9 vector

[0193] The AT1 gene was knocked out in the sorghum recipient material variety Wheatland using gene editing technology. The original vector for CRISPR-Cas9 gene editing in monocot plants, including the gRNA expression cassette pYLsgRNA-OsU6a / LacZ vector and the CRISPR-Cas9 vector pYLCRISPR / Cas9Pubi-B, was kindly donated by Professor Liu Yaoguang of South China Agricultural University (Ma X, Zhang Q, Zhu Q, et al.. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant. 2015 Aug;8(8):1274-84. doi:10.1016 / j.molp.2015.04.007. Epub 2015 Apr 24. PMID:25917172.).

[0194] Obtaining AT1 gene mutant plants

[0195] First, a bacterial strain containing the pYLsgRNA-OsU6a / LacZ vector and the CRISPR-Cas9 vector pYLCRISPR / Cas9Pubi-B was activated and plasmids were extracted. Next, a target linker was prepared and the sgRNA vector was digested and then ligated to the sgRNA expression cassette. The sgRNA target nucleotide sequence is 5'-ACGCCTGAAAAGTTGACAGCTG-3', targeting positions 2317-2338 of SEQ ID NO:1 in the AT1 gene. The specific steps are as follows:

[0196] 1) Activation of bacterial strains and plasmid extraction and preparation: The pYLCRISPR / Cas9Pubi-B strain (TOP10F) and the pYLsgRNA-OsU6a / LacZ strain (DH10B) were streaked and cultured overnight on a plate containing kanamycin (25 μg / mL) and ampicillin (50 μg / mL), respectively. Single colonies were picked and expanded for plasmid extraction.

[0197] 2) Target Adapter Preparation: Dissolve the designed and synthesized adapter primers AT1-Target-F: 5'-GCCGCAAGTCGCCGCCTGCCTCGC-3' and AT1-Target-R: 5'-AAACGCGAGGCAGGCGGCGACTTG-3' in ddH2O to a 100 μM stock solution. Mix the left and right primers and dilute to a final concentration of 1 μM. Heat in a PCR instrument (approximately 90°C for 30 seconds) and cool to room temperature to complete annealing and form a double-stranded target adapter.

[0198] 3) Enzyme digestion of sgRNA vector: 1 μg of pYLsgRNA-OsU6a / LacZ plasmid was digested with 10 U of Bsa I in 25 μL of enzyme digestion reaction system ( for 20 min) to obtain the digested plasmid, which was then stored frozen.

[0199] 4) sgRNA expression cassette ligation reaction: Ligation reaction between the digested plasmid and the corresponding double-stranded target adapter (10 μL system): 1 μL 10× T4 DNA ligase buffer, 10 ng of digested plasmid, 0.05 μM double-stranded target adapter, 18 U T4 DNA ligase, and make up to 10 μL with ultrapure water; ligation was carried out at room temperature for 20 min.

[0200] 5) First-round amplification: In a 15 μL reaction system, 0.5 μL of the ligation product was used as a template, using 0.2 μM each of the forward primer UF: 5'-CTCCGTTTTACCTGTGGAATCG-3' and the adapter reverse primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3', and 1 μL of KOD Fx Neo enzyme. The PCR program was as follows: 30 cycles of 94°C for 10 s, 60°C for 15 s, and 68°C for 20 s.

[0201] 6) Second Round Amplification: Dilute the first-round PCR product 10-fold and use 1 μL as the template for the second round of PCR. Use the appropriate amount of KOD Fx Neo enzyme, forward primer B1': 5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3', and reverse primer BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3'. Amplify for 30 cycles: 95°C for 10 seconds, 58°C for 15 seconds, and 68°C for 20 seconds. Determine the size of the target band (831 bp) by running on a gel and purify by ethanol precipitation. The resulting PCR product is the sgRNA containing the OsU6a promoter: OsU6a-sgRNA.

[0202] 7) Digest approximately 2 μg of pYLCRISPR / Cas9Pubi-B plasmid with an enzyme digestion system (30 U Bsa I) for 2 hours, then recover the digested plasmid fragments by DNA gel electrophoresis. Add 100 ng of Bsa I-digested pYLCRISPR / Cas9Pubi-B plasmid to 20 ng of OsU6a-sgRNA (20 ng), the second-round PCR-purified product from step 6, to a 10 μL ligation reaction, adding 35 U of T4 ligase. Ligate for 2-3 hours using a variable temperature cycle (10°C for 5 minutes, 20°C for 5 minutes, for 10-15 cycles).

[0203] 8) Electroporate 1 μL of the ligation product and transform E. coli DH10B competent cells. After electroporate, add 1 mL of SOC and incubate at 37°C for 2 h. The plating medium is LB (25 μg / mL Kan, 0.5 mM IPTG, and appropriate amount of X-gal). Single colonies are selected and amplified by colony PCR using vector primers SP1: 5'-CCCGACATAGATGCAATAACTTC-3' and SP2: 5'-GCGCGGTGTCATCTATGTTACT-3' for the specific target site. Sequencing revealed that the amplified product, approximately 1 kb in size, contained the OsU6a-sgRNA. The positive clones obtained were the successfully recombined plasmid pYLCRISPR / Cas9Pubi-B-AT1-sgRNA.

[0204] 9) Transform competent Agrobacterium tumefaciens EHA105 cells with 1 μg of the prepared recombinant plasmid pYLCRISPR / Cas9Pubi-B-AT1-sgRNA. Culture the cells in YEP medium (containing 50 mg / L kanamycin) at 28°C for two days. Select positive clones and perform PCR identification using primers SP1 and SP2 as described above. Positive Agrobacterium identified by PCR was designated recombinant Agrobacterium tumefaciens EHA105 / pYLCRISPR / Cas9Pubi-B-AT1-sgRNA and stored at -80°C.

[0205] The obtained positive Agrobacterium was used to infect the callus tissue of sorghum (Wheatland) and millet (Ci846). The genetic transformation steps of sorghum were the same as those in step 4.2.2. The millet recipient material Ci846 was kindly donated by Professor Sui Yi of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (Related literature: Cheng Z, Sun Y, Yang S, Zhi H, Yin T, Ma X, Zhang H, Diao X, Guo Y, Li X, Wu C, Sui Y. Establishing in planta haploid inducer line by edited SiMTL in foxtail millet (Setaria italica). Plant Biotechnol J. 2021 Jun; 19(6): 1089-1091.). The genetic transformation of millet was carried out according to the millet genetic transformation method described in the following patent document: Methods for obtaining embryonic callus tissue and genetic transformation of millet for genetic transformation, Publication No. CN108588002A.

[0206] The specific steps are as follows:

[0207] (1) Disinfection of millet embryos: Disinfect the mature embryos of millet seeds in 10% sodium hypochlorite solution for 10-15 minutes, then rinse them repeatedly with sterile water for 3-5 times, and finally dry them with absorbent paper for later use.

[0208] (2) Induction of primary callus of millet: Callus of mature embryos from seeds was induced on induction medium and cultured in the dark at 28°C for about 30 days.

[0209] (3) Preparation and large-scale expansion of millet embryonic callus cell suspension lines: The induced primary callus tissue was transferred to a suspension culture medium for suspension culture at 28-30°C on a shaker at 150 rpm. During the culture process, browned tissue was removed, and cells with good embryonic status were selected and expanded to obtain a large amount of embryonic cell callus tissue.

[0210] (4) Agrobacterium-mediated genetic transformation of millet embryonic cells: recombinant Agrobacterium EHA105 / pYLCRISPR / Cas9Pubi-B-AT1-sgRNA was activated in advance, the prepared callus tissue was co-cultured with Agrobacterium on the pre-culture medium, and the co-cultured callus tissue was transferred to the screening medium containing the corresponding resistance for subculture. After three subcultures, the resistant callus was transferred to the differentiation and regeneration medium until seedlings grew.

[0211] (5) The seedlings are transferred to a rooting medium for rooting culture. After a relatively strong root system is grown, they are transplanted into the soil and cultured in a greenhouse. In the later stage of growth, positive seedlings are identified as transgenic T0 generation plant seedlings, and T0 generation seeds are harvested.

[0212] After obtaining transgenic T0 plants, targeting efficacy testing is performed. PCR amplification is performed using primers synthesized approximately 200-300 bp on either side of the target site. Sequencing primers are designed approximately 150-250 bp upstream of the target site, and the PCR product is directly sequenced. Plants with no overlapping peaks near the target site are considered wild-type or homozygous for the AT1 gene mutation. Plants with double peaks near the target site are positive for the AT1 gene mutation.

[0213] The genomic DNA of sorghum transgenic T0 plants and Wheatland (wild-type sorghum) were used as templates, and PCR amplification of genomic DNA fragments including the splicing site was performed, and the amplified products were sequenced to detect the knockout of the AT1 gene. It was previously predicted that amino acids 22 to 88 at the N-terminus of the AT1 protein in sorghum (amino acids 22-88 of SEQ ID NO: 4) are highly conserved domains. CRISPR-Cas9 transgenic plants were PCR amplified using primers F: 5'-GTTGACAGCTGAACACATGGCT-3' and R: 5'-ATACATCGTTAGGAATGGATCCG-3', and CRISPR-Cas9 transgenic plants whose sequencing results showed that the AT1 gene was edited, resulting in loss of AT1 gene function, were selected. The transgenic plants with the edited AT1 gene were named AT1 KO (Figure 9C) AT1 gene deletion AT1 KO Comparison of the amplification products of primers F and R of the plant with those of wild-type sorghum Wheatland showed that the AT1 gene was missing. KO The plant lost a base T in the corresponding region of the AT1 gene (nucleotide 129 of SEQ ID NO: 3 mutated), and caused a truncated protein to be produced in the corresponding region of the AT1 protein (amino acid 43 of SEQ ID NO: 4 mutated, resulting in the premature termination of subsequent translation), destroying the conserved domain (Figure 9C), thereby knocking out the AT1 gene. KO The coding sequence expressed in the plant is shown in SEQ ID NO: 11, and the amino acid sequence of the protein is shown in SEQ ID NO: 12.

[0214] It was previously predicted that the N-terminal amino acids 25-91 of the foxtail millet SiAT1 protein (SEQ ID NO: 8) also encode a conserved domain, the corresponding coding sequence of which is shown in the nucleotide sequence 73-273 of SEQ ID NO: 7. The foxtail millet SiAT1 mutant plant obtained using the same gene editing method as above was named SiAT1 KO ( FIG16C ), foxtail millet SiAT1 KO A base T was inserted between nucleotides 14 and 15 of SEQ ID NO: 7 (wild-type SiAT1 gene), causing a frameshift mutation, generating a 42-amino acid peptide segment, and terminating protein translation prematurely. Therefore, the gene-edited material is a material in which the conserved domain of AT1 protein is completely missing (Figure 10). KO The coding sequence of AT1 expressed in the plant is shown in SEQ ID NO: 13, and the amino acid sequence of the protein is shown in SEQ ID NO: 14.

[0215] Among them, the nucleotide sequence of the sgRNA target of the foxtail millet SiAT1 gene is 5'-TATAATGGCTGCTGCGCCGG-3', targeting positions 393-412 of the SiAT1 gene, i.e., SEQ ID NO: 5; the adapter primers used in the preparation of the target adapter are SiAT1-Target-F: 5'-GGCGTATAATGGCTGCTGCGCCGG-3' and SiAT1-Target-R: 5'-AAACCCGGCGCAGCAGCCATTATA-3'.

[0216] After positive transgenic plants are screened for in the T0 generation of sorghum, they are self-pollinated to obtain T1 plants. After harvest, the T1 generation is again identified using primers F and R. PCR products are sequenced, and those plants that confirm the target site is edited and sequence as a single peak are retained as homozygous plants. These plants are then PCR amplified using the final primers SP1: 5'-CCCGACATAGATGCAATAACTTC-3' and SP2: 5'-GCGCGGTGTCATCTATGTTACT-3'. If no amplification product is obtained, it indicates that the Cas9 gene has been screened out and can be used in subsequent experiments. After screening, homozygous T1 plants are self-pollinated to obtain homozygous T2 plants.

[0217] Through gene editing technology, the homozygous strain SbAT1, which caused a premature termination mutation at the target site and was separated by the CRISPR-Cas9 vector, was identified and screened in the T2 generation of transgenic sorghum and millet. KO and SiAT1 KO .

[0218] Example 2. Application of sorghum and millet resistant plants produced by genetic transformation of AT1 gene

[0219] Identification of positive transgenic sorghum and millet plants and observation of salt-alkali tolerance phenotypes during germination

[0220] A total of 54 seedlings were obtained from the T0 generation of AT1-MYC-overexpressing transgenic sorghum. PCR analysis identified 12 T0 transgenic-positive plants. Quantitative PCR confirmed that 10 of these lines (designated AT1-MYC-3 to AT1-MYC-12) expressed significantly higher AT1 gene expression than wild-type wheatland, with fold increases ranging from 92 to 303 (Figure 9B). SbEIF was used as an internal reference gene. Next, to select appropriate concentrations for evaluating the alkali tolerance of the successfully constructed transgenic sorghum and millet, three alkali concentration gradients (50 mM mixed alkali solution, 75 mM mixed alkali solution, and 100 mM mixed alkali solution) were established, along with a control (water treatment). All seeds used in the experiments were grown, harvested, and stored under the same conditions. Seeds were sown in a 1:1 mixture of vermiculite and nutrient soil, with 12 seeds per hole. The soil was then covered with a 2 cm layer of soil, leveled with the surface of the tray, and replicated twice. Next, the soil was saturated with the treatment solution (water or alkaline solution) as the treatment, while the control was irrigated with plain water. The seedlings were placed on a flat surface to allow for thorough and even absorption of the solution into the soil. The seedlings were then placed in a model plant glasshouse (seedling growth environment: 28°C / 22°C day / night temperature, 16h / 8h light / dark cycle, and 60% to 70% relative humidity). The soil was then topped up with plain water. Each treatment was repeated three times. Seeds were considered germinated when the embryo emerged from the soil surface. Survival rate = number of seedlings (14 days) / number of test seeds × 100%; relative survival rate = survival rate of the alkali treatment / survival rate of the corresponding control × 100%. Data were statistically analyzed as follows: Excel 2016 was used for data organization and charting. DPS 7.5 software was used for statistical analysis. The results were analyzed using the least significant difference (LSD) method and one-way analysis of variance (ANOVA). If P < 0.05, the data are marked with lowercase letters, indicating significant differences; if P < 0.01, the data are marked with uppercase letters, indicating extremely significant differences.

[0221] By observing the growth of the plants after alkali treatment and analyzing the relative seedling rates, we concluded that the phenotypic variation was greatest when treated with 75 mM mixed alkali, making this concentration suitable for subsequent phenotypic identification (Figure 11). In Figure 11, Sorghum represents sorghum, and Millet represents foxtail millet.

[0222] Among them, the preparation method of 50mM mixed alkali solution (molar ratio of NaHCO3:Na2CO3 of 5:1) is to weigh 12.32g NaHCO3 and 3.11g Na2CO3 and dissolve them in 2 liters of water. The pH of the solution is 10.03. After the soil fully absorbs the solution, the pH value of the soil is 9.19; the preparation method of 75mM mixed alkali solution (molar ratio of NaHCO3:Na2CO3 of 5:1) is to weigh 18.48g NaHCO3 and 4.66g Na2CO3 and dissolve them in 2 liters of water. The pH value of the solution is 10.04. After the soil fully absorbs the solution, the pH value of the soil is 9.32; the preparation method of 100mM mixed alkali solution (molar ratio of NaHCO3:Na2CO3 of 5:1) is to weigh 24.64g NaHCO3 and 6.22g Na2CO3 and dissolve them in 2 liters of water. The pH value of the solution is 10.03. After the soil fully absorbs the solution, the pH value of the soil is 10.10.

[0223] Phenotypic observation results showed that under normal growth conditions of control (CK), wild-type sorghum Wheatland, sorghum AT1 gene overexpression line AT1-OE and sorghum AT1 gene deletion mutant line AT1 KO There was no significant difference in survival rate between wild-type foxtail millet Ci846 (SiWT in Figure 12B), foxtail millet SiAT1 gene overexpression SiAT1-OE and deletion mutant line SiAT1 KO There was no significant difference in survival rate between the two groups (Figure 12B); the sorghum AT1-OE line under 75 mM mixed alkali treatment (soil pH 9.32) was extremely sensitive to alkali, while the sorghum mutant AT1 with gene function loss was KO and foxtail millet mutant SiAT1 KO Both strains showed increased salt-alkali tolerance compared to wild-type sorghum Wheatland and foxtail millet Ci846 (Figures 6E-F and 12B-C). These results indicate that SbAT1 in sorghum and SiAT1 in foxtail millet are indeed important genes that negatively regulate salt-alkali tolerance in sorghum and foxtail millet, and that mutations in their N-terminal GGL conserved domains (SEQ ID NO:15) contribute to improved salt-alkali tolerance in sorghum and foxtail millet.

[0224] Furthermore, the results in Examples 1 and 2 demonstrate that, relative to the wild-type AT1 protein (SEQ ID NO: 1), which has 198 amino acids, the at1 in the NIL-at1 mutant, whose C-terminus is truncated to retain only 136 amino acids (SEQ ID NO: 10), corresponds to a naturally occurring variant allele of AT1. Analysis of near-isogenic lineage material revealed that, despite lacking the C-terminus but retaining an intact N-terminal GGL domain, at1 exhibited significantly reduced alkali tolerance compared to wild-type AT1. Therefore, all of the above results in Examples 1 and 2 demonstrate that the AT1 protein in the grass crops sorghum and millet is a key factor in negatively regulating alkali tolerance, and that gene editing and knocking out the AT1 gene can improve the crops' salt and alkali tolerance.

[0225] To further confirm the above observations, we generated transgenic plants in which a stop codon was generated at the same position as in sorghum by gene editing to mimic the potential C-terminal truncation of SiAT1 in foxtail millet. 102 We also generated SiAT1 overexpressing a truncated C-terminus. 124 (SiAT1 124 -OE) plants and SiAT1 knockout plants (SiAT1 ko )(Figure 12A, Figure 13A-B).

[0226] The use of foxtail millet for testing in this example was based on the following considerations: (1) foxtail millet plant transformation is easier and faster than sorghum, (2) foxtail millet and sorghum are closely related taxonomically, with high genomic similarity and similar environmental physiological behaviors, and (3) the single copy foxtail millet SiAT1 shares 75.24% identity with sorghum SbAT1 at the protein level.

[0227] Similar to the results with transgenic sorghum, knockout of the SiAT1 gene produced plants with higher tolerance to alkaline conditions, as shown by the SiAT1 knockout compared to other genotypes. ko Higher survival rates were observed in the plants (Figure 12B-C). In contrast, the C-terminally truncated transgenic millet (SiAT1 102 Millet plants expressing either a C-terminally truncated SiAT1 (SiAT1124-OE) or overexpressing a C-terminally truncated SiAT1 (SiAT1124-OE) exhibited reduced alkaline tolerance under alkaline stress, with SiAT1124-OE plants showing the weakest growth response to alkalinity (Figures 12B-C, Figure 13C). This result suggests that C-terminally truncated proteins can be expressed in plants and that increased amounts of these proteins negatively affect alkaline tolerance, while knocking out AT1 positively impacts plant alkaline tolerance. In conjunction with the AT1 overexpression phenotype observed in sorghum, we conclude that AT1 plays a negative regulatory role in alkaline tolerance in both sorghum and millet, and that at1 mutations enhance this negative regulatory effect.

[0228] Example 3. Similar effects of AT1 homologous genes in rice and maize

[0229] We further investigated the role of AT1 homologs in alkaline tolerance in other major monocot crops, rice and maize. The ortholog of AT1 in rice has been identified as OsGS3, a major QTL for grain size regulation (H. Mao, S. Sun, J. Yao, C. Wang, S. Yu, C. Xu et al., Linking differential domain functions of the GS3 protein to natural variation of grain size in rice. Proc. Natl. Acad. Sci. USA 107, 19579-19584 (2010). doi: 10.1073 / pnas.1014419107; C. Fan, Y. Xing, H. Mao, T. Lu, B. Han, C. Xu et al., GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein.Theor.Appl.Genet.112,1164-1171(2006).doi:10.1007 / s00122-006-0218-1).

[0230] The complete rice GS (GS3-1) protein sequence is shown in SEQ ID NO: 16, the rice GS3 C-terminal truncated protein (GS3-4) sequence is shown in SEQ ID NO: 17, and the corn GS3 protein sequence is shown in SEQ ID NO: 18.

[0231] We found that in alkaline soil (75 mM mixed alkali, pH 9.0-9.2), overexpression of intact OsGS3 (OsGS3-1OE) and a C-terminally truncated version of OsGS3 (OsGS3-4OE) exhibited lower alkaline tolerance, while knockout of OsGS3 (OsGS3 koRice plants expressing OsGS3 or RNAi OsGS3 (OsGS3Ri) showed enhanced alkali tolerance compared to ZH11 wild-type rice (OsWT) in terms of relative survival rate, plant growth measured by relative plant height and relative chlorophyll content (Figures 12D-F and 13D-F). In transgenic plants, the relative survival rates of OsGS3-1OE and OsGS3-4OE were 12.5% ​​and 26.4% lower than those of OsWT, respectively, while OsGS3 ko The relative survival rates of OsGS3 and OsGS3Ri were 8.3% and 7.4% higher than those of OsWT, respectively (Figure 12F). These results indicate that inhibiting the function of rice OsGS3 can enhance alkaline tolerance and suggest that the Gγ subunit has a conserved function. Furthermore, by manipulating or selecting for nonfunctional alleles of OsGS3, we can enhance alkaline tolerance in rice.

[0232] The maize homolog of AT1 was previously identified as ZmGS3 (Q. Li, X. Yang, G. Bai, ML Warburton, G. Mahuku, M. Gore et al., Cloning and characterization of a putative GS3 ortholog involved in maize kernel development. Theor. Appl. Genet. 120, 753-763 (2010). doi: 10.1007 / s00122-009-1196-x). Therefore, we named this gene AT1 / GS3 and used the prefix to indicate the species; AT1 and GS3 can also be used alone or interchangeably depending on the context. By gene editing the maize line KN5585 (ZmWT), we obtained the maize ZmGS3 knockout (ZmGS3) ko ) strain. Maize ZmGS3 ko A 34-bp deletion and a base mutation occurred in the first exon of ZmGS3. These mutations resulted in frameshift mutations and premature translation termination of the predicted protein (Figure 13G). After alkaline treatment, the growth performance of the knockout maize plants on the 14th day of culture showed that they had stronger alkaline tolerance than wild-type maize (Figures 12G-H, Figure 13H). After 50 days of alkaline stress treatment, the phenotypic differences between the two were more significant; almost all wild-type maize seedlings died, while ZmGS3 ko The cells survived and continued to grow (Figure 12I, Figure 13I). This result supports the conclusion that ZmGS3 ko It can improve the alkaline tolerance of corn, similar to what we have observed in sorghum, millet and rice.

[0233] The method of this embodiment is as follows:

[0234] Functional study of GS3 gene regulating alkaline tolerance

[0235] 3.1 Construction of transgenic plants overexpressing the GS3 gene

[0236] Primers were designed based on the rice genome annotation information (the GS3 genome sequence is shown in SEQ ID NO: 19). Using the full-length cDNA of GS3 from the rice variety Guangluai (Osigcea013f09t3) as a template, two GS3 alleles, GS3-1 and GS3-4, were amplified, with sizes of 696 bp (shown in SEQ ID NO: 20) and 450 bp (shown in SEQ ID NO: 21), respectively.

[0237] In order to amplify the cDNA of the GS3 gene coding region, the present invention designed the following primers:

[0238] Forward primer of GS3OEF (SEQ ID NO: 36): 5′-ggtaccACCATGGCAATGGCGGCGGCGCCC-3′ (the underlined sequence is the Kpn I recognition site);

[0239] GS3-1OER reverse primer (SEQ ID NO: 37): 5′-agatctCAAGCAGGGGGGGCAGCAACG-3′ (the underlined sequence is the BglII recognition site);

[0240] GS3-4OER reverse primer (SEQ ID NO: 38): 5′-agatctACGCCGCCCCACATGAGGA-3′ (the underlined sequence is the BglII recognition site);

[0241] PCR amplification was performed using primer combinations GS3OEF, GS3-1OER and GS3OEF, GS3-4OER to obtain the target fragments GS3-1 and GS3-4, respectively. The total PCR reaction volume was 50 μl, containing 2 μl of cDNA template, 25 μl of 2× GC I buffer, 5 μl of 10 mM dNTPs, 1 μl each of 10 mM primers GS3OEF and GS3OER, 1 μl of ExTaq enzyme, and deionized water to 50 μl (2× GC I buffer, dNTPs, and rTaq enzyme were purchased from Takara Biotechnology (Dalian) Co., Ltd.). PCR reaction conditions were as follows: ① 94°C for 4 minutes, ② 94°C for 30 seconds, ③ 58°C for 30 seconds, ④ 72°C for 1 minute, ⑤ 33 cycles from ② to ④, ⑥ 72°C for 7 minutes, and ⑦ storage at 25°C. PCR products were analyzed by electrophoresis on a 1% (w / v) TBE agarose gel. DNA fragments of 696 bp for GS3-1 (681 bp target DNA segment plus two 15 bp restriction enzyme sites attached to the primers) and 462 bp for GS3-4 (447 bp target DNA segment plus two 15 bp restriction enzyme sites attached to the primers) were recovered. These fragments were then constructed into the commonly used overexpression vector pCAMBIA1301U (adapted in our laboratory: its basic framework is based on pCAMBIA1301 from the Australian CAMBIA Laboratory (http: / / www.cambia.org / daisy / cambia / materials / overview.html), with the addition of the Ubi promoter to regulate gene expression). These fragments were then transformed into rice Zhonghua 11 (ZH11) to generate overexpressing plants GS3-1OE and GS3-4OE.

[0242] The carrier structure is shown in FIG14A .

[0243] 3.2 Construction of RNAi interference plants

[0244] Construction of an RNAi vector for suppressing GS3 expression was performed in two steps. First, a plasmid containing the full-length GS3 cDNA (osigcea013f09t3) was double-digested with BamHI and KpnI and ligated to the modified dsRNAi1301, generating a vector containing the first-strand (forward) GS3. Simultaneously, the BamHI and KpnI digestion product was ligated to the intermediate vector GZ-1 (provided by Dr. Ding Xinhua in our laboratory), followed by double-digestion with SacI and SpeI. The product was then ligated to the dsRNAi1301 containing the first-strand (also double-digested with SacI and SpeI), ensuring that the two identical sequence fragments were oriented in opposite directions. Driven by the 35S promoter, the plasmid was transformed into Zhonghua11 to generate the transgenic plant GS3-1RNAi, which suppresses expression. A schematic diagram of the vector structure is shown in Figure 14B.

[0245] The method of knocking down the expression of the GS3 gene or protein in plants by using RNA interference is preferably to insert the coding sequence of the plant GS3 gene into pDS1301 in the forward and reverse directions respectively, and transform the obtained recombinant vector into the plant to obtain a plant with reduced expression of the GS3 gene or protein. The method of inserting the GS3 gene into the pDS1301 vector is preferably completed by enzyme digestion. When inserting in the forward direction, KpnⅠ and BamHI are used for double enzyme digestion and ligation. When inserting in the reverse direction, SacⅠ and SpeⅠ are used for double enzyme digestion and ligation. When the coding sequence of the GS3 gene is inserted in the forward direction, the nucleotide sequence is shown in SEQ ID NO:34, and when the coding sequence of the GS3 gene is inserted in the reverse direction, the nucleotide sequence is shown in SEQ ID NO:35. The pDS1301 vector was modified in our laboratory (see prior art: Yuan B, Shen X, Li X, Xu C, Wang S (2007) Mitogen-activated protein kinase OsMPK6 negatively regulates rice disease resistance to bacterial pathogens. Planta 226:953–960); its basic framework is pCAMBIA1301 from the Australian CAMBIA laboratory (http: / / www.cambia.org / daisy / cambia / materials / overview.html), and the expression of the transformed gene is regulated by adding the 35S promoter.

[0246] 3.3 Expression level detection of overexpression and suppressed expression transgenic plants

[0247] (1) RNA was extracted from 1 cm long spikelets of GS3-1OE, GS3-4OE, GS3-1RNAi and wild-type plants at the spikelet differentiation stage. The RNA extraction reagent was purchased from the Trizol extraction kit produced by Invitrogen (the specific operation steps were carried out according to the instructions provided by the kit).

[0248] (2) Reverse transcription to synthesize the first strand of cDNA

[0249] Here are the steps:

[0250] ① Take 3 μg of extracted total RNA, add 1 μl of DNase I, 1 μl of 10× DNase I buffer, and add DEPC (diethyl pyrocarbonate, a strong inhibitor of RNase, working concentration is 0.01%) treated water to 10 μl, mix well and let it stand at room temperature for 15 minutes to remove residual genomic DNA;

[0251] ② Add 1 μl of 0.2 M EDTA and incubate in a 65°C water bath for 10 min to inactivate DNase I.

[0252] ③Add oligo(dT) 15 1 μl of primer was added and incubated in a 65°C water bath for 10 min to disrupt the secondary structure of RNA, and then placed on ice for 2 min;

[0253] ④ Add 4 μl of 5× first-strand buffer, 2 μl of 0.1 M DTT (dithiothreitol), 1 μl of 10 mM dNTP mixture, and 1 μl of reverse transcriptase, mix well, and incubate in a 42°C water bath for 1.5 h;

[0254] ⑤ After the reaction is completed, place the reverse transcription product in an 85°C dry bath for 10 minutes to inactivate the reverse transcriptase;

[0255] ⑥ Add 80 μl of water to the reverse transcription product, mix well, and store the final product at -20°C. All reagents used in the reaction were purchased from Invitrogen.

[0256] (3) The obtained reverse transcription product was detected by real-time PCR. The GS3 gene detection primers were GS3QRT-F and GS3QRT-R, and the Ubiquitin gene (LOC_Os03g13170) was used as an internal reference (primer combination was UbiQRT-F and UbiQRT-R). The sequence is shown below:

[0257] GS3QRT-F:5'-CCGCGAGATCGGATTCC-3' (SEQ ID NO:39);

[0258] GS3QRT-R:5'-CGTGGATCCCTTCGATTGA-3' (SEQ ID NO:40);

[0259] UbiQRT-F:5'-AACCAGCTGAGGCCCAAGA-3' (SEQ ID NO:41);

[0260] UbiQRT-R: 5'-ACGATTGATTTAACCAGTCCATGA-3' (SEQ ID NO: 42).

[0261] A 10 μL reaction system was used, containing 1 μL of reverse transcription product, 0.3 μL of forward and reverse primers, and 5 μL of FastStart Universal SYBR Green Master. The reaction was made up to 10 μL with water. The reaction procedure was as follows: ① 95°C for 10 min, ② 95°C for 10 s, ③ 60°C for 30 s, and ④ 40 cycles of ②-③. Relative expression levels were calculated based on the CT value.

[0262] Real-time PCR results showed that the target gene expression levels in rice plants GS3-1OE and GS3-4OE were significantly increased compared to wild-type ZH11, while the target gene expression levels in GS3 RNAi plants were significantly decreased compared to wild-type ZH11, as shown in Figure 14C.

[0263] 3.4 Experiment on the regulation of alkali resistance of GS3 gene

[0264] The transgenic plants overexpressing the GS3 gene and those with reduced GS3 expression were treated with alkali, and their main agronomic traits were compared with those of non-transgenic recipients. Specifically, the alkali treatment experiments were conducted using seeds grown under identical conditions, harvested at the same time, and stored under identical conditions.

[0265] Seeds were sown in a soil matrix formed by vermiculite and nutrient soil in an equal volume ratio, with 12 seeds sown per hole. A 2 cm soil layer was then covered and leveled with the dish surface. This was repeated twice. The soil was then irrigated with a treatment solution (water or a 75 mM mixed alkali solution) until saturated, and the control was irrigated with clean water. The soil was placed on flat ground and fully and evenly absorbed into the soil. The seedlings were then placed in a model plant glasshouse (the seedling growth environment was as follows: the day and night temperature was controlled at 28°C / 22°C, the light / dark time was 16h / 8h, and the relative humidity was 60% to 70%). The seedlings were then filled with clean water, and the treatment was repeated three times for each group. When the embryo of the seed emerged from the soil surface, the seed was considered to have germinated. The survival rate and relative survival rate of the plants were calculated according to Formula I and Formula II. Survival rate = number of mature seeds (14 days) / number of test seeds × 100% (Formula I) Relative survival rate = survival rate of alkali treatment / corresponding survival rate of control × 100% (Formula II).

[0266] Data statistics were performed as follows: First, Excel 2016 was used for data organization and charting, and DPS 7.5 software was used for data statistics. The results were analyzed using the least significant difference (LSD) method and one-way analysis of variance (ANOVA). If P < 0.05, the difference is marked with a lowercase letter, indicating a significant difference; if P < 0.01, the difference is marked with an uppercase letter, indicating an extremely significant difference.

[0267] Phenotypic observation results showed that under normal water treatment, there was no significant difference in the survival rate among the wild-type ZH11, the GS3 gene overexpression lines GS3-1OE and GS3-4OE, and the GS3-inhibited expression plant GS3RNAi. However, under treatment with 75 mM mixed alkali solution, the survival rates of GS3-1OE and GS3-4OE transgenic plants decreased by 12.5% ​​and 26.4%, respectively, compared with ZH11. In contrast, the survival rate of GS3RNAi increased by 7.4% (Figure 12F). The above results indicate that GS3 in rice is an important gene that negatively regulates alkali tolerance.

[0268] The results showed that after alkaline stress treatment, the alkaline tolerance of the overexpressing transgenic rice was reduced, while GS3 inhibition significantly improved alkaline tolerance, indicating that GS3 is a previously undiscovered alkaline negative regulatory gene. Therefore, inhibiting protein expression may improve plant alkaline tolerance.

[0269] 3.5 Using CRISPR / Cas9 gene editing to inhibit GS3 protein expression in rice

[0270] A CRISPR / Cas9-based target was designed for the rice GS3 gene, an sgRNA sequence was synthesized, and a DNA fragment encoding the sgRNA sequence was ligated into a CRISPR / Cas vector (for vector information, see: Ma X, Zhang Q, Zhu Q, et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant, 2015, 8(8): 1274-84).

[0271] Two target sites were designed (as shown in SEQ ID NO: 24 and 25), both located in the first exon of GS3 (Figure 15A). The specific construction method of the gene editing vector pYL-Cas9-gRNA-GS3 is as follows:

[0272] (1) Construction of OsU6a-T1-gRNA-polyT and OsU6b-T2-gRNA-polyT fragments

[0273] In the first round of PCR, the pYL-U6a-gRNA plasmid was used as a template, and primers B1' and T1R were used to amplify the OsU6a promoter and the 20bp T1 target sequence of the GS3 gene. Similarly, pYL-U3-gRNA was used as a template, and primers T1F and B2 were used to amplify the GS3 gene T1 target sequence and gRNA-polyT. In the second round of PCR, the first round PCR product was used as a template, and primers B1' and B2 were used to amplify the OsU6a-T1-gRNA-polyT fragment. The same method was used to obtain the OsU6a-T2-gRNA-polyT fragment. In the first round of PCR, the pYL-U6a-gRNA plasmid was used as a template, and primers B2' and T2R were used to amplify the OsU6b promoter and the 20bp T2 target sequence of the GS3 gene. Similarly, pYL-U6b-gRNA was used as a template, and primers T2F and BL were used to amplify the GS3 gene T2 target sequence and gRNA-polyT. In the second round of PCR, the first round PCR product was used as a template, and primers B2' and BL were used to amplify the OsU6a-T2-gRNA-polyT fragment (Error! Reference source not found. 15B).

[0274] The primer sequences used in step 1) are as follows:

[0275] B1':TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3 (underlined Bsa I restriction enzyme cleavage site, SEQ ID NO: 43)

[0276] B2:AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3 (underlined Bsa I restriction enzyme cleavage site, SEQ ID NO: 44)

[0277] B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3 (underlined Bsa I restriction enzyme cleavage site, SEQ ID NO: 45)

[0278] BL:AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3 (underlined Bsa I restriction enzyme cleavage site, SEQ ID NO: 46)

[0279] T1F:AACGGATTCAGCCGGTCTCGGTTTTAGAGCTAGAAATAGCA (target T1 is underlined, SEQ ID NO: 47)

[0280] T1R:CGAGACCGGCTGAATCCGTTTGCCACGGATCATCTGCACA (target T1 is underlined, SEQ ID NO: 48)

[0281] T2F:GGGACTTGAACGGATTCAGCGTTTTAGAGCTAGAAATAGCA (target T2 is underlined, SEQ ID NO: 49)

[0282] T2R: GCTGAATCCGTCAAGTCCCCGGCAGCCAAGCCAGCACCCG (target T2 is underlined, SEQ ID NO: 50).

[0283] The total PCR reaction volume was 50 μl, containing 2 μl of cDNA template, 25 μl of 2× GC I buffer, 5 μl of 10 mM dNTPs, 1 μl each of 10 mM primers GS3OEF and GS3OER, and 1 μl of ExTaq enzyme, with deionized water added to 50 μl (all 2× GC I buffer, dNTPs, and ExTaq enzyme were purchased from Takara Biotechnology Dalian Co., Ltd.). The PCR reaction conditions were as follows: ① 94°C for 4 min, ② 94°C for 30 s, ③ 58°C for 30 s, ④ 72°C for 1 min, ⑤ 33 cycles from ② to ④, ⑥ 72°C for 7 min, and ⑦ storage at 25°C.

[0284] (2) Construction of pYL-Cas9-gRNA-OsGS3

[0285] The PCR fragments of OsU6a-T1-gRNA-polyT and OsU6b-T2-gRNA-polyT and the pYLCRISPR / Cas9-MT vector were ligated into the pYLCRISPR / Cas9-MT vector by BsaI cutting and ligating ( Figure 15C ) to obtain the pYL-Cas9-gRNA-OsGS3 vector, which was then transformed into Zhonghua 11 to obtain the transgenic plant OsGS3. ko .

[0286] 3.6 OsGS3 ko Mutation detection

[0287] Primers were designed at 111 bp upstream and 72 bp downstream of the target site to generate the transgenic plant OsGS3 obtained in Example 2. ko PCR amplification of the DNA was performed and the amplified fragment was sequenced to determine the mutation status of the target site. PCR amplification was performed using the GS3CRJCF / GS3CRJCR primers. The primer sequences for identifying the effect of GS3 mutation are as follows. The fragment size is 273bp.

[0288] GS3CRJCF:TACATAGCTGCTGCACCGTC (SEQ ID NO:51);

[0289] GS3CRJCR:GAAGCAAGATCGAAGGAGTATG (SEQ ID NO: 52).

[0290] The total PCR reaction volume was 20 μl, containing 2 μl of DNA template, 20 μl of 2×GC I buffer, 2 μl of 2 mM dNTPs, 0.2 μl each of 10 mM primers GS3OEF and GS3OER, and 0.2 μl of rTaq enzyme, with deionized water added to 20 μl (the 2×GC I buffer, dNTPs, and rTaq enzyme used were purchased from Takara Biotechnology Dalian Co., Ltd.). The PCR reaction conditions were as follows: ① 94°C for 4 minutes, ② 94°C for 30 seconds, ③ 58°C for 30 seconds, ④ 72°C for 30 seconds, ⑤ 33 cycles from ② to ④, ⑥ 72°C for 7 minutes, and ⑦ storage at 25°C. Sequencing results showed that the present invention obtained a pure and mutant OsGS3. ko OsGS3 ko A 2 bp insertion occurred (see FIG16 ), and the sequence is shown in SEQ ID NO: 30.

[0291] A similar approach was used to suppress the GS3 protein (SEQ ID NO: 18) in the maize inbred line KN5585 (variety rights application number 20191002444). The maize GS3 genomic sequence is shown in SEQ ID NO: 22, and the cDNA sequence is shown in SEQ ID NO: 23. The target site was also designed in the first exon, with the sequence shown in SEQ ID NO: 26, and the synthesized sgRNA sequence is shown in SEQ ID NO: 29. After constructing the editing vector and genetic transformation of maize, primers were designed 118 bp upstream and 113 bp downstream of the target site. PCR amplification and sequencing were performed to determine the mutation status of the target site. The primer sequences for identifying the effect of ZmGS3 mutations are as follows, and the fragment size is 255 bp.

[0292] ZmGS36F: ACTATAACAATCGACGACGTG (SEQ ID NO: 53);

[0293] ZmGS36R: AGCAGTGCAGCGTAATCGAT (SEQ ID NO:54).

[0294] The total PCR reaction volume was 20 μl, containing 2 μl of DNA template, 20 μl of 2× GC I buffer, 2 μl of 2 mM dNTPs, 0.2 μl each of 10 mM primers ZmGS36F and ZmGS36R, and 0.2 μl of rTaq enzyme, with deionized water added to 20 μl (all 2× GC I buffer, dNTPs, and rTaq enzyme were purchased from Takara Biotechnology Dalian Co., Ltd.). PCR reaction conditions were as follows: ① 94°C for 4 min, ② 94°C for 30 s, ③ 58°C for 30 s, ④ 72°C for 1 min, ⑤ 33 cycles from ② to ④, ⑥ 72°C for 7 min, and ⑦ storage at 25°C. Sequencing results indicate that a homozygous knockout mutant, designated ZmGS3, was obtained in this experiment. ko , there is a 34 bp deletion at the target site (Figure 17). ko The mutant gene sequence is shown in SEQ ID NO: 31, and the amino acid sequence deduced from the mutant gene sequence is shown in SEQ ID NO: 32.

[0295] 3.7 OsGS3 ko rice plants and ZmGS3 ko Identification of alkali resistance of corn plants

[0296] The wild type ZH11 and OsGS3 rice were treated with 75 mM mixed alkali solution. ko , maize wild type KN5585 and ZmGS3 ko The phenotypic observation results showed that under normal water treatment, rice OsGS3ko Compared with ZH11, which had no significant difference in survival rate, the maize ZmGS3 deletion mutant line ZmGS3 ko There was no significant difference compared with the wild type KN5585. However, under the treatment of 75 mM alkaline solution, rice OsGS3 ko The survival rate of transgenic plants was significantly increased compared with ZH11 (Figure 12E-F). ko The survival rate of transgenic plants was also significantly increased compared with KN5585 (Figure 12H-I). The results showed that the GS3 gene in both rice and maize is an important gene that negatively regulates salt-alkali tolerance, and this function is conserved in the grass plants maize and rice.

[0297] These mutant genes or mutant proteins can be transferred to other rice or corn or other hybrid materials through conventional hybridization to cultivate new alkali-resistant varieties.

[0298] Example 4. Similar effects of AT1 homologous genes in wheat

[0299] Common wheat (Triticum aestivum) is a hexaploid plant with genomes A, B, and D. The homologous gene of AT1 in wheat is named TaGS or TaAT1 (the two can be used interchangeably), and there are three copies: TaGS-4A gene, TaGS-7A gene, and TaGS-7D gene are three homologous genes in wheat, and their genomic sequences are shown in SEQ ID NO:59, SEQ ID NO:60, and SEQ ID NO:61, respectively. TaGS proteins include any one or more of TaGS-4A1 protein, TaGS-4A2 protein, TaGS-7A protein, or TaGS-7D protein. Among them, TaGS-4A1 protein and TaGS-4A2 protein are two transcripts of the wheat TaGS-4A gene, and their amino acid sequences are SEQ ID NO:55 and SEQ ID NO:56, respectively. The TaGS-7A gene expresses the TaGS-7A protein shown in SEQ ID NO:57. The TaGS-7D gene expresses the TaGS-7D protein shown in SEQ ID NO:58. The following experiments demonstrate that by adjusting any one or more of the aforementioned nucleic acid molecules, the expression level of the corresponding TaGS protein can be changed, thereby achieving regulation of the salt-alkali tolerance of wheat plants, which can be applied in plant breeding.

[0300] 4.1 Selection of wheat TaGS target sites and construction of knockout vectors

[0301] 1) Selection of wheat TaGS target sites

[0302] The TaGS gene in wheat has three homologous genes: TaGS-4A, TaGS-7A, and TaGS-7D, with corresponding gene ID numbers: TraesCS4A02G474000, TraesCS7A02G017700, and TraesCS7D02G015000, respectively. We identified a suitable target site and constructed a knockout vector targeting these three homologous genes using a conserved target sequence. The target site selected was located in exon 1 (Figure 18).

[0303] One of the target double strands knocked out using CRISPR technology has the following structure: 5-Nx-NGG-3, where N in PAM(NGG) represents any one of A, T, C, and G, and N in Nx represents any one of A, T, C, and G, with x = 20. In this example, the target sequence of the TaGS gene used is as follows, with the underlined bases representing the PAM.

[0304] TaGS gene target sequence: AAGTCCCCGCTCGACCCCTGCGG (SEQ ID NO: 70).

[0305] After the knockout vector is transformed into wheat, under the mediation of sgRNA, the Cas9 protein cuts in the target sequence region, forming a double-strand DNA break, triggering the body's self-damage repair mechanism. Mutations will be introduced in the process of cells spontaneously repairing the gap ("mutation" here refers to broad mutations, including insertions, deletions, narrow mutations, etc., and the vast majority of these mutations are gene function-inactivating mutations).

[0306] 2) Construction of recombinant vector

[0307] (1) The pBUE411 (addgen#62200) plasmid was digested with the restriction endonuclease BsaI, and the approximately 12.5 kb vector backbone was recovered and named BUE411.

[0308] (2) Based on the designed TaGS gene target sequence (SEQ ID NO: 70), the following primers with sticky ends (underlined parts) were synthesized:

[0309] TaGS-IF: GCGAAGTCCCCGCTCGACCCCTG (SEQ ID NO:71).

[0310] TaGS-1R: AAACCAGGGGTCGAGCGGGGACTT (SEQ ID NO:72).

[0311] (3) TaGS-1F and TaGS-1R were annealed to form a double-stranded DNA with sticky ends, named TaGS-1, which was ligated with the gel-recovered product BUE411 from step 1 to obtain the recombinant plasmid pBUE411-TaGS-1. The structure of the recombinant plasmid pBUE411-TaGS-1 is described as follows: the recombinant plasmid is obtained by replacing the small fragment between the two restriction endonuclease BsaI recognition sequences of the pBUE411 plasmid with the DNA fragment shown at positions 1-20 of SEQ ID NO:70.

[0312] Unless otherwise specified, the experimental methods used in the examples of this application are conventional methods.

[0313] Unless otherwise specified, the materials, reagents, etc. used in the examples of this application can be obtained from commercial sources.

[0314] 4.2 Transformation of wheat

[0315] Wheat immature embryo callus was genetically transformed using Agrobacterium EHA105 carrying the recombinant plasmid pBUE411-TaGS-1 constructed in Example 1. After transformation, complete regenerated plants (ie, T0 generation) were obtained through tissue culture.

[0316] After passage in the T2 generation, a transgenic plant E5 was obtained in which the three homologous TaGS genes, TaGS-4A, TaGS-7A, and TaGS-7D, had lost their function. Sanger sequencing revealed that the TaGS gene TaGS-4A of the E5 plant was a homozygous mutation, while both TaGS-7A and TaGS-7D were biallelic mutations (as shown in Figure 19). The TaGS-4A mutation of the E5 plant was a 13bp deletion of the CCCGCTCGACCCC (SEQ ID NO:73) bases at positions 6-18; the first mutation of the TaGS-7A of the E5 plant was a 1bp deletion of the C base at position 18, and the second mutation was a 2bp deletion of the CC bases at positions 17-18; the first mutation of the TaGS-7D of the E5 plant was a 1bp deletion of the G base at position 20, and the second mutation was a 2bp deletion of the TG bases at positions 19-20.

[0317] 4.3 Salt-alkali tolerance phenotype of wheat TaGS triple mutant under salt-alkali stress

[0318] First, the T2 generation TaGS gene triple mutant seeds E5 and wild-type Fielder obtained in Example 4.2 were sown in a soil matrix of vermiculite and nutrient soil mixed in a ratio of 1:1, 12 seeds were sown in each hole, and 2 repetitions were set. Then, 75mM mixed alkaline solution (pH 9.2, molar ratio of 5:1 NaHCO3:Na2CO3) was used to irrigate until the soil was saturated as a treatment, and the control was irrigated with clean water. They were placed on flat ground for uniform absorption, and each treatment was repeated three times. The hole tray after full absorption was placed in a model plant glass greenhouse and replenished with clean water at a later stage. The seedling growth environment is as follows: light / dark time is 16h / 8h, day and night temperature range is 28 / 26℃, and relative humidity is 60% to 70%.

[0319] The results showed that after treatment with saline-alkali stress (75 mM mixed alkali solution), the E5 mutant strain had significantly higher salt-alkali tolerance than the wild type, the aboveground biomass was significantly higher than the wild type, and the degree of root growth inhibition in the underground part was significantly weaker than that of the wild type (as shown in Figure 20).

[0320] The same operation as above was performed, but the soil was irrigated with 100mM or 125mM mixed alkaline solution (pH 9.2, molar ratio of 5:1 NaHCO3:Na2CO3) until saturation as treatment, and water was used as control. The E5 mutant strain had significantly higher salt and alkali tolerance than the wild type, and the degree of chlorosis and wilting was weaker than that of the wild type.

[0321] From the above results, it can be seen that the above-mentioned embodiments of the present invention achieve the following technical effects: by gene editing the nucleic acid molecules used for transcription and translation of TaGS protein in wheat, the expression level of TaGS protein in wheat is reduced, the salt and alkali tolerance of wheat is improved, and new wheat plants with improved salt and alkali tolerance are obtained.

[0322] 4.4 Other Detection of Wheat TaGS Gene Triple Mutants

[0323] We generated TaAT1 null mutants (i.e., TaGS triple mutants) with all three copies of the TaAT1 (also known as TaGS) gene. Phenotypic analysis showed that TaAT1 was downregulated under treatment with a 125 mM (104.2 mM NaHCO3 and 20.8 mM Na2CO3, pH 9.7-9.8) mixed alkali solution. ko -1 and TaAT1 ko The survival rates of TaAT1-2 were 122% and 164% higher than those of TaWT, respectively (Figure 21C, D, E and F). Thus, knocking out all copies of TaAT1 can greatly enhance the salt-alkali tolerance of wheat.

[0324] To further investigate whether TaAT1, like sorghum and rice, adopts a conserved mechanism to resist salinity-alkali stress, the expression of TaAT1 was determined by DAB (3,3-diaminobenzidine) and H2DCFDA staining. ko As can be seen from Figure 21G and H, under saline-alkali treatment, TaAT1 ko The intracellular H2O2 level of the strain was significantly lower than that of TaWT, which was consistent with the AT1 ko The results showed that, similar to the role of the AT1 gene in sorghum, maize, and rice, the TaAT1 gene is an important gene that negatively regulates the salt-alkali tolerance of wheat. Genetic modification of the TaAT1 gene can also effectively improve the growth performance of wheat in saline-alkali soils, and the mechanism is conservative.

[0325] Example 5. Improving crop yields in high sodium soils

[0326] To evaluate the usefulness of the AT1 / GS3 gene in crop production, we conducted field trials in sorghum, rice, maize, and millet, containing different natural alleles and genetically modified AT1 / GS3 genes, on high-sodium soils containing natural alkali. The fields were located in two regions of saline-alkali land in China: Da'an, Jilin Province (northern China) and Pinglou, Ningxia (northwest China). These two regions are major crop-producing areas in China, but crop yields are limited by the presence of large areas of saline-alkali land.

[0327] KY NIL (GS3) is an elite rice variety Kongyu131 carrying OsGS3-2 (compared to OsGS3-1, there is a 3-bp insertion in the reading frame at the C-terminus). The function of OsGS3-2 is equivalent to that of OsGS3-1. NIL (gs3 - ) is an introgressed OsGS3-3 in the Kongyu131 background. OsGS3-3 is a completely loss-of-function allele. NIL (GS3) and KY NIL (gs3 - ) were tested for alkali resistance. The test was conducted in a greenhouse at the seedling stage with a mixed alkali concentration of 75 mM. As expected, KY NIL (gs3 - ) showed higher alkali resistance than Kongyu131 ( Figures 22A and B ).

[0328] We then conducted an experiment comparing NILs in two different soils with pH values ​​of 9.45 and 7.74 (control) using a mixture of high sodium soil and nutrient soil from the same area.NIL (gs3 - ) was significantly superior to KY in terms of relative survival rate, number of grains per ear, grain weight, and yield (Figure 22C), except for the number of ears per plant (Figure 22C). NIL (GS3).

[0329] We also conducted field trials in Da'an, Jilin Province, China, where the soil pH was 9.17. NIL (gs3 - ) performed better than KY at both the seedling stage ( FIG. 22D ) and the harvest stage ( FIG. 23A , left panel). NIL (GS3) is much better, indicating KY NIL (gs3 - ) Enhanced alkali resistance. At harvest time, KY NIL (gs3 - ) rice produced larger panicles ( FIG. 22E ), a higher number of grains per panicle ( FIG. 23A , third panel), and increased grain weight ( FIG. 23A , fourth panel), resulting in a 29.3% increase in grain yield per bush ( FIG. 23A , fifth panel) KY NIL (gs3 - ) rice had a grain yield 27.8% higher than the control (Figure 23A, right). NIL (gs3 - ) and the control, the difference in yield per plant was only 10.3% (Fig. 22F). In the second year, the grain yield of NIL in sodium soil and acidic soil was studied at the same location. The yield in alkaline soil increased by 22.4%, while the control field increased by 6.64% (Fig. 22G and H), similar to the results observed previously. In addition, knockout of OsGS3 contributed to grain length in both sodium soil and neutral soil. We also found that knockout of the OsGS3 gene contributed to grain width in sodium soil but not in neutral soil (Fig. S22I and J). These results suggest that the non-functional allele of GS3 can achieve higher crop yields in high sodium soils.

[0330] Due to its excellent quality and high yield, the improved rice variety Zhongkefa5 (ZKF5) has been planted over 100,000 hectares in northern China since 2018. ZKF5 has a non-functional allele of GS3 (OsGS3-3), which is similar to KY NIL (gs3 -) were similar. ZKF5 field performance was then tested in relatively high-sodium soils (pH 8.5-8.7) and low-sodium soils (pH 7.4-7.6) in the summer of 2021. At the end of the growing season, the local farmers' association obtained field production data from more than 30 hectares of land. We found that the yield of the sodium-containing fields (high sodium) was only 7.8% less than that of the neutral fields (low sodium) (Figure 22K). These large-area field production data also indicate that the use of the GS3-3 allele (i.e., the non-functional allele) in rice production on sodium-containing land can produce rice with improved crop yield.

[0331] In addition, we also transformed Zhonghua 11 (ZH11) rice and its OsGS3 knockout line OsGS3 ko Planted in the greenhouse in two soils with the same pH value, the control with pH 7.74 and the alkaline soil with pH 9.45. Although we were unable to harvest seeds of ZH11 due to its photoperiod sensitivity when planted in Jilin Province, China, we did not harvest seeds of ZH11 in OsGS3 ko The higher relative survival rate observed in the strain (Figure 22L) indicates that it is more tolerant to alkaline conditions.

[0332] Sorghum, maize, and millet were tested in the Pingluo region of Gansu Province, China. The Pingluo region, located in northwestern China, is composed of arid land with high-sodium soils. In this region, pH naturally rises during the growing season due to changes in groundwater levels (BP Singh, ALCowie, KY and Chan, Soil health and climate change. New York: Springer-Verlag Berlin Heidelberg 29, (2011). doi:10.1007 / 978-3-642-20256-8). Wild-type Wheatland and SbAT1ko sorghum grown in the same plot had a pH of 8.97 in the spring and 9.27 during flowering in August. SbAT1 ko The survival rate of the lines exceeded 60%, while the survival rate of the Wheatland wild type was only 33% (Figure 23B, panels 1 and 2). Leaf burn, a symptom that commonly occurs in monocotyledonous crops affected by high salt or high sodium stress, was observed in most Wheatland wild type plants, but not in the SbAT1 lines. ko No observation was made in plants of the line (Figure 23B, first panel). koThe tiller number and ear number of the line (Figure 23B, fourth and fifth panels) were lower than those of the control, but the yield was 20.1% higher than that of the control (Figure 23B, third panel). Since the whole sorghum plant is usually used for silage, we measured the fresh weight of the whole plant biomass and found that SbAT1 ko The fresh weight of the plant of the line was 30.5% higher than that of the control (Figure 23B, right panel). ko The grain yield and whole plant biomass of the strain were higher than those of the wild type, indicating that SbAT1 ko The line sorghum performed better in the field. In the same region, we also planted the NIL-SbAT1 and NIL-Sbat1 lines during the summer. At the end of August, we found that NIL-SbAT1 outperformed NIL-Sbat1 (Figure 23C), a difference similar to that recorded in the greenhouse experiment (Figure 6B).

[0333] Foxtail millet SiAT1 ko SiAT1 and its wild-type control, Ci846, were also grown in the same area along with sorghum. ko The survival rate of the strain at the seedling stage was close to 100%, while the survival rate of the wild type Ci846 was only about 75% (Figure 23D, left panel). ko The grain size of SiAT1 was also larger than that of the control (Fig. 23D, middle panel). ko The yield of β-lactamase was approximately 19.5% higher than that of the control ( FIG. 23D , right panel).

[0334] In the same field, we also planted the maize ZmGS3 knockout line and its wild-type control line KN5585 (ZmWT). ko The relative survival rate of the strains was about 42.5%, while the relative survival rate of the wild-type control was only about 18.5% (Figure 23E). After 3 months of growth, most individuals of the KN5585 strain died, while 7.4% of the individuals of the knockout line survived. Although none of these maize plants were mature enough to produce grain due to the inherent sensitivity of maize to alkaline conditions, the ZmGS3 knockout line showed enhanced alkaline tolerance.

[0335] In summary, we can conclude that non-functional mutations in AT1 homologous genes, whether obtained from natural variation or generated by gene editing, can improve the field performance of crops in terms of biomass or yield when grown in sodic soils (salty-alkali lands).

[0336] Example 6. Study on the mechanism of action of AT1

[0337] Based on our research, we designed a model for the hypothetical Gγ subunit AT1-mediated alkaline stress response in plants (Figure 24). Under alkaline stress, PIP2s (PIP2 water channel protein) acts as a H2O2 exporter. The Gγ subunit AT1 may pair with Gβ to negatively regulate the phosphorylation of PIP2s, thereby reducing PIP2s' H2O2 export capacity, leading to excessive H2O2 accumulation and causing plant sensitivity to alkaline stress. A truncated form of AT1, at1, further inhibits H2O2 export activity and leads to high sensitivity of plants to alkaline stress. However, a naturally non-functional form of AT1 or knockout of the AT1 homolog releases the inhibitory effect on PIP2s and effectively improves alkaline stress tolerance in crops.

[0338] Example 7. Similar functions of AT1 soybean homologous genes

[0339] BLAST analysis revealed three genes each in wild soybean (Glycine soja) and cultivated soybean (Glycine max) (both tetraploids) with relatively high sequence homology to the sorghum AT1 protein (Figure 25 and Table 2, with similarities ranging from approximately 40% to 50%). All three phylogenetic analyses revealed a relatively distant relationship with sorghum, rice, maize, millet, and wheat.

[0340] Table 2. Alignment of the full-length amino acid sequence with sorghum AT1 (using the sequence alignment tool of VectorBuilder)

[0341] Table 3. Alignment of GGL domain with sorghum AT1 GGL domain (using the sequence alignment tool of VectorBuilder)

[0342] In Examples 1-5, we have demonstrated that the AT1 / GS3 gene plays a conserved and important role in saline-alkali stress responses in five monocotyledonous cereals (sorghum, millet, rice, maize, and wheat). Although further investigation is needed to determine whether genetic modification of the AT1 / GS3 gene can also regulate salt-alkali tolerance in dicotyledonous plants such as soybean, our preliminary results (data not shown) suggest that the soybean AT1 homolog shares a certain degree of identity with the sorghum AT1 gene, particularly in the GGL domain (approximately 40% to 50%). These results suggest that the soybean AT1 homolog plays a similar conserved role in regulating salt-alkali tolerance as its counterparts in sorghum, millet, rice, maize, and wheat. For example, reducing the expression of all copies of the soybean AT1 homolog, particularly by knocking out the GGL domain, or using a nonfunctional allele of all copies could improve soybean salt-alkali tolerance. Conversely, increasing the expression of the soybean AT1 homolog (e.g., overexpression) or expressing a C-terminal truncation mutant of the AT1 homolog could also yield salt-alkali-sensitive soybeans.

[0343] The sequences of AT1 homologous genes in soybean are shown in Table 4.

[0344] Table 4. AT1 homologous gene sequences in soybean

[0345] Table 5. Amino acid sequence of GGL domain

[0346] Those skilled in the art will further appreciate that the present invention may be embodied in other specific forms without departing from its spirit or central features. Since the foregoing description of the present invention discloses only exemplary embodiments thereof, it should be understood that other variations are considered to be within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments described in detail herein. Instead, reference should be made to the appended claims for an indication of the scope and content of the present invention.

Claims

1. A nucleic acid molecule encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or having at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15, for use in regulating saline-alkali tolerance in plants, or for breeding plants with saline-alkali tolerance or saline-alkali sensitivity.

2. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule encodes a protein comprising the amino acid sequence of any one of SEQ ID NOs: 15 and 86-96.

3. The nucleic acid molecule according to claim 1, encoding an amino acid sequence selected from the group consisting of: (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions; (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function; (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function; (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function; (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function.

4. A mutant protein encoded by a variant nucleic acid molecule resulting from a frameshift mutation in a nucleic acid molecule encoding the following amino acid sequence: (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions; (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function; (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function; (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function; (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function; Compared with the protein encoded by the nucleic acid molecule before the frameshift mutation, the activity of the mutant protein is reduced or no activity. A nucleic acid molecule encoding the mutant protein according to claim 4 .

6. An expression cassette comprising the nucleic acid molecule of any one of claims 1 to 3 or 5.

7. A recombinant vector comprising the nucleic acid molecule according to any one of claims 1 to 3 or 5, or comprising the expression cassette according to claim 5.

8. A cell comprising the nucleic acid molecule according to any one of claims 1 to 3 or 5, or the expression cassette according to claim 5, or the recombinant vector according to claim 6.

9. The cell according to claim 8, wherein the cell is selected from a prokaryotic cell or a eukaryotic cell, the prokaryotic cell being, for example, a bacterial cell or a fungal cell, for example, an Escherichia coli cell, a yeast cell or an Agrobacterium cell; the eukaryotic cell being, for example, a plant cell.

10. A method for cultivating salt-alkali tolerant plants, the method comprising: Reducing the number of plants encoding a gene comprising a sequence having at least 40% identity, preferably at least about 75% identity, to SEQ ID NO: 15 to the level of expression of all alleles of a protein having an amino acid sequence that is at least about 60% similar, preferably at least about 70%, about 80% or about 85% similar, more preferably at least about 90% or about 95% similar, or to the level of expression of all alleles of a protein having an amino acid sequence that is at least about 60% similar, preferably at least about 70%, about 80% or about 85% similar, more preferably at least about 90% or about 95% similar, wherein the salt-alkali tolerant plants grow better than wild-type plants under saline-alkali conditions, The saline-alkaline conditions include pH>7.5, Na + Growth conditions with concentrations > 75 mM or pH > 8.0, Na + Growth conditions with concentrations >50 mM.

11. The method according to claim 10, wherein the expression levels of all the alleles in the plant are reduced or all the alleles are not expressed by gene editing methods, targeted mutagenesis, chemical induction, radiation induction, natural mutation, RNAi or the addition of substances that inhibit the expression of target genes.

12. The method of claim 10, wherein all alleles in the plant are knocked out or mutated, for example, by knocking out the GGL domain or GGL-like domain of the gene by homologous recombination, or editing the GGL domain or GGL-like domain of the gene by CRISPR technology.

13. The method according to claim 10, wherein the N-terminal first exon portion of all said alleles is knocked out or mutated.

14. The method according to claim 10, wherein the GGL domain or GGL-like domain or the N-terminal first exon portion of all the alleles is knocked out or mutated.

15. The method of claim 10, wherein the expression level of all alleles is reduced by at least 51%, preferably by 60%, 70% or 80%, more preferably by 85%, 90% or 95%, or even not expressed compared to wild-type control plants.

16. The method according to claim 10, wherein the plant is a monocotyledonous or dicotyledonous plant, for example, a grass plant, preferably sorghum, rice, millet, corn, wheat or soybean.

17. method according to claim 10, described method also comprises identifying and comprises described all allelic knockout or sudden change or comprise the parental plant of non-functional allele, carries out selfing or with another and comprises described all allelic knockout or sudden change or comprise the parental plant of non-functional allele hybridization one or more generations of offspring plant, The knockout or mutation of all the alleles results in reduced or no activity of the proteins encoded by all the alleles.

18. The method according to claim 10, wherein the GGL domain or GGL-like domain, or the first N-terminal exon portion of all alleles of a gene encoding an amino acid sequence selected from the group consisting of: (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions; (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function; (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function; (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function; (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function.

19. A plant or plant material, wherein all alleles encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15 are knocked out or mutated, preferably, wherein the GGL domain or GGL-like domain, or the N-terminal first exon portion of all alleles of the gene are knocked out or mutated; The knockout or mutation of all the alleles results in reduced or no activity of the proteins encoded by all the alleles.

20. The plant or plant material according to claim 19, wherein the plant is a monocotyledonous or dicotyledonous plant, for example a plant of the family Poaceae, preferably sorghum, rice, millet, corn, wheat or soybean.

21. The plant or plant material according to claim 19, wherein the GGL domain or GGL-like domain or the N-terminal first exon portion of all alleles of a gene encoding an amino acid sequence selected from the group consisting of: (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions; (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function; (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function; (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function; (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function.

22. The plant or plant material of claim 19, wherein the plant material is a plant part, plant organ, plant tissue, seed, plant protoplast or plant cell, for example, an embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, plant cell culture or plant callus.

23. A method for preparing hybrid plant seeds, the method comprising: (i) crossing a first parent plant with a second parent plant, wherein the first parent plant and the second parent plant encode an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO:

15. All alleles of a protein having an amino acid sequence are knocked out or mutated; and (ii) harvesting seeds of the hybrid plants or their progeny.

24. A method for preparing conventional planting seeds, the method comprising: Propagating parental seeds to harvest progeny seeds thereof, wherein in the parental seeds, all alleles encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15 have been knocked out or mutated such that the protein is not expressed or is expressed at a reduced level compared to wild-type plants.

25. The method of claim 23 or 24, wherein in the parent seed, all alleles encoding a protein comprising the following amino acid sequence have been knocked out or mutated: (i) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 4 and has similar or identical functions; (ii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 8 and has similar or identical function; (iii) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 16-17 and has similar or identical function; (iv) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 18 and has similar or identical function; (v) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 55-58 and has similar or identical function; or (vi) an amino acid sequence that is at least 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NO: 75, 77, 79, 81, 83 or 85 and has similar or identical function.

26. The method of claim 23, wherein the first parent plant and / or the second parent plant is an inbred plant.

27. A plant or plant material thereof, the plant being grown from a seed prepared by the method of any one of claims 23 to 26.

28. A method for cultivating saline-alkali sensitive plants, the method comprising: Increasing the expression level of a gene encoding a protein comprising an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO: 15 in a plant, or expressing or overexpressing a C-terminally truncated protein encoded by a mutant of the gene in a plant.

29. The method of claim 28, wherein the expression level of the gene of interest is increased by introducing into the plant an exogenous nucleic acid molecule encoding an amino acid sequence having at least 40% identity, preferably at least about 75% identity, more preferably at least about 80% identity, or more preferably at least about 90% or about 95% identity, or at least about 60% similarity, preferably at least about 70%, about 80% or about 85% similarity, more preferably at least about 90% or about 95% similarity to SEQ ID NO:

15.

30. The method according to claim 29, wherein genetic material carrying the nucleic acid molecule is introduced into cells or tissues of the plant, wherein the genetic material exists in the plant in the form of free or integrated into the chromosomes of the plant, and the cells or tissues into which the genetic material has been introduced are cultured into a complete plant to obtain the salt-alkali sensitive plant.

Images