Compositions and methods for proprotein convertase subtilisin kexin 9 (pcsk9) editing
The PCSK9 gene is targeted through the CRISPR/Cas system, and the method of guiding the binding of RNA and Cas9 nucleases is used to solve the problem of low efficiency in the expression regulation of PCSK9 gene in the prior art, achieving the effect of reducing LDL cholesterol levels and reducing the risk of cardiovascular disease.
Patent Information
- Application Number
- CN202380083813.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-21
- Filing Date
- 2023-12-20
- Publication Date
- 2025-07-15
AI Technical Summary
The prior art is difficult to effectively regulate PCSK9 gene expression, leading to the occurrence of high cholesterol and cardiovascular diseases, and traditional methods have problems of inefficiency, safety and specificity.
Using the CRISPR/Cas system that guides the binding of RNA to Cas9 nuclease, the introduction of double-stranded or single-stranded breaks to the PCSK9 gene is reduced, and the efficiency and specificity are improved using the lipid nanoparticle delivery system.
Accurate editing of PCSK9 genes has been achieved, significantly reducing the blood LDL cholesterol level, reducing the risk of cardiovascular disease, and improving the treatment effect and safety.
Smart Images

Figure CN120322555A_ABST
Abstract
Description
[0001] Cross-reference to related applications
[0002] This application claims priority to U.S. Provisional Application No. 63 / 434,394, filed December 21, 2022, which is incorporated herein by reference in its entirety.
[0003] Reference to electronic sequence listing
[0004] This application contains a sequence list, which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. The .XML copy was created on November 28, 2023, named "01155-0061-00PCT.xml", and has a size of 508,922 bytes. The sequence list contained in the .XML file is part of this specification and is hereby incorporated by reference in its entirety. Summary of the Invention
[0005] Preprotein convertase subtilisin Kexin 9 (PCSK9) is a member of the subtilisin serine protease family and is expressed in liver, intestine, and kidney tissues. It is a key regulator of circulating low-density lipoprotein (LDL) cholesterol levels and plays a role in cholesterol and fatty acid metabolism. PCSK9 has been shown to induce LDL receptor degradation, particularly in the liver, thereby increasing the level of circulating LDL cholesterol in the blood.
[0006] Excessive production of PCSK9 protein or mutations in the PCSK9 gene have been shown to significantly affect total cholesterol and LDL cholesterol in the general population and are associated with cardiovascular disease (e.g., autosomal dominant familial hypercholesterolemia) and chronic liver injury.
[0007] This disclosure provides compositions and methods for modifying the PCSK9 gene. In some aspects, this disclosure provides a guide RNA, compositions thereof, and pharmaceutical compositions comprising the guide RNA or composition described herein. In some aspects, this disclosure also provides uses and methods of use of the guide RNA, compositions thereof, or pharmaceutical compositions described herein for inducing double-strand breaks or single-strand breaks in the PCSK9 gene, for reducing PCSK9 gene expression in cells or subjects, and for treating patients with or at risk of having a PCSK9-related disease or disorder. In some aspects, this disclosure also provides uses and methods of use of the guide RNA, compositions thereof, or pharmaceutical compositions described herein for inducing double-strand breaks in the PCSK9 gene, for reducing PCSK9 gene expression in cells or subjects, and for treating patients with or at risk of having a PCSK9-related disease or disorder.
[0008] In some embodiments, the guide RNA includes a guide region and a conserved region. In some embodiments, the guide RNA includes a nucleotide sequence targeting a locus in the PCSK9 gene. In some embodiments, the guide RNA is a modified guide RNA.
[0009] In some aspects, this disclosure provides a composition comprising a guide RNA as described herein. In some embodiments, the composition further comprises an RNA-guided DNA binder, namely a polypeptide RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder. In some embodiments, the nucleic acid encoding the RNA-guided DNA binder comprises mRNA containing an open reading frame (ORF) encoding the RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder is a Cas9 nuclease. In some embodiments, Cas9 is *S. pyogenes* (“Spy”)Cas9. In some embodiments, Cas9 is SpyCas9 lyase.
[0010] In some embodiments, the compositions described herein further comprise pharmaceutical excipients. In some embodiments, the guide RNA contained in the composition is associated with lipid nanoparticles (LNPs). In some embodiments, the LNPs comprise cationic lipids. In some embodiments, the LNPs comprise accessory lipids. In some embodiments, the accessory lipid is cholesterol. In some embodiments, the LNPs comprise neutral lipids. In some embodiments, the neutral lipid is 1,2-distearate-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the LNPs comprise stealthlipids. In some embodiments, the stealth lipid is 1,2-dimyristoyl-rac-glycero-3-methoxy polyethylene glycol-2000 (PEG2k-DMG).
[0011] In some aspects, this disclosure provides a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises a guide RNA as described herein or a composition as described herein. In some embodiments, the pharmaceutical composition comprises a composition as described herein, which includes a guide RNA (e.g., a modified guide RNA) and a SpyCas9 lyase as described herein.
[0012] In some aspects, this disclosure provides the use of a guide RNA as described herein or a composition as described herein for inducing double-strand breaks or single-strand breaks in the PCSK9 gene within cells. In some aspects, this disclosure provides a pharmaceutical composition comprising a guide RNA as described herein or a composition as described herein, said pharmaceutical composition for inducing double-strand breaks or single-strand breaks in the PCSK9 gene within cells. In some embodiments, the cells are in a subject. In some aspects, this disclosure provides the use of a guide RNA as described herein or a composition as described herein for reducing the expression of the PCSK9 gene in cells or a subject. In some aspects, this disclosure provides a pharmaceutical composition comprising a guide RNA as described herein or a composition as described herein, said pharmaceutical composition for reducing the expression of the PCSK9 gene in cells or a subject. In some embodiments, the cells are in a subject.
[0013] In some aspects, this disclosure provides the use of a guide RNA or composition as described herein for inducing double-strand breaks in the PCSK9 gene within cells. In some aspects, this disclosure provides a pharmaceutical composition comprising a guide RNA or composition as described herein for inducing double-strand breaks in the PCSK9 gene within cells. In some embodiments, the cells are in a subject. In some aspects, this disclosure provides the use of a guide RNA or composition as described herein for inducing double-strand breaks in the PCSK9 gene within cells, for reducing PCSK9 gene expression in cells or a subject. In some aspects, this disclosure provides a pharmaceutical composition comprising a guide RNA or composition as described herein for inducing double-strand breaks in the PCSK9 gene within cells, for reducing PCSK9 gene expression in cells or a subject. In some embodiments, the cells are in a subject.
[0014] In some aspects, this disclosure provides the use of a guide RNA as described herein or a composition as described herein, for example, for inducing double-strand breaks in the PCSK9 gene in cells, or for treating a subject with a PCSK9-related disease or disorder. In some aspects, this disclosure provides a pharmaceutical composition comprising a guide RNA as described herein or a composition as described herein, for example, for inducing double-strand breaks in the PCSK9 gene in cells, or for treating a subject with a PCSK9-related disease or disorder.
[0015] In some aspects, this disclosure provides a method for inducing double-strand breaks or single-strand breaks in the PCSK9 gene within cells or for reducing the expression of the PCSK9 protein in cells, comprising contacting the cells with a guide RNA as described herein or a composition as described herein. In some embodiments, the cells are in a subject. In some embodiments, the level of the PCSK9 protein in a subject sample selected from blood or serum is measured.
[0016] In some aspects, this disclosure provides the use of a guide RNA or composition as described herein for the preparation of an agent for carrying out any of the methods described herein, such as for inducing double-strand breaks in the PCSK9 gene in cells.
[0017] In some respects, this disclosure provides a medicine box containing a composition as described herein.
[0018] The following is a non-exhaustive list of the implementation schemes provided in this article.
[0019] Implementation scheme 1 is a guide RNA, which includes:
[0020] A. A targeting sequence comprising a sequence having at least 95%, 90%, 85%, or 80% identity or complementarity to a nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18, or 20;
[0021] B. A targeting sequence comprising at least 17, 18, 19, or 20 adjacent nucleotides identical or complementary to the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18, or 20; or
[0022] C. Target sequence, wherein the target sequence comprises the same target sequence as the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18 or 20.
[0023] Implementation scheme 2 is a guide as described in implementation scheme 1, which contains the same target sequence as the nucleotide sequence of SEQ ID NO:9, 14 or 18.
[0024] Implementation scheme 3 is a guide RNA as described in implementation scheme 1 or 2, further comprising one or more of the following:
[0025] A. A shortened section of the hairpin, or alternatively, a shortened section of the hairpin, wherein...
[0026] 1. In hairpin 1, at least one of the following nucleotide pairs is substituted with a Watson-Crick pairing nucleotide: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region is optionally absent.
[0027] a. Any one or two of H1-5 to H1-8
[0028] b. One, two, or three of the following nucleotide pairs: H1-1 with H1-12, H1-2 with H1-11, H1-3 with H1-10, and H1-4 with H1-9, or
[0029] c. 1-8 nucleotides in region 1 of the hairpin; or
[0030] 2. The shortened hairpin region 1 lacks 4-8 nucleotides, preferably 4-6 nucleotides; and
[0031] a. One or more of positions H1-1, H1-2, or H1-3 are deleted or substituted relative to the exemplary SpyCas9 sgRNA-1; or
[0032] b. One or more of positions H1-6 to H1-10 are substituted relative to the exemplary SpyCas9sgRNA-1; or
[0033] 3. The shortened hairpin region 1 is missing 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted relative to the exemplary SpyCas9sgRNA-1; or
[0034] B. A shortened upper stem region, wherein the shortened upper stem region is missing 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include fewer than or equal to 4 substitutions relative to the exemplary SpyCas9 sgRNA-1; or
[0035] C. Substitutions relative to one or more of the exemplary SpyCas9 sgRNA at any of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substituent nucleotide is neither a pyrimidine followed by an adenine nor an adenine preceded by a pyrimidine; or
[0036] D. An exemplary SpyCas9 sgRNA-1 having an upper stem region, wherein the upper stem modification comprises modification of any one or more of US1-US12 in the upper stem region.
[0037] Implementation scheme 4 is the guide RNA as described in implementation scheme 3, wherein the guide RNA lacks 6 nucleotides from the shortened hairpin 1.
[0038] Implementation scheme 5 is the guide RNA as described in implementation scheme 3, wherein the guide RNA lacks 8 nucleotides from the shortened hairpin 1.
[0039] Implementation scheme 6 is the guide RNA as described in any one of implementation schemes 3 to 5, wherein H-1 and H-3 are deleted.
[0040] Implementation scheme 7 is a guide RNA as described in any one of implementation schemes 3 to 6, wherein the guide RNA further comprises a 3' tail.
[0041] Implementation scheme 8 is a guide RNA as described in implementation scheme 7, wherein the 3' tail is 1-4 nucleotides in length, optionally 1 nucleotide in length.
[0042] Implementation scheme 9 is a guide RNA as described in any one of implementation schemes 3 to 8, wherein the guide RNA comprises an upper stem region containing modifications to one or more of US1-US12 in the upper stem region.
[0043] Implementation scheme 10 is a guide RNA as described in implementation scheme 1 or 2, which contains a modified nucleotide sequence according to pattern (mN*)3(N)13-17, where “m” represents 2'-O-methyl modification, * represents thiophosphate bond and N represents 2'-OH and phosphodiester bond.
[0044] Implementation scheme 11 is a guide RNA as described in implementation scheme 1, wherein the guide RNA comprises a modified nucleotide sequence selected from the sequences in Table 4A (SEQ ID NO: 501-512, optionally SEQ ID NO: 507 or 512), wherein the modified nucleotide sequence is the 3' of the guide sequence.
[0045] Implementation scheme 12 is a guide RNA as described in implementation scheme 11, which is modified according to a pattern of nucleotide sequences selected from the sequences in Table 4B (SEQ ID NO: 601-612, optionally SEQ ID NO: 607 or 612), wherein (mN*)3N17 refers to the target sequence as described in implementation scheme 1 or 2.
[0046] Implementation scheme 13 is a guide RNA as described in any one of implementation schemes 1 to 12, wherein the guide RNA comprises a nucleotide sequence selected from SEQ ID NO: 121, 109, 101, 102, 107, 113-115, 117, 118, 120, 122 or 123 provided in Table 2, optionally SEQ ID NO: 109, 114, 118, 121, 122 or 123.
[0047] Implementation scheme 14 is a guide RNA as described in implementation scheme 13, wherein each nucleotide is any natural or non-natural nucleotide.
[0048] Implementation scheme 15 is a guide RNA as described in implementation scheme 14, wherein the guide RNA comprises a nucleotide sequence selected from SEQ ID NO: 221, 209, 201, 202, 207, 213-215, 217, 218, 220, 222 or 223 provided in Table 2, optionally modified with 209, 214, 218, 221, 222 or 223.
[0049] Embodiment 16 is a composition comprising the guide RNA as described in any one of Embodiments 1 to 15.
[0050] Embodiment 17 is a composition as described in Embodiment 16, further comprising an RNA-directed DNA binder or a nucleic acid encoding an RNA-directed DNA binder.
[0051] Embodiment 18 is a composition as described in Embodiment 17, wherein the nucleic acid encoding the RNA-directed DNA binder comprises mRNA containing an open reading frame (ORF) encoding the RNA-directed DNA binder.
[0052] Embodiment 19 is a composition as described in Embodiment 17 or 18, wherein the RNA-directed DNA binding agent is a Cas9 nuclease.
[0053] Embodiment 20 is the composition as described in Embodiment 19, wherein the Cas9 is Streptococcus pyogenes Cas9.
[0054] Embodiment 21 is the composition as described in Embodiment 20, wherein the Streptococcus pyogenes Cas9 comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 1001, 1004, 1007 or 1010, or an ORF encoding Streptococcus pyogenes Cas9 having at least 90% identity with a sequence selected from SEQ ID NO: 1003, 1006 and 1009.
[0055] Embodiment 22 is the composition as described in Embodiment 21, wherein the ORF encoding the amino acid sequence has at least 95% identity with SEQ ID NO: 1003, 1006 or 1009.
[0056] Embodiment 23 is a composition as described in any one of Embodiments 19 to 22, wherein the nuclease has double-stranded endonuclease activity.
[0057] Embodiment 24 is a composition as described in any one of embodiments 18 to 23, wherein the ORF is a modified ORF.
[0058] Embodiment 25 is the composition as described in Embodiment 21, wherein the guide RNA comprises a target sequence identical to the nucleotide sequence of SEQ ID NO:9 and the Streptococcus pyogenes Cas9 comprises an amino acid sequence having at least 95% identity with SEQ ID NO:1001, wherein the nuclease in the Streptococcus pyogenes Cas9 has double-stranded endonuclease activity.
[0059] Embodiment 26 is the composition as described in Embodiment 21, wherein the guide RNA comprises a target sequence comprising the same nucleotide sequence as SEQ ID NO:9 and the Streptococcus pyogenes Cas9 comprises an amino acid sequence comprising the amino acid sequence of SEQ ID NO:1001.
[0060] Embodiment 27 is the composition as described in Embodiment 21, wherein the guide RNA comprises a target sequence comprising a sequence identical to the nucleotide sequence of SEQ ID NO:9, and wherein the Streptococcus pyogenes Cas9 comprises an ORF encoding a sequence having at least 90% identity with a sequence selected from SEQ ID NO:1003, wherein the nuclease in the Streptococcus pyogenes Cas9 has double-stranded endonuclease activity.
[0061] Embodiment 28 is a composition as described in any one of Embodiments 25 to 27, wherein the ORF is a modified ORF.
[0062] Embodiment 29 is a composition as described in any one of Embodiments 25 to 28, wherein the guide RNA comprises the nucleotide sequence of SEQ ID NO: 121 or 109.
[0063] Embodiment 30 is a composition as described in any one of Embodiments 25 to 28, wherein the guide RNA comprises a modified nucleotide sequence of SEQ ID NO: 221 or 209.
[0064] Embodiment 31 is a composition as described in any one of Embodiments 16 to 30, further comprising a pharmaceutical excipient.
[0065] Embodiment 32 is a composition as described in any one of Embodiments 16 to 31, wherein the guide RNA is associated with lipid nanoparticles (LNP).
[0066] Embodiment 33 is the composition as described in Embodiment 32, wherein the LNP comprises a cationic lipid.
[0067] Embodiment 34 is the composition as described in Embodiment 33, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadecane-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadecane-9,12-dienoate.
[0068] Embodiment 35 is a composition as described in any one of Embodiments 32 to 34, wherein the LNP comprises an auxiliary lipid.
[0069] Embodiment 36 is the composition as described in Embodiment 35, wherein the auxiliary lipid is cholesterol.
[0070] Embodiment 37 is a composition as described in any one of Embodiments 32 to 36, wherein the LNP comprises neutral lipids.
[0071] Embodiment 38 is the composition as described in Embodiment 37, wherein the neutral lipid is 1,2-distearate-sn-glycero-3-phosphocholine (DSPC).
[0072] Embodiment 39 is a composition as described in any one of Embodiments 32 to 38, wherein the LNP comprises a hidden lipid.
[0073] Embodiment 40 is the composition as described in Embodiment 39, wherein the elusive lipid is 1,2-dimyristoyl-rac-glycero-3-methoxy polyethylene glycol-2000 (PEG2k-DMG).
[0074] Embodiment 41 is a composition as described in Embodiment 32, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadecane-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadecane-9,12-dienoate; DSPC; cholesterol; and PEG2k-DMG.
[0075] Embodiment 42 is a pharmaceutical composition comprising a guide RNA as described in any one of Embodiments 1 to 15 or a composition as described in any one of Embodiments 16 to 41.
[0076] Embodiment 43 is a pharmaceutical composition comprising a guide RNA as described in any one of Embodiments 1 to 15 or a composition as described in any one of Embodiments 16 to 41; or the use of a guide RNA as described in any one of Embodiments 1 to 15 or a composition as described in any one of Embodiments 16 to 41 for inducing double-strand breaks or single-strand breaks in the PCSK9 gene in cells or reducing the expression of the PCSK9 gene in cells.
[0077] Embodiment 44 is a pharmaceutical composition or use as described in Embodiment 43, wherein the cells are liver cells.
[0078] Embodiment 45 is a pharmaceutical composition or use as described in Embodiment 44, wherein the cells are in a subject.
[0079] Embodiment 46 is a pharmaceutical composition comprising a guide RNA as described in any one of Embodiments 1 to 15 or a composition as described in any one of Embodiments 16 to 41; or the use of a guide RNA as described in any one of Embodiments 1 to 15 or a composition as described in any one of Embodiments 16 to 41 for treating a subject with PCSK9-related disease.
[0080] Embodiment 47 is a method for inducing double-strand breaks or single-strand breaks in the PCSK9 gene in cells or reducing the expression of PCSK9 protein in cells, comprising contacting cells with a guide RNA and an RNA-guided DNA binder as described in any one of Embodiments 1 to 15, or a nucleic acid encoding an RNA-guided DNA binder, or a composition as described in any one of Embodiments 16 to 41.
[0081] Embodiment 48 is the use of a guide RNA as described in any one of Embodiments 1 to 15 or a composition as described in any one of Embodiments 16 to 41 for the preparation of a pharmaceutical agent for carrying out the method as described in Embodiment 47.
[0082] Implementation scheme 49 is a human liver cell containing insertions and deletions (indels) of nucleotide sequences selected from the genomic loci in Table 1.
[0083] Embodiment 50 is a human liver cell as described in Embodiment 49, comprising insertions or deletions selected from the following nucleotide sequences: genomic loci selected from SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18 or 20.
[0084] Embodiment 51 is a method for modifying genomic loci in human liver cells, the method comprising contacting the human liver cells with a guide RNA and an RNA-directed DNA binder as described in any one of Embodiments 1 to 15, or a nucleic acid encoding an RNA-directed DNA binder, or a composition as described in any one of Embodiments 16 to 41.
[0085] Implementation scheme 52 is the method as described in implementation scheme 51, wherein the method is performed in vivo.
[0086] Embodiment 53 is a pharmaceutical composition, method, or cell as described in any one of embodiments 44, 45, 49 to 52, wherein the liver cell is a hepatocyte.
[0087] Embodiment 54 is a pharmaceutical composition, method, or cell as described in Embodiment 53, wherein the cell is in a subject suffering from PCSK9-related disease.
[0088] Embodiment 55 is a method for treating a subject with PCSK9-related disease, the method comprising administering to the subject a guide RNA and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder as described in any one of Embodiments 1 to 15, or a composition as described in any one of Embodiments 16 to 41, or a pharmaceutical composition as described in Embodiment 42.
[0089] Embodiment 56 is a pharmaceutical composition, method, or cell as described in any one of Embodiments 42 to 55, further comprising measuring the PCSK9 protein level in a subject's blood or serum sample.
[0090] Embodiment 57 is the use of a guide RNA as described in any one of Embodiments 1 to 15, or a composition as described in any one of Embodiments 16 to 41, or a pharmaceutical composition as described in Embodiment 42, for the preparation of a pharmaceutical agent for carrying out any one of the methods described in Embodiments 47 or 51 to 56.
[0091] Embodiment 58 is a kit comprising, as described in any one of embodiments 1 to 15, a guide RNA and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, or a composition as described in any one of embodiments 16 to 41, or a pharmaceutical composition as described in any one of embodiments 42 to 46.
[0092] Implementation scheme 59 is a medicine box for use or for implementing the method as described in any one of implementation schemes 47 or 51 to 56. Attached Figure Description
[0093] Figure 1 The dose-dependent curves of the average percentage of editing at the PCSK9 locus in primary human hepatocytes (PHH) treated with various sgRNAs and Cas9 mRNAs are shown.
[0094] Figure 2 The dose-dependent curves of serum PCSK9 levels secreted by PHH treated with Cas9 mRNA and various sgRNAs targeting the PCSK9 locus are shown.
[0095] Figure 3A The average percentage of editing at the human PCSK9 locus in mouse livers after treatment with Cas9 mRNA and specified sgRNA is shown.
[0096] Figure 3BThe percentage of human PCSK9 serum levels knocked down (KD) in mice treated with Cas9 mRNA and specified sgRNA is shown.
[0097] Figure 4A The average percentage of editing at the human PCSK9 locus in mouse livers after treatment with Cas9 mRNA and specified sgRNA is shown.
[0098] Figure 4B The levels of human PCSK9 in mouse serum treated with Cas9 mRNA and specified sgRNA are shown.
[0099] Figure 4C The percentage of human PCSK9 serum levels knocked down (KD) in mice treated with Cas9 mRNA and specified sgRNA is shown.
[0100] Figures 5A to 5B The dose-dependent curves of the average percentage of editing at the PCSK9 locus in primary cynomolgus hepatocytes (PCH) treated with Cas9 mRNA and specified sgRNA are shown.
[0101] Figures 6A to 6C The dose-dependent curves of the average percentage of editing at the PCSK9 locus in PHH treated with Cas9 mRNA and specified sgRNA are shown.
[0102] Figures 7A to 7C The DRC of the average percentage of editing at the PCSK9 locus in PHH treated with Cas9 mRNA and specified sgRNA is shown.
[0103] Figure 8A The average percentage of editing at the human PCSK9 locus in mouse livers after treatment with Cas9 mRNA and specified sgRNA is shown.
[0104] Figure 8B The levels of human PCSK9 in mouse serum treated with Cas9 mRNA and specified sgRNA are shown.
[0105] Figure 8C The percentage of human PCSK9 serum levels knocked down (KD) in mice treated with Cas9 mRNA and specified sgRNA is shown.
[0106] A brief description of the published sequence
[0107] SEQ ID NO describe 1-20 Exemplary PCSK9 guide sequence and chromosome coordinates 101-123 Exemplary unmodified sgRNA sequence targeting PCSK9 201-223 Exemplary modified sgRNA sequences targeting PCSK9 301-309 Exemplary unmodified SpyCas9 scaffold sequence 401-408 Exemplary unmodified SpyCas9 guide RNA sequence 501-512 Exemplary modified SpyCas9 guide scaffold sequence 601-612 Exemplary modified SpyCas9 instruction sequence 1001 Cas9 amino acid sequence with 1x NLS (RNP) 1002 mRNA encoding SpyCas9 1003 Spy Cas9's open reading box 1004 The amino acid sequence of SpyCas9 1005 mRNA encoding SpyCas9 1006 Spy Cas9's open reading box 1007 The amino acid sequence of SpyCas9 1008 mRNA encoding SpyCas9 with a HiBiT tag 1009 Open reading box of Spy Cas9 with HiBiT tag 1010 Amino acid sequence of SpyCas9 with HiBiT tag 1011 Example EMX1 guide RNA (G000644) 1012 Example VEGFA guide RNA (G000645) 1013 Exemplary SV40 NLS 1014 Exemplary SV40 NLS 1015 Exemplary nucleoplasmic protein NLS Detailed Implementation
[0108] Reference will now be made in detail to certain embodiments of this disclosure, examples of which are illustrated in the accompanying drawings. Although the teachings of this invention are described in conjunction with various embodiments, it is not intended to limit the teachings of this invention to those embodiments. Rather, the teachings of this invention encompass various alternatives, modifications, and equivalents, as will be understood by those skilled in the art.
[0109] Before describing the teachings of this invention in detail, it should be understood that this disclosure is not limited to specific compositions or process steps, as such specific compositions or process steps may vary. It should be noted that, unless the context clearly indicates otherwise, as used in this specification and the appended claims, the singular forms “a / an” and “the” include a plurality of indicators. Thus, for example, reference to “a conjugate” includes multiple conjugates and reference to “a cell” includes multiple cells (e.g., a cell population), etc.
[0110] Numerical ranges include the numbers within a defined range. Taking into account significant figures and measurement-related errors, measured and measurable values are understood as approximate values.
[0111] The use of terms “comprise,” “comprises,” “containing,” and “include” is not intended to be restrictive. It should be understood that the foregoing general and detailed descriptions are exemplary and explanatory only, and not intended to limit the teachings. Unless specifically stated in this specification, embodiments in which various components are listed as “comprise” are also considered to “compose of” or “substantially consist of” the listed components; embodiments in which various components are listed are also considered to “include” or “substantially consist of” the listed components; and embodiments in which various components are listed are also considered to “compose of” or “include” the listed components (this interchangeability does not apply to the use of these terms in the claims).
[0112] Unless the context clearly indicates otherwise, the term "or" is used inclusively in this specification and is equivalent to "and / or".
[0113] When the term "about" is used before a list, it modifies each member of the list. The term "about" should be understood to cover permissible variation or error within the art, such as two standard deviations from the average or the sensitivity of the method used to make the measurement. When "about" appears before the first value in a series, it can be understood to modify each value in the series.
[0114] The range should be understood to include the numerical value at the end of the range and all logical values in between. For example, 5-10 nucleotides should be understood as 5, 6, 7, 8, 9, or 10 nucleotides, while 5-10% should be understood as including 5% and 10% and all possible values in between.
[0115] A sequence of at least 17 nucleotides in a 20-nucleotide sequence should be understood to include 17, 18, 19, or 20 nucleotides in the provided sequence, thus providing an upper limit even if not specifically provided due to clear understanding. Similarly, a sequence of at most 3 nucleotides will be understood to cover 0, 1, 2, or 3 nucleotides, providing a lower limit even if not specifically provided. When “at least,” “at most,” or other similar language modifies a number, it can be understood to modify each number in the series.
[0116] As used herein, “no more than” or “less than” should be understood as the value adjacent to the phrase and the logically lower value or integer that is logically consistent with the context, up to zero. For example, the double-stranded region of “no more than 2 nucleotide base pairs” has 2, 1, or 0 nucleotide base pairs. When “no more than” or “less than” appears before a series of numbers or ranges, it should be understood that each number in the series or range is modified.
[0117] As used in this article, the range includes both the upper and lower limits.
[0118] If the sequence in the application conflicts with the specified login number or position within the login number, the sequence in the application shall prevail.
[0119] As used herein, “detection of analyte” should be understood as performing a determination in which an analyte (if present) is detected, wherein the analyte is present in an amount above the detection level of the determination.
[0120] As used herein, it should be understood that when the maximum value is expressed as 100% (e.g., 100% suppression or 100% encapsulation), the value is limited by the detection method. For example, 100% suppression should be understood as suppression to a level below the determined detection level, and 100% encapsulation should be understood as the absence of detectable material intended for encapsulation outside the vesicle.
[0121] The section headings used herein are for organizational purposes only and should not be construed as limiting the intended target in any way. In the event of any material incorporated by reference that contradicts any terminology defined herein or any other express content herein, this specification shall prevail.
[0122] I. Definition
[0123] Unless otherwise stated, the following terms and phrases as used herein are intended to have the following meanings:
[0124] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds containing nucleosides or nucleoside analogs, having nitrogen-containing heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers as analogs thereof. The nucleic acid "backbone" may be composed of a variety of bonds, including one or more of the following: sugar-phosphodiester bonds, peptide-nucleic acid bonds ("peptide-nucleic acid" or PNA; PCT No. WO 95 / 32305), thiophosphate bonds, methylphosphonate bonds, or combinations thereof. The sugar moiety of a nucleic acid may be ribose, deoxyribose, or similar compounds with substitutions (e.g., 2'-methoxy, 2'-halide, or 2'-O-(2-methoxyethyl)(2'-O-moe) substitution). RNA may contain one or more deoxyribonucleotides, for example, as a modification, and similarly, DNA may contain one or more ribonucleotides. The nitrogenous base can be a conventional base (A, G, C, T, U), its analogues (e.g., modified uridine, such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine or other analogues); inosine; or a derivative of a purine or pyrimidine (e.g., N...). 4 -Methyldeoxyguanosine, deza-purine or aza-purine, deza-pyrimidine or aza-pyrimidine, pyrimidine bases with substituents at the 5 or 6 positions (e.g., 5-methylcytosine), purine bases with substituents at the 2, 6 or 8 positions, 2-amino-6-methylaminopurine, O 6 -Methylguanine, 4-thiopyrimidine, 4-aminopyrimidine, 4-dimethylhydrazine-pyrimidine and O 4-alkyl-pyrimidine; U.S. Patent No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion, see The Biochemistry of the Nucleic Acids 5-36, eds. Adams et al., 11th edition, 1992. Nucleic acids may contain one or more “base-free” residues, wherein the backbone does not contain nitrogenous bases for polymer positions (U.S. Patent No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain conventional components and substitutions for both (e.g., conventional nucleosides with a 2'-methoxy substituent, or polymers containing conventional nucleosides and one or more nucleoside analogs). Nucleic acids include “locked nucleic acids” (LNAs), which are analogs containing one or more LNA nucleotide monomers, with bicyclic furanose units locked in a glycoform mimicking RNA, which enhances hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). Nucleic acids include "unlocking nucleic acids," which enable the regulation of thermodynamic stability and also provide stability for nucleases. RNA and DNA have different sugar moieties and can differ due to the presence of uridine or its analogues in RNA and thymine or its analogues in DNA.
[0125] As used herein, "peptide" refers to a multimeric compound containing amino acid residues, which may have a three-dimensional configuration. Peptides include, but are not limited to, enzymes, enzyme precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid-binding proteins, and antibodies. Peptides may, but may not, contain post-translational modifications, non-natural amino acids, or prosthetic groups.
[0126] The terms “guide RNA,” “gRNA,” and simply “guide RNA” are used interchangeably in this document and refer to, for example, a single guide RNA or a combination of crRNA and trRNA (also known as tracrRNA). crRNA and trRNA can associate into a single RNA strand (single guide RNA, sgRNA) or, for example, in two separate RNA strands (dual guide RNA, dgRNA). “Guide RNA” or “gRNA” refers to either sgRNA or dgRNA. trRNA can be a naturally occurring sequence or may contain modifications or variations. Such modifications or variations can be chemically induced.
[0127] As used herein, a “guide sequence” refers to a sequence within guide RNA that is complementary to the target sequence and serves to guide the guide RNA to the target sequence for binding or modification (e.g., cleavage) via an RNA-guided DNA binder. A “guide sequence” may also be referred to as a “target sequence” or a “spacer sequence.” The guide sequence can be approximately 20 nucleotides in length, for example, when used in combination with an RNA-guided DNA binder such as Streptococcus pyogenes (i.e., “Spy”) Cas9. Preferred guide sequence lengths, including shorter or longer sequences, known in the art, may also be used for relevant Cas9 homologs / orthologs.
[0128] For example, the SpyCas9 guide sequence may be 16, 17, preferably 18, 19, or 20 nucleotides long, such that in some embodiments, the SpyCas9 guide sequence comprises 16, 17, 18, 19, or 20 adjacent nucleotides selected from SEQ ID NO:1-20, optionally SEQ ID NO:1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO:9, 14, or 18. In some embodiments, the target sequence is, for example, in a gene or on a chromosome, and is complementary to the guide sequence. In some embodiments, the complementarity or identity between the guide sequence and its corresponding target sequence is at least 80%, 85%, preferably 90% or 95%, or 100%. For example, in some embodiments, the guiding sequence comprises at least 16, 17, preferably 18, 19, or 20 adjacent nucleotides selected from SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18. In some embodiments, the guiding sequence and the target region may be 100% complementary or identical. In other embodiments, the guiding sequence and the target region may contain at least one mismatch, i.e., a different or non-complementary nucleotide, depending on the reference sequence. For example, the guiding sequence and the target sequence may contain 1, 2, 3, or 4 mismatches in the duplex formed by the guiding sequence and the target sequence, wherein the total length of the target sequence is 16, 17, 18, 19, 20, or more nucleotides. In some embodiments, the guiding sequence and the target region may contain 1, 2, 3, or 4 mismatches, wherein the guiding sequence comprises at least 20 nucleotides. In some embodiments, the guiding sequence and target region may contain 1, 2, 3, or 4 mismatches, with the guiding sequence comprising 20 nucleotides. In other words, the guiding sequence and target region may form a double-stranded region with 16, 17, 18, 19, 20, or more base pairs. In some embodiments, the double-stranded region may contain 1, 2, 3, or 4 mismatches, such that the guiding strand and target sequence are not perfectly complementary. For example, the guiding strand and target sequence may be complementary within a 20-nucleotide region, including 2 mismatches, such that the guiding sequence and target sequence are 90% complementary, thereby providing a double-stranded region of 18 base pairs out of 20. Tolerable mismatch locations are known in the art. For example, protospacer adjacent motif (PAM) long-range mismatches tend to be more tolerable than PAM-proximal matches, and the tolerance for mismatches at other locations has been characterized (see, for example, Sternberg et al., 2015, Nature: 527: 110-113).
[0129] The target sequence of the RNA-guided DNA binder (defined by the target sequence of the guiding RNA) can be present on either the positive or negative strand. Tables and other disclosures provided herein list genomic coordinates as target sequences. It should be understood that the guide can be complementary to either the positive or negative strand of the DNA defined by the genomic coordinates. The sequence complementary to the guide depends on the presence of a suitable PAM on the opposite strand of the RNA-guided DNA binder. Thus, in some embodiments, in the case where the guide sequence binds to the inverse complementary sequence of the target sequence, i.e., when the PAM is present on the sense strand, the guide sequence is identical to certain nucleotides of the sense (positive) strand of the target sequence, except that T is replaced by U in the guide sequence.
[0130] As used herein, "RNA-directed DNA binder" or "RNA-directed DNA-binding protein" means a polypeptide or polypeptide complex having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA-binding activity is sequence-specific and depends on the presence of a PAM and the sequence of the guiding RNA. Exemplary RNA-directed DNA binders include Cas lysins / nicking enzymes and their inactivated forms (e.g., "dCas DNA binders"). As used herein, "Cas nuclease" encompasses Cas lysins, Cas nicking enzymes, and dCas DNA binders. Cas nicking enzymes include nucleases in which one of the RuvC or HNH domains of a Cas protein is mutated such that only single-stranded cleavage by the nuclease occurs. dCas DNA binders may be inactive nucleases containing a non-functional nuclease domain (i.e., a RuvC or HNH domain). In some embodiments, Cas lysins or Cas nicking enzymes encompass dCas DNA binders modified to allow DNA cleavage, for example via fusion with a FokI domain.
[0131] Exemplary nucleotide and polypeptide sequences of the Cas9 molecule are provided below. Methods for identifying alternative nucleotide sequences (including alternative naturally occurring variants) encoding the Cas9 polypeptide sequence are known in the art. Sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any of the Cas9 nucleic acid sequences or nucleic acid sequences encoding the amino acid sequences provided herein are also considered. In some embodiments, the nucleotide sequence encoding the Cas9 amino acid sequence is not a naturally occurring Cas9 nucleotide sequence. Sequences having at least 95%, 96%, 97%, 98%, or 99% identity with any of the Cas9 amino acid sequences provided herein are also considered. In some embodiments, the Cas9 amino acid sequence is not a naturally occurring Cas9 sequence.
[0132] An example open reading box for Cas9 is provided in Table 23 below.
[0133] As used herein, the term "connector" refers to a chemical group or molecule that links two adjacent molecules or portions. Typically, a connector is located between or on either side of two groups, molecules, or other portions and is linked to each other via covalent bonds. In some embodiments, the connector is one or more amino acids (e.g., a polypeptide or protein). Exemplary peptide connectors are disclosed elsewhere herein.
[0134] "Modified uridine" is used herein to refer to a nucleoside other than thymidine that has the same hydrogen bond acceptor as uridine and has one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more aprotic substituents (e.g., alkoxy groups, such as methoxy groups) replace a proton. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more aprotic substituents (e.g., alkyl groups, such as methyl groups) replace a proton. In some embodiments, the modified uridine is any one of a substituted uridine, a pseudouridine, or a substituted pseudouridine (e.g., N1-methyl-pseudouridine).
[0135] As used herein, "uridine position" refers to a position in a polynucleotide occupied by uridine or a modified uridine. Thus, for example, a polynucleotide "100% uridine position is modified uridine" contains modified uridine at every position that should be uridine in a conventional RNA of the same sequence (where all bases are standard A, U, C, or G bases). Unless otherwise indicated, U in the polynucleotide sequence of this disclosure or in the sequence listing or sequence listing accompanying this disclosure may be uridine or a modified uridine.
[0136] As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to a guide RNA along with an RNA-directed DNA binder, such as a Cas nuclease, for example a Cas lyase, a Cas nicking enzyme, or a dCas DNA binder (e.g., Cas9). In some embodiments, the guide RNA directs the RNA-directed DNA binder (such as Cas9) to a target sequence, and the guide RNA hybridizes to the target sequence and the binder binds to the target sequence; where the binder is a lyase or a nicking enzyme, cleavage or nicking can occur after binding.
[0137] As used herein, “control” should be understood as an appropriately matched sample or subject used for comparison. For example, a control may be a cell population treated in the same manner as the test population, except that the treatment used for the control population lacks at least one active agent, such as guide RNA, mRNA encoding a nuclease, an insert construct, or a lipid preparation. In some embodiments, a control may be an internal control, such as a cell population or subject before treatment.
[0138] In some embodiments, the “control” in a control subject is a comparison of measurement results, such as diagnostic measurements of signs or symptoms of a disease. In some embodiments, the control may be a subject sample from the same subject at an earlier time point (e.g., before treatment intervention). In some embodiments, the control may be a measurement from a normal subject (i.e., a subject who does not have the disease of the treated subject) to provide a normal control, such as enzyme concentration or activity in a subject sample. In some embodiments, the normal control may be a population control, i.e., the average of subjects in a general population. In some embodiments, the control may be an untreated subject with the same disease. In some embodiments, the control may be a subject treated with different therapies (e.g., standards of care). In some embodiments, the control may be a subject or group of subjects from a natural history study of subjects with the disease of the subject being compared. In some embodiments, certain factors of the control are matched to the subject being tested, such as age and sex. In some embodiments, the control may be a control level from a specific laboratory (e.g., a clinical laboratory). The ability to design or select an appropriate control is within the capabilities of someone skilled in the art. It should be understood that when relative values are provided, the values can be considered relative to an appropriate control.
[0139] As used herein, "purified" in terms such as "purified composition," "purified protein," or "purified nucleic acid" means a composition (or analogue, such as a protein or nucleic acid) in which at least some non-composition (or analogue) components have been removed from the initial composition or mixtures used to prepare the composition (e.g., cells, subject samples, or reaction mixtures) through human intervention. In some embodiments, when the term "purified" is used, the composition (or analogue, such as a protein or nucleic acid) is the major component, such as comprising at least 80%, 85%, 90%, or 95% free of other components.
[0140] As used herein, "subject" includes primates, including human and non-human primates, mice, and rats. In some embodiments, the subject is a human subject. In some embodiments, the subject is a non-human subject. In some embodiments, the subject is a non-human subject expressing one or more human genes, such as a transgenic mouse expressing human genes, or a mouse in which human hepatocytes have been re-implanted into the liver. Such models are well known in the art.
[0141] As used herein, a "target sequence" refers to a nucleic acid sequence in the target gene, either in the positive or negative strand, that is complementary to the guide sequence of the gRNA (i.e., sufficiently complementary to allow for specific binding of the guide sequence). The interaction between the target sequence and the guide sequence guides an RNA-guided DNA binder to bind to the target sequence and potentially cleave or break it within the target sequence (depending on the activity of the binder). The specific length of the target sequence and the number of possible mismatches between the target and guide sequences depend on, for example, the properties (identity) of a Cas nuclease guided by the gRNA.
[0142] As used in this paper, if an alignment of a first sequence with a second sequence shows that all positions in the entire second sequence match those in the first sequence, then the first sequence is considered "identical" to the second sequence or has "100% identity". For example, sequences AAG and AAGA have 100% identity because all three positions in the first sequence match without gaps, thus the alignment will give 100% identity. Identity less than 100% can be calculated using conventional methods. For example, ACG and AAGA have 67% identity because two of the three positions in the first sequence match those in the second sequence (2 / 3 = 67%). Differences between RNA and DNA (typically uridine exchange for thymidine and vice versa) and the presence of nucleoside analogs (such as modified uridine) do not result in differences in identity or complementarity between polynucleotides, provided that the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complementary sequence (e.g., for all thymidine, uridine, or modified uridine, it is adenosine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as complementary sequences). Therefore, for example, the sequence 5'-AXG (where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine) is considered 100% identical to AUG because both are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms well-known in the art. Those skilled in the art will understand which algorithm and parameter settings are appropriate for the sequence pairs to be compared; for sequences of substantially similar length and expected amino acid identity >50% or nucleotide identity >75%, the Needleman-Wunsch algorithm with default settings provided by EBI on the www.ebi.ac.uk web server is generally suitable.
[0143] Similarly, as used herein, a first sequence is considered "perfectly complementary" or "100% complementary" to a second sequence when all nucleotides of the first sequence are complementary to the second sequence without any gaps. For example, the sequence UCU would be considered perfectly complementary to the sequence AAGA because every nucleobase from the first sequence pairs with a nucleotide base of the second sequence without any gaps. The sequence UGU would be considered 67% complementary to the sequence AAGA because two of the three nucleobases from the first sequence pair with nucleobases of the second sequence. Those skilled in the art will understand that algorithms with various parameter settings can be used to determine the percentage of complementarity for any sequence pair using, for example, the NCBI BLAST interface (blast.ncbi.nlm.nih.gov / Blast.cgi) or the Needleman-Wunsch algorithm.
[0144] "Messenger RNA" or "mRNA" as used herein refers to a polynucleotide containing an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by ribosomes and amino-acylated tRNA). mRNA may contain one or more chemically modified nucleosides, such as 5-methylcytidine (5mC), 2-thiouridine (2sU), N1-methylpseuuridine (m1ψU), and pseudouridine (ψU), or modified cap structures, as provided below.
[0145] Exemplary guide sequences that can be used in the guide RNA compositions and methods described herein are shown in Table 1 and throughout the application. For example, where guide sequences are shown in Table 1, these guide sequences can be used in guide RNA to direct an RNA-guided DNA binder (e.g., a nuclease, such as a Cas nuclease, such as Cas9) to a target sequence. The target sequence is provided in Table 1 as genomic coordinates and includes the positive and negative strands of the genomic DNA (i.e., the test sequence and the reverse complementary sequence of said sequence). In some embodiments, where the guide sequence binds to the reverse complementary sequence of the target sequence, the guide sequence is identical to certain nucleotides of the target sequence, except that T is replaced by U in the guide sequence.
[0146] As used herein, “indel” refers to an insertion / deletion mutation consisting of a number of nucleotides inserted or deleted at a double-strand break (DSB) site in a target nucleic acid. As used herein, when an indel results in an insertion, the insertion is a random insertion at the double-strand break site and is not guided by or based on a template sequence.
[0147] As used herein, "inhibition of expression" refers to a reduction (e.g., knockdown or knockout) in the expression of a specific gene product (e.g., protein, mRNA, or both). Protein (i.e., gene product) expression can be measured by detecting the total cellular amount of protein from a tissue sample (e.g., biopsy) or cell population of interest, detecting protein expression in individual members of a cell population, e.g., by cell sorting to define the percentage of cells expressing the protein, or by protein expression in aggregated cells, e.g., by ELISA or Western ink dot assay. Inhibition of expression can be caused by genetic modifications to the gene sequence, such as the genome sequence, such that the full-length gene product or any gene product is no longer detectable, e.g., gene knockdown. Some genetic modifications can cause frameshifts or the introduction of meaningless mutations, thereby preventing the translation of the full-length gene product. Genetic modifications at splice sites, such as at locations sufficiently close to splice acceptor or donor sites to disrupt splicing, can prevent the translation of the full-length protein. Repression of expression can be caused by genetic modification of regulatory sequences within the genome that are required for the expression of a gene product, such as promoter sequences, 3'UTR sequences (e.g., capped sequences), and 5'UTR sequences (e.g., poly A sequences). Repression of expression can also be caused by disrupting the expression or activity of regulatory factors required for the translation of a gene product, such as preventing the production of the gene product. For example, genetic modification of a transcription factor sequence that inhibits the expression of a full-length transcription factor can have downstream effects and inhibit the expression of one or more gene products controlled by the transcription factor. Repression of expression can be predicted by changes in the genome or mRNA sequence. Mutations expected to cause expression suppression can be detected by known methods, including next-generation sequencing of DNA isolated from a tissue sample or cell population of interest. Repression of expression can be determined as the percentage of cells in a population expressing a predetermined level of protein, i.e., a reduction in the percentage or number of cells in the population expressing a protein of interest at at least one level. Repression of expression can also be assessed by determining a decrease in the total protein level in, for example, a cell or tissue sample (e.g., a biopsy sample). In some embodiments, the suppression of secreted protein expression can be assessed in a fluid sample (e.g., cell culture medium or body fluid). Proteins may be present in bodily fluids (e.g., blood or urine) to allow for the analysis of protein levels. In some embodiments, protein levels can be determined by the level of protein activity or metabolites in, for example, urine or blood. In some embodiments, "inhibition of expression" can refer to some loss of expression of a particular gene product, such as a reduction in the amount of mRNA or protein expressed in a tissue sample or by a cell population. In some embodiments, "inhibition" can refer to some loss of expression of a particular gene product, such as on the cell surface or secreted into bodily fluids (e.g., blood).In some implementations, "inhibition" can refer to some loss of expression in one or more cell or tissue types, but not in all cell or tissue types, such as inhibition of expression in the liver but not in other organs. It should be understood that the level of inhibition is relative to the starting level, reference level, or control level in a sample of the same type of subject. For example, routine monitoring of protein levels may be performed in fluid samples (e.g., blood or urine) or tissue samples (e.g., biopsy samples) from the subject. In some implementations, the correlation is known or established, where the level of a biomarker (e.g., in blood or urine) is correlated with the level of inhibition of target gene expression. It should be understood that the level of inhibition is relative to the sample being measured. Similarly, in animal studies where continuous tissue samples (e.g., liver tissue) are available, the target may be expressed in other tissues. Therefore, the level of inhibition is not necessarily the level of inhibition of systemic expression, but rather the level in the tissue, cell type, or sampled fluid.
[0148] As used herein, “genetic modification” refers to changes at the DNA level, such as those induced by CRISPR / Cas9 gRNA and the Cas9 system. Genetic modifications can involve insertions, deletions, or substitutions (i.e., base sequence substitutions, or mutations), typically within a defined sequence or genomic locus. Genetic modifications alter the nucleic acid sequence of DNA. Genetic modifications can occur at a single nucleotide position. Genetic modifications can occur at multiple nucleotide positions, such as 2, 3, 4, 5, or more nucleotides, typically very close to each other, such as adjacent nucleotides. Genetic modifications can occur in coding sequences, such as exon sequences. Genetic modifications can occur at splice sites, i.e., close enough to a splice acceptor or splice donor site to disrupt splicing. Genetic modifications can include the insertion of nucleotide sequences that are not endogenous to a genomic locus, such as the insertion of a heterologous open reading frame or the coding sequence of a gene. As used herein, genetic modifications can be used to prevent the translation of endogenous full-length proteins that have the amino acid sequence of a full-length protein prior to genetic modification of a genomic locus. Preventing the translation of a full-length protein or gene product includes preventing the translation of proteins or gene products of any length. Translation of endogenous full-length proteins can be blocked, for example, by frameshift mutations that lead to premature stop codon generation or by the generation of meaningless mutations. Translation of endogenous full-length proteins can be blocked by disrupting splicing. Translation of full-length proteins can be blocked by inserting heterologous coding sequences. Translation of endogenous full-length proteins can be blocked by altering the coding sequence at one or more locations to provide a modified full-length coding sequence different from the endogenous sequence present in the cell (e.g., correction of point mutations) (e.g., when the endogenous full-length protein contains an unwanted mutation). Translation of endogenous full-length proteins can be blocked by altering the splicing of the endogenous full-length protein to produce different proteins through alternating splicing.
[0149] As used herein, “treatment” should be understood as the reduction of at least one sign or symptom of the disease or indication. Reduction may include a decrease in frequency or severity such that the sign or symptom of the disease is no longer detectable. Treatment may include the administration of more than one dose of an agent. Treatment may include administration in combination with other agents. Effective treatment does not require a cure or complete elimination of the disease or indication. The rate of disease progression or development may be compared to the progression or development of the disease in appropriately matched controls (e.g., population controls, controls from natural history studies). As used herein, “delivery” and “administration” are used interchangeably.
[0150] As used herein, co-application means the administration of multiple substances together in sufficiently close proximity so that the agents work together. Co-application encompasses both the administration of substances together in a single formulation and the administration of substances in separate formulations in sufficiently close proximity so that the agents work together.
[0151] As used herein, the phrase "pharmaceutically acceptable" means that it can be used to prepare pharmaceutical compositions that are generally non-toxic and not biologically undesirable, and is otherwise unacceptable for pharmaceutical use. Pharmaceutically acceptable typically refers to nonpyrogenic substances. Pharmaceutically acceptable can also refer to sterile substances, especially pharmaceutical substances intended for injection or infusion.
[0152] As used herein, “PCSK9” refers to the nucleic acid or protein sequence of “proprotein convertase subtilisin kexin9” or “proprotein convertase subtilisin kexin 9 type”. Human wild-type PCSK9 sequences are available at NCBIGene ID:255738 (worldwide web at ncbi.nlm.nih.gov / gene?cmd=retrieve&dopt=default&rn=1&list_uids=255738, the version available as of the date of this application); Ensembl:ENSG00000169174MIM:607786, chr1:55039548-chr1:55064852. Synonyms for PCSK9 include NARC1, FH3, HCHOLA3, PC9, FHCL3, and LDLCQ1. The PCSK9 gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursor transport through regulatory or constitutive branching of secretory pathways. The encoded protein undergoes autocatalytic processing with its pre-fragment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and trans-Golgi network. The encoded protein is expressed in liver, intestine, and kidney tissues and escorts specific receptors for lysosomal degradation. The PCSK9 protease is involved in regulating circulating LDL cholesterol levels and plays a role in cholesterol and fatty acid metabolism. Certain mutations or overproduction of PCSK9 are associated with cardiovascular disease and chronic liver injury. Single nucleotide polymorphisms and other variations in the human PCSK9 sequence can be found, for example, at www.ncbi.nlm.nih.gov / SNP / snp_ref.cgi?locusId=255738.
[0153] As used herein, the term "within genomic coordinates" includes the boundaries of a given range of genomic coordinates. For example, if chr1:55039548-chr1:55064852 is given, then coordinates chr1:55039548 and chr1:55064852 are covered. Throughout this application, the referenced genomic coordinates are based on genomic annotations from the human genome GRCh38 (also known as hg38) assembly from the Genome Reference Consortium, which is available at the National Center for Biotechnology Information website. Tools and methods for converting genomic coordinates between assemblies are known in the art and can be used to convert the genomic coordinates provided herein to corresponding coordinates in another human genome assembly, including conversion to earlier assemblies generated by the same institution or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversion to assemblies generated by different institutions or algorithms (e.g., from GRCh38 to NCBI33, generated by the International Human Genome Sequencing Consortium). Available methods and tools known in this field include, but are not limited to, NCBI Genome Remapping Service, available on the website of the National Center for Biotechnology Information; UCSC LiftOver, available on the website of the UCSC Genome Brower; and Assembly Converter, available on the website of Ensembl.org.
[0154] II. Composition
[0155] Compositions containing guide RNA (gRNA)
[0156] This document provides compositions that can be used, for example, to alter the DNA sequence within the PCSK9 gene using a guide RNA and an RNA-guided DNA binder (e.g., a CRISPR / Cas system), to induce single-strand breaks (SSBs) or double-strand breaks (DSBs). Guide sequences targeting the PCSK9 gene are shown at SEQ ID NO: 1–20 in Table 1, and the genomic coordinates targeted by such guide RNAs are also shown.
[0157] Each of the guide sequences shown at SEQ ID NO:1–20 in Table 1 may further contain additional nucleotides to form crRNA, for example, having the following exemplary nucleotide sequence at its 3' end after the guide sequence: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:301) in the 5' to 3' orientation.
[0158] In the case of sgRNA, the above-mentioned guide sequence may further include additional nucleotides to form sgRNA, for example having the following exemplary nucleotide sequence after the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:303) in the 5' to 3' orientation.
[0159] In the case of sgRNA, the above-mentioned guide sequence may further include additional nucleotides to form sgRNA, for example having the following exemplary nucleotide sequence after the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:302) in the 5' to 3' orientation.
[0160] In the case of sgRNA, the guide sequence can be integrated into the following modified motif: mN*mN*mN*NNNNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUm AmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmC mCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO:601), where “N” can be any natural or non-natural nucleotide, preferably an RNA nucleotide; the sugar portion of the nucleotide can be ribose, deoxyribose, or a similar compound with substitutions; m is a 2'-O-methyl modified nucleotide, and * is a phosphate thioester bonded to an adjacent nucleotide residue; and N' together form the nucleotide sequence of the guide sequence. In the context of the modified sequence, A, C, G, N, and U are unmodified RNA nucleotides, i.e., 2'-OH sugar moieties with phosphodiesterase bonds to adjacent nucleotide residues, or 5'-terminal PO4.
[0161] In the case of sgRNA, the guide sequence may further include a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is shown in the table below (SEQ ID NO:303: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGC – “Exemplary SpyCas9 sgRNA-1”), which includes the 3' end of the guide sequence and has the domains shown in Table A below. LS is the lower stem. B is the protrusion. US is the upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. H1 and H2 are collectively referred to as the hairpin region. A model of the structure is provided in Figure 10A of WO2019237069, which is incorporated herein by reference.
[0162] The nucleotide sequence of the exemplary SpyCas9 sgRNA-1 can serve as a template sequence for specific chemical modifications, sequence substitutions, and truncations.
[0163] In some embodiments, the gRNA is, for example, sgRNA or dgRNA, and optionally contains chemical modifications. In some embodiments, the modified sgRNA comprises a guide sequence and a SpyCas9 sgRNA sequence, such as the exemplary SpyCas9sgRNA-1. The gRNA (such as sgRNA) may contain modifications at the 5' end of the guide sequence or at the 3' end of the SpyCas9 sgRNA sequence, such as at one, two, three, or four nucleotides at the 3' or 5' end of the exemplary SpyCas9sgRNA-1. In some embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, or reverse-base-free modified nucleotides; or combinations thereof. In some embodiments, the modified nucleotide includes a 2'-OMe modified nucleotide. In some embodiments, the modified nucleotide includes a PS bond. In some implementations, the modified nucleotides include 2'-OMe modified nucleotides and PS bonds.
[0164] In some implementations, using SEQ ID NO:303 (as shown in Table A, “Exemplary SpyCas9 sgRNA-1”) as an example, Exemplary SpyCas9 sgRNA-1 further comprises one or more of the following:
[0165] A. A shortened section of the hairpin, or alternatively, a shortened section of the hairpin, wherein...
[0166] 1. In hairpin 1, at least one of the following nucleotide pairs is replaced by a Watson-Crick pairing nucleotide: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region is optionally missing.
[0167] a. Any one or two of H1-5 to H1-8
[0168] b. One, two, or three of the following nucleotide pairs: H1-1 with H1-12, H1-2 with H1-11, H1-3 with H1-10, and H1-4 with H1-9, or
[0169] c. 1-8 nucleotides in region 1 of the hairpin; or
[0170] 2. The shortened hairpin region 1 lacks 4-8 nucleotides, preferably 4-6 nucleotides; and
[0171] a. One or more of positions H1-1, H1-2, or H1-3 are deleted or substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 303), or
[0172] b. One or more of positions H1-6 to H1-10 are substituted relative to the exemplary SpyCas9sgRNA-1 (SEQ ID NO:303); or
[0173] 3. The shortened hairpin region 1 lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted relative to the exemplary SpyCas9sgRNA-1 (SEQ ID NO:303); or
[0174] B. A shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include fewer than or equal to 4 substitutions relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO:303); or
[0175] C. Substitutions relative to one or more of the exemplary SpyCas9 sgRNA-1 (SEQ ID NO:303) at any one of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substituent nucleotide is neither a pyrimidine followed by an adenine nor an adenine preceded by a pyrimidine; or
[0176] D. An exemplary SpyCas9 sgRNA-1 (SEQ ID NO:303) having an upper stem region, wherein the upper stem modification comprises modification of any one or more of US1-US12 in the upper stem region, wherein
[0177] 1. The modified nucleotide is optionally selected from nucleotides modified with 2'-O-methyl (2'-OMe), nucleotides modified with 2'-O-(2-methoxyethyl)(2'-O-moe), nucleotides modified with 2'-fluoro (2'-F), nucleotides linked by phosphate thioester (PS) bonds, nucleotides without reverse base modification, or combinations thereof; or
[0178] 2. The modified nucleotides optionally include nucleotides modified with 2'-OMe.
[0179] In some implementations, the exemplary SpyCas9 sgRNA-1 is missing 6 nucleotides in the shortened hairpin 1.
[0180] In some implementations, the exemplary SpyCas9 sgRNA-1 is missing 8 nucleotides in the shortened hairpin 1.
[0181] In some implementations, H-1 and H-3 are missing in the exemplary SpyCas9 sgRNA-1.
[0182] In some embodiments, the exemplary SpyCas9 sgRNA-1 further includes a 3' tail. In some embodiments, the 3' tail is 1-4 nucleotides in length, optionally 1 nucleotide in length.
[0183] In some implementations, the exemplary SpyCas9 sgRNA-1 includes an upper stem region containing modifications to any one or more of US1-US12 in the upper stem region.
[0184] In some embodiments, the exemplary SpyCas9 sgRNA-1 or sgRNA (such as sgRNA containing the exemplary SpyCas9 sgRNA-1) further comprises a 3' tail, such as a 3' tail of 1, 2, 3, 4 or more nucleotides. In some embodiments, the tail comprises one or more modified nucleotides. In some embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, 2'-deoxy (2'-H-) modified nucleotides, baseless nucleotides, locked nucleic acid (LNA) nucleotides, unlocked nucleic acid (UNA) nucleotides, or phosphate thioester (PS) bonds between nucleotides, terminally reverse baseless nucleotides; or combinations thereof. In some embodiments, the modified nucleotide includes a 2'-OMe modified nucleotide. In some embodiments, the modified nucleotide comprises a PS bond between nucleotides. In some implementations, the modified nucleotide comprises a 2'-OMe modified nucleotide and a PS bond between the nucleotides.
[0185] In some embodiments, the hairpin region comprises one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free nucleotides, or combinations thereof. In some embodiments, the modified nucleotides include 2'-OMe modified nucleotides.
[0186] In some embodiments, the upper stem region comprises one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free nucleotides, or combinations thereof. In some embodiments, the modified nucleotides include 2'-OMe modified nucleotides.
[0187] In some embodiments, the exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is pyrimidine, and the YA dinucleotide includes a modified nucleotide. In some embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free nucleotides, or combinations thereof. In some embodiments, the modified nucleotide includes a 2'-OMe modified nucleotide.
[0188]
[0189] Table 1: PCSK9 guide sequence and chromosome coordinates
[0190]
[0191] Table 2: Exemplary unmodified and modified sgRNA sequences targeting PCSK9
[0192]
[0193]
[0194]
[0195]
[0196]
[0197] In the table above, in the context of unmodified sequences, A, C, G, U, and N are independently any natural or non-natural adenine, cytosine, guanine, uridine, and any nucleotide (e.g., A, C, G, or U). In the context of modified sequences, m indicates a 2'-O-methyl modified nucleotide; * indicates a phosphate thioester nucleotide linker; and A, C, G, U, and N are RNA nucleotides, i.e., when present, the 2'-OH and phosphodiesterase are linked to the 3' nucleotide.
[0198] In some embodiments, a composition is provided comprising one or more guide RNAs (gRNAs) including a guide sequence that directs an RNA-guided DNA binder to a target DNA sequence in PCSK9, wherein the RNA-guided DNA binder may be a nuclease (e.g., a Cas nuclease such as Cas9, such as SpyCas9 lyase). In some embodiments, an engineered cell is provided that contains a genetic modification in the human PCSK9 sequence within genomic coordinates at chr1:55039548..55064852. In some embodiments, an engineered cell is provided that contains a genetic modification in the human PCSK9 sequence, wherein the genetic modification comprises a modification corresponding to at least one nucleotide within genomic coordinates of a PCSK9 guide sequence selected from SEQ ID NO:1-20, optionally SEQ ID NO:1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO:9, 14 or 18. In some embodiments, an engineered cell is provided that contains genetic modifications in the human PCSK9 sequence, wherein the genetic modifications include modifications of at least one nucleotide selected from the genomic coordinates in Table 1.
[0199] In some embodiments comprising gRNA, the gRNA may comprise crRNA containing the guide sequences shown in Table 1 as guide sequences. In some embodiments, the gRNA contains the guide sequences shown in Table 1, for example, as sgRNA. In some embodiments, the gRNA may comprise a guide sequence selected from SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18, or 20. In some embodiments, the gRNA may comprise a guide sequence selected from SEQ ID NO: 9, 14, or 18.
[0200] The gRNA may contain a guide sequence comprising the guide sequences shown in Table 1, such as SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally 16 or 17 of SEQ ID NO: 9, 14, or 18, preferably 18, 19, or 20 adjacent nucleotides. In some embodiments, the gRNA contains a guide sequence having at least 80%, 85%, preferably 90%, 95%, or 100% identity with the guide sequences shown in Table 1 (SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18). In the embodiments described herein, the gRNA may comprise crRNA and trRNA associated as a single RNA (sgRNA) or as separate RNAs (dgRNA). In the context of sgRNA, the crRNA and trRNA components may be covalently linked, for example, via a phosphodiester bond or other covalent bond.
[0201] In the embodiments described herein, the gRNA may comprise crRNA and trRNA associated as a single RNA (sgRNA) or as separate RNAs (dgRNA). In the context of sgRNA, the crRNA and trRNA components may be covalently linked, for example, via phosphodiester bonds or other covalent bonds.
[0202] In the embodiments described herein, the guide RNA may comprise two non-covalently linked RNA strands as a “dgRNA” or “double guide RNA”. The dgRNA comprises a first RNA molecule containing crRNA and a second RNA molecule containing trRNA, the crRNA containing, for example, the guide sequences shown in Table 1. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex via base pairing between portions of the crRNA and trRNA.
[0203] In the various embodiments described herein, the guide RNA may comprise a single RNA molecule as a “single guide RNA” or “sgRNA”. The sgRNA may comprise a crRNA (or a portion thereof) covalently linked to a trRNA, said crRNA comprising the guide sequences shown in Table 1 or selected from SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally the guide sequences of SEQ ID NO: 9, 14 or 18.
[0204] The sgRNA may comprise the guide sequence shown in Table 1 or 16, 17, 18, or 20 of the guide sequence of SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18, or 20, preferably 18, 19, or 20 adjacent nucleotides. In some embodiments, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure via base pairing between portions of the crRNA and trRNA. In some embodiments, the crRNA and trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.
[0205] In some embodiments, the trRNA may comprise a trRNA sequence, wholly or partially derived from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 55, 60, 65, 70, 75, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise certain secondary structures, such as one or more hairpin or stem-loop structures, or one or more protrusion structures.
[0206] In some embodiments, a composition is provided comprising one or more guide RNAs comprising a guide sequence comprising any one of SEQ ID NO:1-20, optionally SEQ ID NO:1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO:9, 14 or 18.
[0207] In some embodiments, a composition is provided comprising one or more sgRNAs comprising SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally any one of SEQ ID NO: 9, 14 or 18.
[0208] In one aspect, a composition is provided comprising a gRNA containing a guide sequence having at least 90% or 95% identity with any one of the nucleic acids of SEQ ID NO: 1-20, optionally SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO: 9, 14 or 18.
[0209] In some embodiments, a composition is provided comprising at least one, for example, at least two gRNAs, said gRNAs comprising one or more guide sequences selected from SEQ ID NO:1-20, optionally SEQ ID NO:1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO:9, 14 or 18. In some embodiments, the composition comprises at least two gRNAs, each comprising a guide sequence having at least 90% or 95% identity with any one of the nucleic acids of SEQ ID NO:1-20, optionally SEQ ID NO:1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO:9, 14 or 18.
[0210] The guide RNA compositions provided herein are designed to recognize target sequences in the PCSK9 gene (e.g., hybridization with ). For example, the PCSK9 target sequence can be recognized and cleaved by a Cas lyase containing the guide RNA provided. In some embodiments, an RNA-guided DNA binder (such as a Cas lyase, e.g., SpyCas9 lyase) can be guided by the guide RNA to the target sequence of the PCSK9 gene, wherein the guide sequence of the guide RNA hybridizes with the target sequence and the RNA-guided DNA binder, such as the Cas lyase, cleaves the target sequence.
[0211] In some implementations, the selection of one or more guide RNAs is determined based on target sequences within the PCSK9 gene.
[0212] Unbound by any particular theory, mutations in certain regions of a gene (e.g., frameshift mutations caused by insertions or deletions, resulting from nuclease-mediated DSBs) may be less acceptable than mutations in other regions of the gene. Therefore, the location of the DSB is a significant factor in the amount or type of protein knockdown that may result. In some implementations, a gRNA complementary to or having complementary properties to a target sequence within PCSK9 is used to guide an RNA-directed DNA binder to a specific location within the appropriate PCSK9 gene.
[0213] In some embodiments, the Spy guide sequence is at least 90% or 95%; or 100% complementary to the inverse complementary sequence of the target sequence present in the human PCSK9 gene. In some embodiments, the target sequence is complementary to the guide sequence of the guide RNA. In some embodiments, the complementarity or identity between the guide sequence of the Spy guide RNA and its corresponding target sequence is at least 80%, 85%, preferably 90% or 95%; or 100%. In some embodiments, the target sequence may be 100% complementary to or identical to the guide sequence of the Spy gRNA.
[0214] In some embodiments, the target sequence and the guide sequence of the Spy gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, wherein the total length of the guide sequence is 20 nucleotides. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1 to 4 mismatches, wherein the guide sequence is 20 nucleotides long.
[0215] In some embodiments, the Spy directive sequence comprises at least 16, 17, preferably 18, 19, or 20 adjacent nucleotides selected from SEQ ID NO:1-20, optionally SEQ ID NO:1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO:9, 14, or 18.
[0216] In some embodiments, the compositions or formulations disclosed herein comprise mRNA containing an open reading frame (ORF) encoding an RNA-directed DNA binder, such as the Cas nuclease described herein. In some embodiments, mRNA comprising an ORF encoding an RNA-directed DNA binder such as a Cas nuclease is provided, used, or administered.
[0217] Modified gRNA and mRNA
[0218] In some embodiments, the gRNA is chemically modified. A gRNA containing one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or "chemically modified" gRNA to describe the presence of one or more non-natural or naturally occurring components or configurations used to replace or complement canonical A, G, C, and U residues. In some embodiments, modified gRNA synthesized using non-canonical nucleosides or nucleotides is referred to herein as "modified". Modified nucleosides and nucleotides may include one or more of the following: (i) altering (e.g., replacing) one or two non-linked phosphate oxygens or one or more linked phosphate oxygens in the phosphodiester backbone (exemplary backbone modification); (ii) altering (e.g., replacing) the composition of the ribose (e.g., the 2' hydroxyl group on the ribose) (exemplary sugar modification); (iii) modifying or replacing naturally occurring nucleobases, including using non-canonical nucleobases (exemplary base modification); and (iv) modifying the nucleotides at the 3' or 5' end of the oligonucleotide, for example to provide exonuclease stability, such as ribose modified by 2'O-me, 2' halide, or 2' deoxygenated substitution; or reverse base-free terminal nucleotides, or replacing the phosphodiester with a thiophosphate.
[0219] Chemical modifications (such as those listed above) can be combined to provide modified gRNA or mRNA comprising two, three, four, or more modified nucleosides and nucleotides (collectively, “residues”). For example, the modified residues may have modified sugars and modified nucleobases. In some embodiments, the phosphate group of the gRNA molecule is replaced by a thiophosphate group. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5' end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3' end of the RNA.
[0220] In some embodiments, the gRNA contains one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, 10%, 15%, preferably at least 20%, 25%, 30%, 35%, 40%, 45%, or 50%) of the modified gRNA is a modified nucleoside or nucleotide. In some embodiments, at least 5% of the modified guide RNA is a modified nucleotide or nucleoside. In some embodiments, at least 10% of the modified guide RNA is a modified nucleotide or nucleoside. In some embodiments, at least 15% of the modified gRNA is a modified nucleotide or nucleoside. In some embodiments, preferably at least 20% of the modified gRNA is a modified nucleotide or nucleoside. In some embodiments, no more than 65% of the modified gRNA is a modified nucleotide. In some embodiments, no more than 55% of the modified gRNA is a modified nucleotide. In some embodiments, no more than 50% of the modified gRNA is a modified nucleotide. In some embodiments, 10%-70% of the modified gRNA consists of modified nucleotides. In some embodiments, 20%-70% of the modified gRNA consists of modified nucleotides. In some embodiments, 20%-80% of the modified gRNA consists of modified nucleotides. In some embodiments, 20%-50% of the modified gRNA consists of modified nucleotides, and the nuclease is SpyCas9 nuclease.
[0221] Unmodified nucleic acids are readily degraded by, for example, intracellular nucleases or nucleases found in serum. For instance, nucleases can hydrolyze the phosphodiester bonds of nucleic acids. Therefore, in one aspect, the gRNAs described herein may contain one or more modified nucleosides or nucleotides, for example, to introduce stability against intracellular or serum-based nucleases. In some embodiments, the modified gRNA molecules described herein may exhibit a reduced innate immune response when introduced into cell populations in vivo and in vitro. The term "innate immune response" includes cellular responses to exogenous nucleic acids (including single-stranded nucleic acids) involving the induction of cytokine expression and release (specifically, interferon), and cell death.
[0222] In some embodiments of main-chain modification, the phosphate ester groups of the modified residues can be modified by replacing one or more oxygen atoms with different substituents. Furthermore, the modified residues (e.g., modified residues present in the modified nucleic acid) may include replacing unmodified phosphate ester moieties with modified phosphate ester groups as described herein. In some embodiments, main-chain modification of the phosphate backbone may include alterations resulting in uncharged joints or charged joints with an asymmetric charge distribution.
[0223] Examples of modified phosphate groups include thiophosphates, boroalkyl phosphates, methylphosphonates, phosphoramides, dithiophosphates, alkylphosphonates or arylphosphonates, and phosphate triesters. The phosphorus atom in an unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygen atoms with one of the aforementioned atoms or groups can make the phosphorus atom chiral. Stereoisomeric phosphorus atoms can have an "R" configuration (Rp in this case) or an "S" configuration (Sp in this case). The backbone can also be modified by replacing bridging oxygens (i.e., linking the phosphate ester to the oxygen of the nucleoside) with nitrogen (bridging phosphoramides), sulfur (bridging thiophosphates), and carbon (bridging methylenephosphonates). Substitution can occur at any of the linked oxygens or at both linked oxygens.
[0224] In certain main-chain modifications, the phosphate ester group may be replaced by a phosphorus-free linking group (e.g., an amide bond). In some embodiments, the charged phosphate ester group may be replaced by a neutral portion. Examples of portions that can replace the phosphate ester group include, but are not limited to, methylphosphonates, carboxymethyl esters, carbamates, amides, and thioethers. Other examples of portions that can replace the phosphate ester group include, but are not limited to, ethylene oxide connectors, sulfonates, sulfonamides, thiomethyl acetals, methyl acetals, methyleneimino, methylenemethylimino, methylenehydrazine, methylenedimethylhydrazine, and methyleneoxymethylimino.
[0225] Nucleic acid-mimicking scaffolds can also be constructed, wherein the phosphate linkers and ribose are replaced by nuclease-resistant nucleosides or nucleotide substitutes. Such modifications can include backbone and sugar modifications. In some embodiments, nucleobases can be tethered by alternative backbones. Examples include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside substitutes.
[0226] Modified nucleosides and modified nucleotides may include one or more modifications to the sugar group, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) may be modified, for instance, by being replaced with various different "oxygen" or "deoxy" substituents. In some embodiments, modification of the 2' hydroxyl group can enhance the stability of the nucleic acid because the hydroxyl group can no longer be deprotonated to form a 2'-alkoxide ion.
[0227] Examples of 2' hydroxyl modification may include alkoxy or aryloxy (OR, where "R" may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), O(CH2CH2O). nCH2CH2OR, where R may be, for example, H or an optionally substituted alkyl group, and n may be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In some embodiments, the 2' hydroxyl modification may be 2'-O-Me. In some embodiments, the 2' hydroxyl modification may be a 2'-fluorine modification, in which the 2' hydroxyl group is replaced by a fluoride. In some embodiments, the 2' hydroxyl modification may include a "locked" nucleic acid (LNA), wherein the 2' hydroxyl group may be, for example, via C... 1-6 Alkylene or C 1-6 A heteroalkylene bridge is attached to the 4' carbon of the same ribose, wherein exemplary bridges may include methylene, propylene, ether, or amino bridges; O-amino (wherein the amino group may be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH2). n -Amino group (wherein the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl modification may include an "unlocked" nucleic acid (UNA) where the ribose ring lacks the C2'-C3' bond. In some embodiments, the 2' hydroxyl modification may include methoxyethyl (MOE) (OCH2CH2OCH3, for example, a PEG derivative). The 2' modification may include hydrogen (i.e., deoxyribose); a halogen (e.g., bromine, chlorine, fluorine, or iodine); an amino group (wherein the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH (CH2CH2NH). n CH2CH2-amino (wherein the amino group may be, for example, as described herein), -NHC(O)R (wherein R may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl groups, which may optionally be substituted with an amino group, for example, as described herein.
[0228] Sugar modifications may include a sugar group, which may also contain one or more carbons having a stereochemical configuration opposite to that of the corresponding carbon in ribose. Therefore, modified nucleic acids may include nucleotides containing, for example, arabinose as a sugar. Modified nucleic acids may also contain abasic sugars. These abasic sugars may also be further modified at one or more constituent sugar atoms. Modified nucleic acids may also contain one or more sugars in the L-form, such as L-nucleotides. As used herein, a single abasic sugar should not be construed as causing a break in the double strand.
[0229] In some implementations, the 2' modification includes, for example, 2'-OMe, 2'-F, or 2'-H, optionally 2'-O-Me.
[0230] The modified nucleosides and modified nucleotides described herein that can be incorporated into modified nucleic acids may include modified bases, also referred to as modified nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uridine (U). These nucleobases may be modified or completely substituted to provide modified residues that can be incorporated into modified nucleic acids. The nucleobases of nucleotides may be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases may include, for example, naturally occurring and synthetic derivatives of the base.
[0231] In embodiments employing dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. These modifications may be at one or both ends of the crRNA or tracrRNA. In embodiments containing sgRNA, one or more residues located at one or both ends of the sgRNA may be chemically modified, or internal nucleotides may be modified, or the entire sgRNA may be chemically modified. Some embodiments include a 5' end modification. Some embodiments include a 3' end modification. Some embodiments include both 5' and 3' end modifications.
[0232] In some embodiments, the guide RNA disclosed herein comprises one of the modification patterns disclosed in WO2018 / 107028, the contents of which are incorporated herein by reference in full. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in US20170114334, the contents of which are incorporated herein by reference in full. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in WO2017 / 136794, the contents of which are incorporated herein by reference in full. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in WO2019 / 237069, the contents of which are incorporated herein by reference in full. In some embodiments, the guide RNA disclosed herein comprises one of the structural / modification patterns disclosed in WO2021 / 119275, the contents of which are incorporated herein by reference in full.
[0233] In some implementations, the sgRNA comprises any of the modification patterns shown herein, wherein N is any natural or non-natural nucleotide, and wherein N as a whole comprises the PCSK9 guide sequence as described in Table 1 herein. In some implementations, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNNNGU UUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAU AAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmG mUmGmGmGmGmCmAmCmGmGmGmGmGmGmGmGmGmGmGmCmU*mU*mU*mU (SEQ ID NO: 601), wherein N comprises the PCSK9 guide sequence as described in Table 1, for example, in the case where N is replaced by any of the guide sequences disclosed in Table 1 herein, optionally wherein N is replaced by SEQ ID NO: 1-20, optionally SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO: 9, 14 or 18.
[0234] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, wherein N is any natural or non-natural nucleotide, and wherein the entirety of N comprises the PCSK9 guide sequence as described in Table 1 herein. In some embodiments, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNNNGU UUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAU AAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (SEQ ID NO: 607), wherein the entirety of N comprises the PCSK9 guide sequence as described in Table 1, for example, where N is replaced by any of the guide sequences disclosed in Table 1 herein, optionally wherein N is replaced by PCSK9 numbers 1-20, optionally SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO: 9, 14 or 18.
[0235] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, wherein N is any natural or non-natural nucleotide, and wherein the entirety of N comprises the PCSK9 guide sequence as described in Table 1 herein. In some embodiments, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNNNGU UUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAU AAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGmU*mG*mC*mU (SEQ ID NO: 612), wherein the entirety of N comprises the PCSK9 guide sequence as described in Table 1, for example, in the case where N is replaced by any of the guide sequences disclosed in Table 1 herein, optionally wherein N is replaced by SEQ ID NO: 1-20, optionally SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO: 9, 14 or 18.
[0236] Any of the modifications described below can be present in the gRNA and mRNA described herein.
[0237] In the context of chemically modified sequences, “A”, “C”, “G”, “N” and “U” represent RNA nucleotides, i.e., 2'-OH with a phosphodiesterase bond to a 3' nucleotide.
[0238] The terms “mA”, “mC”, “mU”, or “mG” are used to represent adenine, cytosine, uridine, or guanidine nucleotides that have been modified with 2'-O-Me, respectively.
[0239] The modification of 2'-O-methyl can be described as follows:
[0240]
[0241] Another chemical modification that has been shown to affect the sugar ring of nucleotides is halogen substitution. For example, 2'-fluorine (2'-F) substitution on the sugar ring of nucleotides can increase oligonucleotide binding affinity and nuclease stability.
[0242] In this application, the terms “fA”, “fC”, “fU”, or “fG” are used to denote nucleotides that have been substituted with 2'-F.
[0243] The substitution of 2'-F can be described as follows:
[0244]
[0245] A phosphate thioester (PS) bond or linkage refers to a non-bridging phosphate ester oxygen bond in a phosphate diester linkage, such as a bond between nucleotide bases. When phosphate thioesters are used to produce oligonucleotides, the modified oligonucleotides can also be called S-oligonucleotides.
[0246] The asterisk (*) is used to indicate a PS modification. In this application, the terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3') nucleotide via a PS bond.
[0247] In this application, the terms “mA*”, “mC*”, “mU*” or “mG*” are used to denote a nucleotide that has been replaced by 2'-O-Me and linked to the next (e.g., 3') nucleotide via a PS bond.
[0248] The diagram below shows how S- is replaced with a non-bridged phosphate ester oxygen, thereby generating a PS bond instead of a phosphodiester bond:
[0249]
[0250] A base-free nucleotide is a nucleotide that lacks a nitrogenous base. The image below depicts an oligonucleotide with a base-free (also called depurinated) site lacking a base: As used in this article, the presence of a single base-free site should not be considered as disrupting the duplex, such as the duplex formed between the target sequence of RNA and the target site in the genome:
[0251]
[0252] A reverse base is a base that has a bond that is the reverse of the normal 5' to 3' bond (i.e., a 5' to 5' bond or a 3' to 3' bond). Such reverse bases exist only as terminal nucleotides. In 3' to 5' chemical synthesis methods, the reverse base does not have a 5' hydroxyl group that can be used to grow the chain. For example:
[0253]
[0254] Abase-free nucleotides can be linked by reverse bonding. For example, an abase-free nucleotide can be linked to a terminal 5' nucleotide via a 5'-to-5' bond, or to a terminal 3' nucleotide via a 3'-to-3' bond. The reverse abase-free nucleotide at the terminal 5' or 3' nucleotide can also be called a reverse abase-free cap.
[0255] In some embodiments, one or more of the first three, four, or five nucleotides at the 5' end and one or more of the last three, four, or five nucleotides at the 3' end are modified. In some embodiments, the modification is a 2'-O-Me, 2'-F, reverse abase-free nucleotide, PS bond, or other nucleotide modifications known in the art to increase stability or performance.
[0256] In some implementations, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked by phosphate thioester (PS) bonds.
[0257] In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise nucleotides modified with 2'-O-methyl (2'-O-Me). In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise nucleotides modified with 2'-fluorine (2'-F). In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise inverted abase-free nucleotides.
[0258] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern shown in mN*mN*mN*NNNNNNNNNNNNNNNNNNNGUU UUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAUA AGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGm UmGmGmGmCmAmCmGmGmGmGmCmGmGmGmGmGmCmU*mU*mU*mU (SEQ ID NO: 601), where N is any natural or non-natural nucleotide, or where N as a whole comprises a guide sequence that guides the nuclease to the target sequence in PCSK9 (e.g., the genomic coordinates shown in Table 1, such as SEQ ID NO: 1-20, optionally SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO: 9, 14 or 18).
[0259] In some embodiments, the guide RNA comprises an sgRNA containing any one of the guide sequences SEQ ID NO: 1-20, optionally SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO: 9, 14 or 18, and a conserved portion of the sgRNA, such as the conserved portion of the sgRNA shown in the exemplary SpyCas9 sgRNA-1, or the conserved portion of the gRNA shown in Tables 3 to 4 or throughout this specification. In some embodiments, the guide RNA comprises an sgRNA containing any one of the guide sequences SEQ ID NO: 1-20, optionally SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO: 9, 14 or 18, and a nucleotide of the sequence GUUUUAGAGC UAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 302), wherein the nucleotide is located at the 3' end of the guide sequence, and wherein the sgRNA may be as shown herein or in the sequence mN*mN*mN*NNNNNNNNNNNNNNNNNG UUUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAA The sgRNA is modified in the form UAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmGmGmCmGmGmU*mU*mU*mU (SEQ ID NO: 601). In some embodiments, the sgRNA comprises the exemplary SpyCas9 sgRNA-1 provided herein or a modified form thereof, or as provided in Tables 3B or 4B, wherein the N as a whole comprises a guide sequence that directs the nuclease to the target sequence. Each N is independently modified or unmodified. In some embodiments, in the absence of a modification indicator, the nucleotide is an unmodified RNA nucleotide residue, i.e., the ribose and phosphodiester backbone.
[0260] Table 3A: Exemplary unmodified SpyCas9 scaffold sequences
[0261]
[0262] Table 3B: Exemplary unmodified SpyCas9 guide RNA sequences
[0263]
[0264] N is the guiding sequence provided herein. In the table, A, C, G, U, and N are, in the context of unmodified sequences, any natural or non-natural adenine, cytosine, guanine, uridine, and any nucleotide (e.g., A, C, G, or U).
[0265] Table 4A: Exemplary modified SpyCas9 guide scaffold sequences
[0266]
[0267]
[0268] Table 4B: Exemplary modified SpyCas9 instruction sequences
[0269]
[0270]
[0271] Where “m” indicates 2’-O-Me modification, “f” indicates 2’-fluorine modification, “*” indicates phosphate thioester bond between nucleotides, and no modification in the context of the modified sequence indicates RNA (2’-OH) and phosphodiesterase bond to the 3’ nucleotide (when one is present).
[0272] In some embodiments, the chemically modified scaffold sequences in Table 4A further include chemically modified targeting sequences. In some embodiments, the guiding sequence for chemical modification is (mN*)3(N)13-17. In some embodiments, the guiding sequence is (mN*)3(N)17, i.e., mN*mN*mN*NNNNNNNNNNNNNNNNN. In some embodiments, each N in (N)13-17 or (N)17 is unmodified. In some embodiments, each N in (N)13-17 or (N)17 is independently modified, for example, independently modified with a 2'-O-methyl group.
[0273] As shown above, in some embodiments, the compositions or formulations disclosed herein comprise mRNA containing an open reading frame (ORF) encoding an RNA-directed DNA binder, such as a Cas nuclease, for example, the Cas9 nuclease described in Table 23. In some embodiments, mRNA comprising an ORF encoding an RNA-directed DNA binder such as a Cas nuclease, for example, the Cas9 nuclease, is provided, used, or administered. In some embodiments, the ORF encoding an RNA-directed DNA nuclease is referred to as a “modified RNA-directed DNA binder ORF” or simply “modified ORF,” used as an abbreviation to indicate ORF modification.
[0274] In some embodiments, the mRNA or modified ORF may contain modified uridine at at least one, multiple, or all uridine positions. In some embodiments, the modified uridine is uridine modified at the 5-position, for example, with halogen, methyl, or ethyl. In some embodiments, the modified uridine is pseudouridine modified at the 1-position, for example, with halogen, methyl, or ethyl. The modified uridine may be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or combinations thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methylpseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.
[0275] In some embodiments, the mRNA disclosed herein includes a 5' cap, such as Cap0, Cap1, or Cap2. The 5' cap is typically a 7-methylguanine ribonucleotide (which may be further modified, as discussed below for example with regard to ARCA), linked by a 5'-triphosphate to the first nucleotide of the 5' to 3' strands of the mRNA, i.e., the 5' position of the first cap proximal nucleotide. In Cap0, the ribose of both the first and second cap proximal nucleotides of the mRNA contains a 2'-hydroxyl group. In Cap1, the ribose of the first and second transcribed nucleotides of the mRNA contains a 2'-methoxy group and a 2'-hydroxyl group, respectively. In Cap2, the ribose of both the first and second cap proximal nucleotides of the mRNA contains a 2'-methoxy group. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; and Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous higher eukaryotic mRNAs (including mammalian mRNAs, such as human mRNAs) contain either Cap1 or Cap2. Cap0, and other cap structures different from Cap1 and Cap2, may be immunogenic in mammals (such as humans) because components of the innate immune system (such as IFIT-1 and IFIT-5) recognize them as “non-self,” potentially leading to elevated levels of cytokines, including type I interferon. Components of the innate immune system (such as IFIT-1 and IFIT-5) may also competitively bind to mRNAs with caps other than Cap1 or Cap2 with eIF4E, potentially inhibiting mRNA translation.
[0276] Co-transcribed caps are possible. For example, the anti-reverse cap analog (ARCA; Thermo Fisher Scientific catalog number AM8045) is a cap analog containing a 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of a guanine ribonucleotide, which can be incorporated into the transcript in vitro at initiation. ARCA produces a Cap0 cap, in which the 2' position of the proximal nucleotide of the first cap is a hydroxyl group. See, for example, Stepinski et al., (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7:1486–1495. The structure of ARCA is shown below.
[0277]
[0278] CleanCap TM AG(m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies catalog number N-7113) or CleanCap TM GG(m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies catalog number N-7133) can be used to co-transcribe and provide the Cap1 structure. CleanCap TM AG and CleanCap TM The 3'-O-methylated form of GG is also available from TriLink Biotechnologies under catalog numbers N-7413 and N-7433, respectively, or CleanCap AU is available from TriLink Biotechnologies under catalog number N-7114. CleanCap TM The AG structure is shown below.
[0279]
[0280] Alternatively, the cap can be added to the RNA post-transcriptionally. For example, vaccinia capping enzyme is commercially available (New England Biolabs catalog number M2080S) and possesses RNA triphosphatase and guanylate acyltransferase activity provided by its D1 subunit and guanine methyltransferase activity provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, it can add 7-methylguanine to RNA to obtain Cap0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; and Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479.
[0281] In some embodiments, the mRNA further comprises a poly-A tail. In some embodiments, the poly-A tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenine nucleotides, optionally up to 300 adenine nucleotides. In some embodiments, the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. In some embodiments, the poly-A tail comprises non-adenine nucleotides, i.e., a discontinuous poly-A tail. In some embodiments, the poly-A tail is discontinuously broken down by non-adenine nucleotides at approximately every 40, 50, 60, 70, 80, or 90 nucleotides. In some embodiments, the poly-A tail is discontinuously broken down by non-adenine nucleotides at approximately every 50 nucleotides.
[0282] Riboprotein complex
[0283] In some embodiments, a composition is included comprising one or more gRNAs, said gRNAs comprising one or more guide sequences from Table 1 or one or more sgRNAs from Table 2, and an RNA-directed DNA binder, such as a nuclease, such as a Cas nuclease like Cas9. In some embodiments, the RNA-directed DNA binder has lysinic activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-directed DNA binder comprises a Cas nuclease. Examples of Cas9 nucleases include those nucleases of the type II CRISPR system from Streptococcus pyogenes and other prokaryotes as known in the art, and their modified (e.g., engineered or mutant) forms.
[0284] In some embodiments, the Cas nuclease is a Cas9 nuclease derived from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease derived from Streptococcus pyogenes, wherein the nuclease induces double-strand breaks, i.e., it is a lyase.
[0285] In some embodiments, the gRNA, together with the RNA-directed DNA binder, is referred to as a ribonucleoprotein complex (RNP). In some embodiments, the RNA-directed DNA binder is a Cas nuclease. In some embodiments, the gRNA, together with the Cas nuclease, is referred to as a Cas RNP. In some embodiments, the Cas nuclease is the Cas9 protein from the Spy CRISPR / Cas system. In some embodiments, the gRNA, together with Cas9, is referred to as a Cas9RNP.
[0286] Wild-type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target DNA strand. In some embodiments, the Cas9 protein contains more than one RuvC domain or more than one HNH domain. In some embodiments, the Cas9 protein is wild-type Cas9. In each of the compositions, uses, and method embodiments, wild-type Cas induces double-strand breaks in the target DNA.
[0287] In some embodiments, a chimeric Cas nuclease is used, wherein a domain or region of a protein is replaced by a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced by a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.
[0288] In some embodiments, the RNA-directed DNA binder has single-strand nicking enzyme activity, capable of cleaving one strand of DNA to produce a single-strand break, also known as a "nick". In some embodiments, the RNA-directed DNA binder comprises a Cas nicking enzyme. A nicking enzyme is an enzyme that creates a nick in dsDNA, i.e., cleaving one strand of the DNA double helix but not the other. In some embodiments, the Cas nicking enzyme is a form of Cas nuclease (e.g., the Cas nuclease discussed above) in which the endonuclease active site is inactivated, for example, by alteration of one or more catalytic domains (e.g., point mutation). See, for example, U.S. Patent No. 8,889,356, for example, the discussion of Cas nicking enzymes and exemplary catalytic domain alterations. In some embodiments, the Cas nicking enzyme (such as the Cas9 nicking enzyme) has an inactivated RuvC or HNH domain.
[0289] In some embodiments, the RNA-directed DNA binder is modified to contain only one functional nuclease domain. For example, a modifier protein can be used to mutate or completely or partially delete one of the nuclease domains to reduce its nucleic acid cleavage activity. In some embodiments, a nickase with a reduced-activity RuvC domain is used. In some embodiments, a nickase with an inactive RuvC domain is used. In some embodiments, a nickase with a reduced-activity HNH domain is used. In some embodiments, a nickase with an inactive HNH domain is used.
[0290] In some embodiments, conserved amino acids within the Cas protein nuclease domain are substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may contain amino acid substitutions in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the Streptococcus pyogenes Cas9 protein). See, for example, Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may contain amino acid substitutions in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the Streptococcus pyogenes Cas9 protein). See, for example, Zetsche et al. (2015). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain or RuvC or RuvC-like domain of Neisseria meningitidis include Nme2Cas9D16A (HNH nickase) and Nme2Cas9H588A (RuvC nickase).
[0291] In some embodiments, the mRNA encoding the nicking enzyme is provided in combination with a pair of guide RNAs complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs guide the nicking enzyme to the target sequence and introduce the DSB by creating a nick on the opposite strand of the target sequence (i.e., a double nick). In some embodiments, the use of a double nick can improve specificity and reduce off-target effects. In some embodiments, the nicking enzyme is used with two separate guide RNAs targeting opposite DNA strands to create a double nick in the target DNA. In some embodiments, the nicking enzyme is used with two separate guide RNAs selected to be very close to each other to create a double nick in the target DNA.
[0292] In some embodiments, the RNA-directed DNA binder lacks lyase and nicking enzyme activity. In some embodiments, the RNA-directed DNA binder comprises a dCas DNA-binding polypeptide. The dCas polypeptide has DNA-binding activity but is substantially lacking in catalytic (lyase / nicking enzyme) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-directed DNA binder lacking lyase and nicking enzyme activity or the dCas DNA-binding polypeptide is a form of Cas nuclease (e.g., the Cas nucleases discussed above) in which its endonuclease active site is inactivated, for example, by one or more alterations in its catalytic domain (e.g., point mutation). See, for example, US 20140186958; US20150166980; and US20190338308.
[0293] In some implementations, the RNA-directed DNA binder comprises one or more heterologous functional domains (e.g., a fusion polypeptide).
[0294] In some embodiments, the heterologous functional domain facilitates the transport of the RNA-guided DNA binder to the cell nucleus. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binder may fuse with 1-5 NLSs. In some embodiments, the RNA-guided DNA binder may fuse with 1, 2, or 3 NLSs. In some embodiments, the RNA-guided DNA binder may fuse with two NLSs. In some embodiments, the RNA-guided DNA binder may fuse with one NLS. When using one NLS, the NLS may be linked to the N-terminus or C-terminus of the RNA-guided DNA binder sequence. In some embodiments, the NLS is not linked to the C-terminus. In some embodiments, the NLS is inserted into the RNA-guided DNA binder sequence. In some cases, the RNA-guided DNA binder contains at least two identical NLSs (e.g., two SV40 NLSs). In some embodiments, the RNA-guided DNA binder contains at least two different NLSs. In some embodiments, the RNA-guided DNA binder fuses with two SV40 NLS sequences linked to the C-terminus. In some embodiments, the RNA-guided DNA binder may fuse with two NLSs, one attached to the N-terminus and the other to the C-terminus. In some embodiments, the RNA-guided DNA binder may fuse with three NLSs. In some embodiments, the RNA-guided DNA binder may not fuse with any NLS. In some embodiments, the NLS may be a single sequence, such as SV40 NLS, PKKKRKV (SEQ ID NO: 1013), or PKKKRRV (SEQ ID NO: 1014). In some embodiments, the NLS may be a duplicate sequence, such as the NLS of the nucleoplasmic protein KRPAATKKAGQAKKKK (SEQ ID NO: 1015). In one specific embodiment, a single PKKKRKVNLS (SEQ ID NO: 1013) may be attached to the C-terminus of the RNA-guided DNA binder. One or more adapters may optionally be included at the fusion site.
[0295] In some embodiments, the heterofunctional domain may be able to alter the intracellular half-life of the RNA-directed DNA binder. In some embodiments, the half-life of the RNA-directed DNA binder may be increased. In some embodiments, the half-life of the RNA-directed DNA binder may be decreased. In some embodiments, the heterofunctional domain may be able to improve the stability of the RNA-directed DNA binder. In some embodiments, the heterofunctional domain may be able to decrease the stability of the RNA-directed DNA binder. In some embodiments, the heterofunctional domain may act as a signal peptide for protein degradation. In some embodiments, protein degradation may be mediated by proteases, such as proteasomes, lysosomal proteases, or calpases. In some embodiments, the heterofunctional domain may contain a PEST sequence. In some embodiments, the RNA-directed DNA binder may be modified by adding ubiquitin or a polyubiquitin chain. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-associated modifier-1 (URM1), developmentally downregulated protein-8 expressed in neuronal progenitor cells (NEDD8, also known as Rub1 in brewer's yeast), human leukocyte antigen F-associated protein (FAT10), autophagy-8 (ATG8) and autophagy-12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin folding modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).
[0296] In some embodiments, the heterologous functional domain may be a labeling domain. Non-limiting examples of labeling domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the labeling domain may be a fluorescent protein. Suitable non-limiting examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami). Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midorishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed-Monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric) Kusabira-Orange, mTangerine, tdTomato, and any other suitable fluorescent protein. In other embodiments, the labeled domain may be a purification tag or an epitope tag. Non-limiting exemplary tags include glutathione S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag1, Softag3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotinylate carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-restrictive exemplary reporter genes include glutathione S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, and fluorescent protein.
[0297] In other embodiments, the heterologous functional domain may be an effector domain. When an RNA-directed DNA binder is guided to its target sequence, such as when a Cas nuclease is guided to its target sequence by gRNA, the effector domain may modify or influence the target sequence. In some embodiments, the effector domain may be selected from a nucleic acid-binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. In some embodiments, the heterologous functional domain is a nuclease, such as FokI nuclease. See, for example, U.S. Patent No. 9,023,649. In some embodiments, the heterologous functional domain is a transcriptional activator or repressor. See, for example, Qi et al., “Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression”, Cell 152:1173-83 (2013); Perez-Pinera et al., “RNA-guided gene activation by CRISPR-Cas9-based transcription factors”, Nat. Methods 10:973-6 (2013); Mali et al., “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering”, Nat. Biotechnol. 31:833-8 (2013); and Gilbert et al., “CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes”, Cell 154:442-51 (2013). Therefore, RNA-guided DNA binders essentially become transcription factors, which can be guided by guiding RNA to bind to desired target sequences. In some embodiments, the heterologous functional domain is a deaminase, such as cytidine deaminase or adenine deaminase. In some embodiments, the heterologous functional domain is a C-to-T base transition enzyme (cytidine deaminase), such as apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.
[0298] Determination of gRNA efficacy
[0299] In some embodiments, the efficacy of the gRNA is determined when it is delivered or expressed together with other components that form the RNP. In some embodiments, the gRNA is expressed together with an RNA-directed DNA binding agent (such as a Cas protein, e.g., Cas9). In some embodiments, the gRNA is delivered to or expressed in a cell line that stably expresses an RNA-directed DNA nuclease (such as a Cas nuclease or a nicking enzyme, e.g., Cas9 nuclease or nicking enzyme). In some embodiments, the gRNA is delivered to cells as part of the RNP. In some embodiments, the gRNA is delivered to cells together with mRNA encoding an RNA-directed DNA nuclease (such as a Cas nuclease or a nicking enzyme, e.g., Cas9 nuclease or nicking enzyme).
[0300] As described herein, using RNA-guided DNA-binding nucleases and guide RNA disclosed herein can cause DNA double-strand breaks, which can lead to errors in the form of insertion / deletion (insertion-deletion) mutations after repair by cellular mechanisms. Many mutations caused by insertions and deletions alter reading frames or introduce premature stop codons, and thus produce non-functional proteins. In some embodiments, the efficacy of a particular gRNA is determined based on an in vitro model. In some embodiments, the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9). In some embodiments, the in vitro model is a primary cell line, such as a primary hepatocyte line, such as primary hepatocytes. In some embodiments, the primary hepatocytes are primary human hepatocytes. Regarding the use of primary cells, commercially available primary cells can be used to provide greater consistency between experiments. In some embodiments, the number of off-target sites where deletions or insertions occur in the in vitro model (e.g., in primary hepatocytes) is determined, for example, by analyzing the genomic DNA from cells transfected in vitro with Cas9 mRNA and guide RNA. In some implementations, such determination involves analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotides. Exemplary procedures for such determination are provided in working examples, using HEK293 cells or primary hepatocytes.
[0301] In some embodiments, the efficacy of a specific gRNA is determined in multiple in vitro cell models used in the gRNA selection process. In some embodiments, data are compared with the cell lines of the selected gRNA. In some embodiments, cross-screening is performed in multiple cell models.
[0302] In some embodiments, the efficacy of the guide RNA is measured by the percentage of PCSK9 insertions / deletions or genetic modifications. In some embodiments, the efficacy of the guide RNA is measured by the percentage of PCSK9 insertions / deletions or genetic modifications at the PCSK9 locus. In some embodiments, the efficacy of the guide RNA is measured by the percentage of PCSK9 insertions / deletions or genetic modifications at the genomic coordinates in Table 1. In some embodiments, the percentage of PCSK9 edited is compared to the percentage of insertions / deletions or genetic modifications required to achieve a reduction (e.g., knockdown) of the PCSK9 protein product. In some embodiments, the efficacy of the guide RNA is measured by reduced PCSK9 protein expression. In some embodiments, the reduced PCSK9 protein expression is measured using, for example, an ELISA as described herein.
[0303] In some embodiments, the methods and compositions disclosed herein are used to reduce PCSK9 protein expression in a cell population. In some embodiments, the protein level is reduced by at least 55%, 60%, 65%, 70%, 75%, preferably at least 80%, 85%, 90%, or 95%, relative to a control population of unmodified cells, for example, by ELISA.
[0304] "One unmodified cell" (or "multiple unmodified cells") refers to one (or multiple) control cells of the same cell type used in an experiment or test, wherein the "unmodified" control cells were not exposed to the PCSK9 guide RNA. Therefore, one unmodified cell (or multiple cells) can be a cell that has not been exposed to the guide RNA, or a cell that has been exposed to guide RNA that does not target PCSK9.
[0305] In some embodiments, the efficacy of the guide RNA is measured by the number or frequency of insertions, deletions, or genetic modifications at off-target sequences within the genome of the target cell type (such as primary hepatocytes). In some embodiments, effective guide RNAs are provided that produce insertions / deletions at off-target sites at a very low frequency (e.g., <5%) in the cell population or relative to the frequency of insertion / deletion generation at the target site. Therefore, this disclosure provides guide RNAs that do not exhibit off-target insertion / deletion formation in the target cell type (e.g., primary hepatocytes) or produce an off-target insertion / deletion formation frequency of <5% in the cell population or relative to the frequency of insertion / deletion generation at the target site. In some embodiments, this disclosure provides guide RNAs that do not exhibit any off-target insertion / deletion formation in the target cell type (e.g., primary hepatocytes) compared to control cells. In some embodiments, guide RNAs are provided that produce insertions / deletions at fewer than 5 validated off-target sites, as evaluated by one or more methods provided herein. In some embodiments, guide RNAs are provided that produce insertions / deletions at fewer than or equal to 4, 3, 2, or 1 validated off-target sites, as evaluated by one or more methods provided herein. In some implementations, one or more off-target sites do not appear in the protein-coding regions of the target cell (e.g., hepatocyte) genome.
[0306] In some embodiments, the efficacy of the guide RNA is measured in vivo, for example in an animal or animal model having a DNA sequence readily cleaved by a nuclease targeted by the guide RNA (i.e., a DNA sequence sufficiently complementary to the target sequence of a homologous PAM in the guide RNA and the nuclease). In some embodiments, the animal has an endogenous DNA sequence readily cleaved by a nuclease targeted by the guide RNA. In some embodiments, the animal model is a transgenic model, such as a mouse model having an inserted DNA sequence readily cleaved by a nuclease targeted by the guide RNA, such as a mouse with an inserted human DNA sequence, such as a transgenic mouse with an inserted human PCSK9 sequence. The inserted sequence may or may not include one or more intron sequences or regulatory sequences, such as 3'UTR, 5'UTR, present in the human gene in its natural context. In some embodiments, the human DNA sequence may replace the homologous endogenous DNA sequence, for example, the mouse PCSK9 gene is replaced by the human PCSK9 gene. In some embodiments, the human gene is present in a mouse in a human hepatocyte background, such as a mouse with a humanized liver, for example, available from PheonixBio.
[0307] In some embodiments, the animal model is a rodent. In some embodiments, the rodent is a mouse or rat. In some embodiments, the animal model is an animal expressing human PCSK9, such as a mouse expressing human PCSK9 derived from an expression construct, such as a viral vector, or a transgenic mouse expressing human PCSK9. In some embodiments, the animal model is a high-fat fed or hyperlipidemic animal, optionally an animal expressing human PCSK9, such as a mouse expressing human PCSK9.
[0308] In some embodiments, the detection of gene editing events in the target DNA, such as the formation of insertion / deletion (“insertion-deletion”) mutations and insertion or homology-directed repair (HDR) events, utilizes linear amplification with labeled primers and the separation of the labeled amplified products (hereinafter referred to as “LAM-PCR” or “linear amplification (LA)” methods). In some embodiments, the efficacy of the guide RNA is measured by the level of a functional protein complex containing the protein product of gene expression. In some embodiments, the efficacy of the guide RNA is measured by ELISA.
[0309] Genetic modifications used to suppress target gene expression
[0310] Engineered cells or cell populations contain genetic modifications, such as endogenous nucleic acid sequences encoding PCSK9.
[0311] In some embodiments, the engineered cells or cell populations contain genetic modifications to the PCSK9 gene, as assessed by sequencing (e.g., NGS), wherein at least 50%, 55%, 60%, 65%, 70%, 75%, preferably at least 80%, 85%, or 90% of the cells contain insertions, deletions, or substitutions in the endogenous PCSK9 sequence. In some embodiments, at least 50% of the cells in the population contain modifications selected from insertions, deletions, and substitutions in the endogenous PCSK9 sequence. In some embodiments, at least 80% of the cells in the population contain modifications selected from insertions, deletions, and substitutions in the endogenous PCSK9 sequence. In some embodiments, at least 85% of the cells in the population contain modifications selected from insertions, deletions, and substitutions in the endogenous PCSK9 sequence. In some embodiments, at least 90% of the cells in the population contain modifications selected from insertions, deletions, and substitutions in the endogenous PCSK9 sequence. In some embodiments, the cells in the population include hepatocytes from the liver. In some embodiments, PCSK9 expression is reduced by at least 50%, 55%, 60%, 65%, 70%, 75%, preferably at least 80%, 85%, or 90% compared to a suitable control (e.g., where the PCSK9 gene is unmodified). In some embodiments, PCSK9 expression is reduced by at least 70% or to below the detection limit compared to a suitable control (e.g., where the PCSK9 gene is unmodified). In some embodiments, PCSK9 expression is reduced by at least 75% or to below the detection limit compared to a suitable control (e.g., where the PCSK9 gene is unmodified). In some embodiments, PCSK9 expression is reduced by at least 80% or to below the detection limit compared to a suitable control (e.g., where the PCSK9 gene is unmodified). In some embodiments, PCSK9 expression is reduced by at least 85% or to below the detection limit compared to a suitable control (e.g., where the PCSK9 gene is unmodified). In some embodiments, PCSK9 expression is reduced by at least 90% or to below the detection limit compared to a suitable control (e.g., where the PCSK9 gene is unmodified). In some embodiments, PCSK9 expression is reduced by no more than 95% compared to a suitable control (e.g., where the PCSK9 gene is unmodified). Assays for PCSK9 protein and mRNA expression are known in the art.
[0312] It should be understood that in some embodiments, in vivo expression levels may be suppressed in one, but not all, tissues expressing the target gene. For example, many genes are primarily expressed in the liver but may also be expressed in other tissues. In some embodiments, the level of expression suppression may be targeted at a specific tissue or cell type, but not as a suppression of systemic expression, such as suppression of liver expression rather than systemic expression. In some embodiments, alternative markers may be used to monitor changes in expression. For example, many proteins produced in the liver are secreted into the circulatory system; therefore, the level of expression suppression can be determined by or correlated with a decrease in protein levels in the blood. In some embodiments, suppression of expression in the liver may result in changes in metabolites or other biomarkers in bodily fluids such as blood or urine. Changes in metabolite levels may be correlated with the level of expression suppression. Such correlations can be used to monitor the level of expression suppression, instead of, for example, serial biopsies, which are not practical for monitoring in human subjects or typically in animal models. Following treatment with an agent that reduces protein expression in the liver, the level of expression suppression or the absolute level of protein in the blood or serum is correlated with the treatment outcome.
[0313] In some embodiments, a target gene is genetically modified using a guide RNA and an RNA-guided DNA binder, resulting in suppression of expression in the cell. In some embodiments, this document discloses cells engineered by inducing breaks (e.g., double-strand breaks (DSBs) or single-strand breaks (notches)) within a target gene in the cell, for example, using a guide RNA and an RNA-guided DNA binder (e.g., a CRISPR / Cas system). These methods can be used in vitro, for example, to screen for guides, or in vivo, for example, to provide therapeutic benefits.
[0314] In some embodiments, the guide RNA mediates target-specific cleavage of the target gene at the sites described herein by an RNA-guided DNA binder (e.g., a Cas nuclease, such as SpyCas9 nuclease). It should be understood that in some embodiments, the guide RNA comprises a guide sequence that binds to or is capable of binding to the region.
[0315] III. Methods and uses, including treatments and applications of genome editing agents.
[0316] The gRNAs, methods, and compositions disclosed herein can be used to prepare genome editing therapeutic agents.
[0317] In some embodiments, a gRNA containing the guide sequence of Table 1 and an RNA-guided DNA nuclease (such as Cas nuclease) induces DSB and produces modifications, such as mutations, in the PCSK9 gene during non-homologous end joining (NHEJ) during repair. In some embodiments, NHEJ results in nucleotide deletions or insertions, thereby inducing frameshifts or meaningless mutations in the PCSK9 gene. In some embodiments, the gRNA containing the guide sequence targeting the target genome sequence is also delivered to the cell, either together with or separately from an RNA-guided DNA nuclease (such as Cas nuclease), to produce genetic modifications in the target genome sequence, thereby suppressing the expression of the full-length expression product from the target gene. In some embodiments, the gRNA is sgRNA.
[0318] In some embodiments, the guide RNA, composition, and formulation are used to generate cells in vivo, such as liver cells, like hepatocytes with genetic modifications in the PCSK9 gene. In some embodiments, the cells are in a subject's body.
[0319] In some implementations, the subject is a mammal. In some implementations, the subject is a human. In some implementations, the subject is a non-human primate.
[0320] In some embodiments, the subject has a PCSK9-associated disease or condition or is at risk of having such a disease or condition. As used herein, “PCSK9-associated disease or condition” or “PCSK9-related disease or condition” is intended to include any disease or condition associated with the expression or activity of the PCSK9 gene or protein. Such a disease or condition may be caused by, for example, an overproduction of the PCSK9 protein, a mutation in the PCSK9 gene, abnormal cleavage of the PCSK9 protein, or abnormal interactions between PCSK9 and other proteins or other endogenous or exogenous substances. Exemplary PCSK9-related diseases include lipemias, such as hyperlipidemia, and other forms of lipid imbalances, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these conditions, such as heart and circulatory system diseases. In some embodiments, PCSK9-related diseases or conditions are selected from the group consisting of cardiovascular disease or chronic liver injury. In some implementations, PCSK9-related diseases or disorders include, but are not limited to, hypercholesterolemia (e.g., total cholesterol level >190 mg / dl, or LDL-cholesterol level >100 mg / dl), familial hypercholesterolemia (FH), autosomal dominant hypercholesterolemia (ADH), autosomal recessive hypercholesterolemia (ARH), hyperlipidemia, hypertriglyceridemia, coronary artery disease, stroke, myocardial infarction, obesity, xanthomas, atherosclerosis, aortic stenosis, hepatic steatosis, hypertension, type 2 diabetes, and insulin resistance.
[0321] Familial hypercholesterolemia (FH) is characterized by severely elevated LDL cholesterol (LDL-C) levels (e.g., over 190 mg / dL in adults or over 160 mg / dL in children), leading to atherosclerotic plaque buildup in the coronary arteries and proximal aorta during childhood. This increases the risk of cardiovascular disease, which may manifest as angina, myocardial infarction, or stroke. FH is a hereditary disorder inherited through families and is caused by a pathogenic mutation in one of three genes (APOB, LDLR, and PCSK9). Patients can be heterozygous or homozygous for the mutation.
[0322] Autosomal dominant hypercholesterolemia (ADH) and autosomal recessive hypercholesterolemia (ARH) are other forms of hypercholesterolemia, also characterized by excessively high blood cholesterol levels (Cohen, JC, (2003) Curr. Opin. Lipidol. 14, 121-127). ADH is caused by a defect in the liver's uptake of LDL, which may be due to mutations in the LDLR that prevent LDL uptake, or mutations in apolipoprotein B, a protein on LDL (responsible for binding LDL to the LDLR). ARH is caused by mutations in the ARH protein, which are necessary for the endocytosis of the LDLR-LDL complex via interaction with clathrin.
[0323] It should be understood that subjects with PCSK9-related disease may be treated with one or more additional therapeutic agents within the standards of care used to treat lipid disorders or lipid-related conditions (e.g., cardiovascular diseases such as hypertension; type 2 diabetes, insulin resistance). In some embodiments, subjects are treated with additional agents until a decrease in serum PCSK9 levels is observed. In some embodiments, subjects are treated with additional agents until a change in signs or symptoms associated with PCSK9-related disease is observed, such as a decrease in blood pressure before discontinuation of treatment with one or more agents that lower blood pressure; or normalization of blood glucose or glycemic regulation before discontinuation of treatment with one or more agents that normalize blood glucose or glycemic regulation. In some embodiments, subjects are treated with one or more PCSK9 inhibitors. In some embodiments, subjects are treated with one or more anti-PCSK9 monoclonal antibodies. In some embodiments, subjects are treated with evolocumab. In some embodiments, subjects are treated with alirocumab. In some embodiments, subjects are treated with vutrisiran.
[0324] Examples of additional therapeutic agents include those known to treat lipid disorders such as hypercholesterolemia, atherosclerosis, or dyslipidemia. For example, the gRNA characteristic of this invention can be administered in conjunction with: HMG-CoA reductase inhibitors (e.g., statins), fibrates, bile acid sequestrants, niacin, antiplatelet agents, angiotensin-converting enzyme inhibitors, angiotensin II receptor antagonists (e.g., losartan potassium), acyl-CoA cholesterol acetyltransferase (ACAT) inhibitors, cholesterol absorption inhibitors, cholesterol ester transfer protein (CETP) inhibitors, microsomal triglyceride transfer protein (MTTP) inhibitors, cholesterol regulators, bile acid regulators, peroxisome proliferation activated receptor (PPAR) agonists, glycoprotein IIb / IIIa inhibitors, aspirin or aspirin-like compounds, IB AT inhibitors, squalene synthase inhibitors, or mononuclear cell chemical attractant protein (MCP)-I inhibitors. Exemplary HMG coenzyme A reductase inhibitors include atorvastatin, pravastatin, simvastatin, lovastatin, fluvastatin, cerivastatin, rosuvastatin, and pitivastatin. Exemplary fibrates include, for example, bezafibrate, clofibrate, fenofibrate, gemfibrozil, and ciprofibrate. Exemplary bile acid sequestrants include, for example, cholestyramine, colestipol, and colesvelam. Exemplary niacin therapy includes, for example, immediate-release and extended-release formulations. Exemplary antiplatelet agents include, for example, aspirin, clopidogrel, and ticlopidine. Exemplary angiotensin-converting enzyme inhibitors include, for example, ramipril and enalapril. Exemplary acyl-CoA cholesterol acetyltransferase (ACAT) inhibitors include, for example, avasimibe and eflucimibe. Exemplary cholesterol absorption inhibitors include, for example, ezetimibe and pamaqueside. Exemplary CETP inhibitors include, for example, torcetrapib, JTT-705, and CETi-I.Exemplary microsomal triglyceride transfer protein (MTTP) inhibitors include, for example, impitapide, R-103757, and CP-346086.
[0325] Exemplary bile acid modulators include, for example, HBS-107 (Hisamitsu / Banyu), Btg-511 (British Technology Group), BARI-1453 (Aventis), S-8921 (Shionogi), SD-5613 (Pfizer), and AZD-7806 (AstraZeneca). Exemplary peroxisome proliferation-activating receptor (PPAR) agonists include, for example, tesaglitazar and napoglitazone. Exemplary glycoprotein IIb / IIIa inhibitors include, for example, roxifiban, gantofiban, and cromafiban. The anti-atherosclerotic agent BO-653 (Chugai Pharmaceuticals) and the nicotinic acid derivative Nyclin are also suitable for combination administration with the gRNAs characteristic of this invention. Exemplary combination therapies suitable for administration in combination with PCSK9-targeting gRNAs include, for example, advicor, amlodipine / atorvastatin, and ezetimibe / simvastatin. Agents suitable for use in treating hypercholesterolemia and suitable for combination with PCSK9-targeting gRNAs include, for example, lovastatin, amlodipine besylate, atorvastatin, rosuvastatin, fluvastatin, niacin, pravastatin, fenofibrate, ezetimibe, simvastatin, colesvelam, and ezetimibe.
[0326] In some embodiments, the method includes instructing the end user (e.g., a healthcare provider, a subject) to administer an adjunct (such as the adjunct provided above) in conjunction with the gRNA provided herein. In some embodiments, the adjunct, i.e., one or more adjuncts, is administered, for example, before, simultaneously with, or after the administration of the gRNA, for example, until a desired clinical outcome is achieved, such as lowering blood pressure or serum cholesterol or lipids; or normalizing blood glucose.
[0327] In one aspect, the present invention provides a method for treating a patient by selecting the patient based on the patient's need to lower LDL, lower LDL without lowering HDL, lower ApoB, or lower total cholesterol. The method includes administering to the patient an amount of gRNA sufficient to lower the patient's LDL or ApoB levels, for example, without significantly lowering HDL levels.
[0328] Genetic predisposition plays a role in the development of target gene-related diseases such as hyperlipidemia. However, most variants detected during molecular screening of patients with clinical familial hypercholesterolemia (FH) lack functional evidence, potentially making definitive diagnosis difficult (see, for example, Di Costanzo et al. (2021) J Clin Lipidol, 15:822-831). Therefore, patients requiring gRNA can be identified by obtaining a family history or by screening for one or more genetic markers or variants (often in conjunction with or suggested by signs of hyperlipidemia). Examples of genes involved in hyperlipidemia include, but are not limited to, LDL receptor (LDLR), apolipoproteins (ApoA1, ApoB, ApoE, etc.), cholesterol ester transfer protein (CETP), lipoprotein lipase (LPL), hepatic lipase (LIPC), endothelial lipase (EL), and lecithin cholesterol acyltransferase (LCAT). Population-based genomic studies (e.g., UK Biobank) are expected to further define genetic markers associated with familial hypercholesterolemia and other hyperlipidemias.
[0329] Healthcare providers (such as doctors, nurses, or geneticists) can obtain family medical history before prescribing or administering the gRNA agent of this invention. Additionally, tests can be performed to determine genotype or phenotype. For example, DNA testing can be performed on samples from the patient (e.g., blood samples) to identify the PCSK9 genotype or phenotype before administering the PCSK9 gRNA to the patient. Pathogenic and benign variants of PCSK9 can be found, for example, in the NCBI SNP database www.ncbi.nlm.nih.gov / snp / ?linkName=gene_snp&from_uid=255738. In another embodiment, tests are performed to identify the relevant genotype or phenotype, such as the LDLR genotype. Examples of genetic variants of the LDLR gene can be found in the art, for example in the following publications incorporated by reference: Costanza et al. (2005) Am J Epidemiol. 15; 161(8): 714-24; Yamada et al. (2008) J Med Genet. Jan; 45(l): 22-8, e.g. August 31, 2007; and Boes et al. (2009) Exp. Gerontol 44: 136-160, e.g. November 17, 2008.
[0330] Delivery of gRNA composition
[0331] Lipid nanoparticles (LNPs) are a well-known means of delivering nucleotide and protein cargoes, and can be used for in vivo and in vitro delivery of the guide RNAs and compositions disclosed herein. In some embodiments, LNPs deliver nucleic acid cargoes, protein cargoes, or nucleic acids together with protein cargoes.
[0332] In some embodiments, a method is provided for delivering any of the cells or cell populations disclosed herein to a subject, wherein the gRNA is delivered in vivo via an LNP. In some embodiments, the gRNA / LNP is also associated with Cas9 or mRNA encoding Cas9.
[0333] In some embodiments, a composition is provided comprising any of the gRNAs disclosed herein and an LNP. In some embodiments, the composition further comprises Cas9 or mRNA encoding Cas9.
[0334] In some implementations, the LNP associated with the gRNA disclosed herein is used to prepare a medicament for treating a disease or condition.
[0335] In some embodiments, a method is provided for in vivo delivery of any of the gRNAs disclosed herein, wherein the gRNA associates with an LNP. In some embodiments, the gRNA does not associate with an LNP. In some embodiments, the gRNA / LNP or the gRNA also associates with Cas9 or an mRNA encoding Cas9.
[0336] In some embodiments, the guide RNA composition described herein, encoded alone or on one or more vectors, is formulated in or administered via lipid nanoparticles (LNPs) (see, for example, WO2017 / 173054 and WO2021 / 222287, the contents of each of which are incorporated herein by reference in their entirety).
[0337] In some embodiments, a DNA or RNA vector is provided that encodes any one of one or more of the guide RNAs comprising the guide sequences described herein. In some embodiments, in addition to the guide RNA sequence, the vector further comprises nucleic acids that do not encode the guide RNA. Nucleic acids that do not encode the guide RNA include, but are not limited to, promoters, enhancers, regulatory sequences, and nucleic acids encoding RNA-guided DNA-binding nucleases, such as Cas9. In some embodiments, the vector comprises one or more nucleotide sequences encoding crRNA, trRNA, or a combination of crRNA and trRNA. In some embodiments, the vector comprises one or more nucleotide sequences encoding sgRNA and mRNA encoding an RNA-guided DNA nuclease (which may be a Cas nuclease, such as Cas9, or a SpyCas9 lyase). In some embodiments, the vector comprises one or more nucleotide sequences encoding crRNA or trRNA and mRNA encoding an RNA-guided DNA-binding nuclease (which may be a Cas protein, such as Cas9). In one embodiment, Cas9 is derived from Streptococcus pyogenes (i.e., SpyCas9), for example, SpyCas9 lyase. In some embodiments, the nucleotide sequence encoding crRNA, trRNA, or crRNA and trRNA (which may be sgRNA) includes or is composed of a guide sequence, said guide sequence being side-joined by all or part of a repetitive sequence from a naturally occurring CRISPR / Cas system. The nucleic acid containing crRNA, trRNA, or crRNA and trRNA, or composed of them, may further include a vector sequence, wherein the vector sequence contains or is composed of nucleic acids not naturally found with crRNA, trRNA, or crRNA and trRNA.
[0338] In some embodiments, the component may be introduced into cells as naked nucleic acid, as nucleic acid complexed with an agent such as liposomes or poloxamer, or the component may be delivered via a viral vector (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus). Non-viral methods and compositions for nucleic acid delivery include electroporation, lipid transfection, microinjection, gene gun, virions, liposomes, immunoliposomes, LNPs, polycationic or lipid:nucleic acid conjugates, naked nucleic acids (e.g., naked DNA / RNA), artificial viral particles, and agent-enhanced DNA uptake. Ultrasonic perforation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used for nucleic acid delivery.
[0339] This description and exemplary embodiments should not be considered limiting. For the purposes of this specification and the appended claims, all figures representing quantities, percentages, or proportions, and other numerical values used in the specification and claims, unless otherwise stated, should be understood to be modified in all cases by the term "about," unless it is not so modified. Therefore, unless indicated to the contrary, the numerical parameters set forth in the following specification and the appended claims are approximate values that may vary depending on the desired characteristics sought and tolerances accepted in the art. At least and without attempt to limit the application of the equivalence criterion to the scope of the claims, each numerical parameter should be interpreted at least according to the number of significant figures reported and by applying common rounding techniques.
[0340] IV. Examples
[0341] The following examples are provided to illustrate certain disclosed embodiments and should not be construed as limiting the scope of this disclosure in any way.
[0342] Example 1. Materials and Methods
[0343] In vitro transcription (IVT) of nuclease mRNA
[0344] Capped and polyadenylated mRNA containing N1-methylpseudo-UTP was generated by in vitro transcription using conventional methods. Typically, the DNA plasmid containing the T7 promoter, the sequence for transcription, and the polyadenylated region was linearized with XbaI according to the manufacturer's protocol. XbaI was inactivated by heat. The linearized plasmid was purified from the enzyme and buffer salts. The modified mRNA was generated by IVT reaction at 37°C under the following conditions: 50 ng / μL linearized plasmid; 2–5 mM each of GTP, ATP, CTP, and N1-methylpseudo-UTP (Trilink); 10–25 mM ARCA (Trilink); 5 U / μL T7 RNA polymerase; 1 U / μL mouse RNase inhibitor (NEB); 0.004 U / μL inorganic E. coli pyrophosphatase (NEB); and 1× reaction buffer. Add TURBO DNAase (Thermo Fisher) to a final concentration of 0.01 U / μL and incubate the reaction at 37°C to remove the DNA template.
[0345] Following the manufacturer's instructions, mRNA is purified using the MegaClear Transcription Cleanup Kit (Thermo Fisher) or the RneasyMaxi Kit (Qiagen). Alternatively, mRNA is purified via a precipitation protocol, sometimes followed by HPLC-based purification. In short, mRNA is purified using LiCl precipitation, ammonium acetate precipitation, and sodium acetate precipitation after DNase digestion. For HPLC-purified mRNA, after LiCl precipitation and remodeling, mRNA is purified by RP-IP HPLC (see, for example, Kariko et al. Nucleic Acids Research, 2011, Vol. 39, No. 21, el42). Fractions selected for pooling are combined and desalted by sodium acetate / ethanol precipitation as described above. In another alternative method, mRNA is purified by LiCl precipitation followed by further purification by tangential flow filtration. RNA concentration is determined by measuring absorbance at 260 nm (Nanodrop), and transcripts are analyzed by capillary electrophoresis using a Bioanalyzer (Agilent).
[0346] The *Streptococcus pyogenes* (“Spy”) Cas9 mRNA was generated from plasmid DNA encoding open reading frames according to SEQ ID NO: 1003, 1006, and 1009 (see sequences in Table 23). When sequences cited in this paragraph are mentioned below with respect to RNA, it should be understood that T should be replaced with U (which may be a modified nucleoside as described above). The messenger RNA used in the examples comprised a 5' cap and a 3' polyadenylated sequence, for example, up to 100 nt. The RNA was chemically synthesized using modified nucleotides by commercial suppliers or using standard in vitro synthesis techniques.
[0347] Preparation of LNP formulations containing sgRNA and Cas9 mRNA
[0348] Generally, lipid nanoparticle components are dissolved in 100% ethanol at different molar ratios. RNA cargo (e.g., Cas9 mRNA and sgRNA) is dissolved in 25 mM citrate and 100 mM NaCl (pH 5.0) to achieve a concentration of approximately 0.45 mg / mL. The LNP used contains an ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadecane-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)- The LNP consists of octadecane-9,12-dienoate (also referred to herein as lipid A), cholesterol, 1,2-distearate-sn-glycero-3-phosphocholine (DSPC), and 1,2-dimyristoyl-rac-glycero-3-methoxy polyethylene glycol 2000 (PEG2K-DMG) (e.g., catalog number GM-020 from NOF, Tokyo, Japan), in a molar ratio of 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2K-DMG. The LNP is formulated with a molar ratio of approximately 6 lipid amines to RNA phosphate (N:P) and a weight ratio of 1:2 gRNA to mRNA. The LNP used contains a single RNA species, such as Cas9 mRNA or sgRNA. The LNP is similarly prepared using a mixture of Cas9 mRNA and guide RNA.
[0349] LNPs are prepared using a cross-flow technique, which utilizes a collision-jet mixing process involving lipids in ethanol with two volumes of RNA solution and one volume of water. First, the lipids in ethanol are mixed with two volumes of RNA solution using a cross-flow mixer. Then, the fourth-strand aqueous stream is mixed with the outlet stream of the cross-flow mixer through a straight tee (see WO2016010840). Figure 2 The LNP was kept at room temperature for 1 hour and further diluted with water (approximately 1:1 v / v). The diluted LNP buffer was exchanged for 50 mM Tris, 45 mM NaCl, and 5% (w / v) sucrose (pH 7.5) (TSS) and concentrated as needed using methods known in the art. The resulting mixture was then filtered through a 0.2 μm sterile filter. The final LNP was characterized to determine encapsulation efficiency, polydispersity index, and average particle size. The final LNP was stored at 4 °C or -80 °C until further use.
[0350] Hepatocyte preparation
[0351] Primary human hepatocytes (PHH) and primary cynomolgus monkey hepatocytes (PCH) were prepared as follows: Cells were thawed and resuspended in 50 mL of cryopreserved hepatocyte recovery medium (CHRM) (Invitrogen, CM7000), followed by centrifugation. Cells were then resuspended in hepatocyte culture medium supplemented with William's E Medium Plating Supplement (Gibco, catalog A13450) containing fetal bovine serum (FBS). Cells were clumped by centrifugation, resuspended in the medium, and plated onto 96-well plates coated with Bio-coat collagen I (Corning #354407). The plated cells were incubated in a tissue culture incubator at 37°C under a 5% CO2 atmosphere for 4–6 hours to allow them to settle and adhere. After incubation, the formation of the cell monolayer was examined and the cells were washed once with 100 μL of hepatocyte maintenance medium (Williams E medium (Gibco, catalog A12176-01) plus supplement pack (Gibco, catalog CM3000)) and then seeded.
[0352] DNA isolation
[0353] Cells were harvested 72 hours after transfection. DNA was extracted from each well of a 96-well plate using 50 μL / well QuickExtract DNA extraction solution (Epicentre, catalog QE09050) or Quick Extract (Lucigen, catalog SS000035-D2), according to the manufacturer's protocol. Alternatively, DNA was isolated using methods known in the art.
[0354] Next-generation sequencing (“NGS”) and analysis with editing efficiency
[0355] To quantitatively determine the editing efficiency at target sites in the genome, sequencing is used to identify the presence of insertions and deletions introduced through gene editing. PCR primers are designed near target sites within genes of interest (e.g., PCSK9), and the genomic region of interest is amplified. Primer sequences are designed according to standards in the art.
[0356] Additional PCR was performed according to the manufacturer's protocol (Illumina) to add chemicals for sequencing. The amplicon was sequenced on an Illumina MiSeq instrument. After eliminating low-quality reads, the reads were aligned to a reference genome (e.g., hg38). The resulting file containing the reads was mapped to the reference genome (BAM file), where reads overlapping with the target region of interest were selected, and the number of wild-type reads and the number of reads containing insertions or deletions (“insertions / deletions”) were calculated.
[0357] Edit percentage (e.g., "edit efficiency", "edit percentage", or "insertion / missing percentage") is defined as the total number of sequence reads with insertions or missing values ("insertion / missing") divided by the total number of sequence reads including wild-type reads.
[0358] Example 2. In vitro editing in primary hepatocytes
[0359] As shown in Table 1, sgRNAs targeting the human PCSK9 gene with different target sequences were designed and transfected into primary human (PHH) hepatocytes using lipid transfection. Premixed lipid preparations were used for lipid transfection of Cas9 mRNA and gRNA. The lipid transfection reagent contains ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadecane-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadecane-9,12-dienoate, also referred to herein as lipid A), cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. This mixture was reconstituted in 100% ethanol and then mixed with RNA cargo (e.g., Cas9 mRNA (SEQ ID NO:1002) and gRNA) at a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 to produce a lipid nucleic acid mixture. This was then performed via in vitro transcription (IVT) (as described in WO2019 / 067910, see example...). 354), the mRNA was purified by 2 hours of IVT reaction time and precipitation with LiCl followed by tangential flow filtration to produce mRNA containing the Cas9 ORF of Table 23.
[0360] PHH (Gibco, batch 9396) cells were seeded at densities of 40,000 and 33,000 cells / well, respectively. Lipotransfected samples were prepared using an N:P molar ratio of approximately 7 and a gRNA:mRNA weight ratio of 6.5:1. Cells were incubated at 37°C and 5% CO2 for 24 hours prior to treatment with the lipid-nucleic acid mixture. The lipid-nucleic acid mixture was incubated at 37°C for 10 minutes in medium containing 10% fetal bovine serum (FBS). After incubation, the lipid-nucleic acid mixture containing 50 ng of Cas9 mRNA was added to the cells. Cells were lysed 72 hours post-treatment for NGS analysis as described in Example 1. The mean editing results and standard deviation (SD) for PHH are shown in Table 5. Samples were run in duplicate.
[0361] Table 5: In vitro editing in PHH
[0362] Guidance ID Average edit percentage SD G016707 75.50 4.4 G016675 69.55 1.7 G016723 61.35 6.8 G016704 58.85 2.1 G016649 55.00 1.4 G016696 52.90 6.9 G016735 52.50 6.5 G016650 52.10 7.6 G016714 50.25 7.7 G016662 49.20 0.8 G016689 48.70 2.2 G016730 48.10 2.0 G016660 47.05 11.6 G016709 46.70 8.3 G016674 45.15 7.9 G016657 45.05 5.5 G016687 43.25 4.9 G016661 41.50 0.0 G016690 41.00 4.5 G016654 40.20 1.6
[0363] Example 3. In vitro editing in primary hepatocytes with dilution curves
[0364] The editing efficacy of PCSK9-targeting guide RNA was tested in primary human hepatocytes (PHH) (Gibco, batch number: Hu8284).
[0365] Example 3.1. Cell Preparation
[0366] Thaw and resuspend PHH cells in hepatocyte thawing medium containing seeding supplement (Williams E medium (Gibco, catalog A12176-01)) and dexamethasone + mixed supplement (Gibco, catalog A15563, batch 2019842), and seeding supplement and FBS inclusions (Gibco, catalog A13450, batch 1970698), followed by centrifugation. Discard the supernatant and resuspend the clumps of cells in hepatocyte seeding medium with supplement packs (Invitrogen, catalog A1217601, and Gibco, catalog CM3000). Count the cells and seed them at a density of 33,000 cells / well in 96-well plates coated with bio-coated collagen I (Thermo Fisher, catalog 877272). The seeded cells were allowed to settle and adhere in a tissue culture incubator at 37°C and a 5% CO2 atmosphere for 4–6 hours. After incubation, the formation of the cell monolayer was examined and the cells were washed once with hepatocyte maintenance medium (Invitrogen, catalog A1217601, and Gibco, catalog CM4000).
[0367] Example 3.2. LNP Processing
[0368] LNPs were generally prepared as described in Example 1. The LNPs contained 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG by molar ratio. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA (SEQ ID NO: 1002) weight ratio of 1:2. Each LNP was applied to cells using an 8-point 3-fold dilution curve starting at 300 ng mRNA / 100 μl as shown in Table 6.
[0369] Table 6: Guide substances and mRNA concentrations for dose-response curves
[0370] Guide concentration (nM) mRNA(ng) 46.5 300 15.5 100 5.167 33.33 1.722 11.11 0.574 3.70 0.191 1.23 0.064 0.412 0.021 0.137
[0371] After LNP treatment, cells were incubated for 24 hours at 37°C in Williams E medium (Gibco, A1217601) with maintenance supplements and 3% fetal bovine serum. After 72 hours, cells were harvested and analyzed by NGS as described in Example 1. EC50 values and mean edit results are shown in Table 7. Dose-response curves were plotted... Figure 1 middle.
[0372] Table 7: Editing efficiency and EC50 (nM) of selected PCSK9 guidelines
[0373]
[0374] Example 3.3. Preprotein convertase 9 (PCSK9) ELISA analysis for PHH
[0375] The seeded cells were cultured in Cellartis Power Primary HEP medium (Takara, Y20020) for approximately 10 days. The medium was changed every other day. Tissue culture was collected 48 hours after the last medium change on day 10. Serum PCSK9 secretion concentrations were determined using a Human Proprotein Convertase 9 (PCSK9) DuoSet ELISA Kit (R&D Systems, catalog DY3888) according to the manufacturer's protocol, with a final concentration of capture antibody at 2 μg / ml. The plates were read on a Clariostar plate reader at absorbance of 450 nm and wavelength correction at 570 nm. Serum PCSK9 levels were calculated using a four-parameter logistic curve fitted to a standard curve. The dose-response curve (pg / ml) for PCSK9 protein reduction is shown in [Figure / Table / Insert Table ... Figure 2 The data are presented in Table 8. The final maximum protein reduction is shown in Table 9. Samples were run in triplicate. The percentage of protein knockdown (%KD) was measured relative to the untreated control group.
[0376] Table 8: Dose-response curves for reduction in serum PCSK9 levels
[0377]
[0378] Table 9: Maximum protein reduction of selected guides in PHH
[0379]
[0380] Example 4. In vivo editing of mouse liver using lipid nanoparticles (LNPs)
[0381] All LNPs used in in vivo studies were formulated as described in Example 1. The transport and storage solution (TSS) used in LNP preparation was administered as a negative control in the experiments, serving only as a carrier. The nucleotide sequences of the sgRNA contained in the LNPs each target different sequences in the PCSK9 gene as shown in Table 2.
[0382] Example 4.1. In vivo editing of a humanized PCSK9 mouse model
[0383] In vivo editing efficiency was tested on the selected guideline designs from Table 2. Male and female transgenic mice containing the human PCSK9 gene sequence (hPCSK9) were used in each study involving mice. hPCSK9 mice were bred in a hybrid C57B6 / 129 background, backcrossed once with B6, and then crossbred for population expansion. The mouse PCSK9 gene was excised from the genome of the hPCSK9 mice. Animals were approximately 6 weeks old and weighed before administration. LNP was administered via the lateral tail vein at a dose of 0.3 mg / kg body weight (e.g., 0.3 mg / kg or 0.3 mpk). Adverse reactions in animals were observed approximately 24 hours after administration. Animals were euthanized 14 days after administration by exsanguination under isoflurane anesthesia and cervical dislocation. Blood was collected via cardiac puncture into serum separation tubes or tubes containing buffered sodium citrate for plasma, as described herein. For studies involving in vivo editing, liver tissue was collected from the left lobe of each animal for DNA extraction and analysis.
[0384] For in vivo studies, genomic DNA was extracted from 10 mg of liver tissue using a bead-based extraction kit, such as the Zymo Quick-DNA 96 kit (Zymo Research, catalog number D3010), according to the manufacturer's protocol, which included homogenizing the tissue in lysis buffer (approximately 600 μL / 10 mg tissue). All DNA samples were normalized to a concentration of 100 ng / μL for PCR and subsequent NGS analysis, as described in Example 1.
[0385] Example 4.2. PCSK9 ELISA Analysis in Animal Studies
[0386] Collect blood and separate serum as described above. Determine total PCSK9 serum levels using the Human PCSK9 ELISA Kit (Abcam, catalog ab209884). Prepare kit reagents and standards according to the manufacturer's protocol. Dilute mouse serum 5 to 10-fold. Add 100 μL each of the standard curve diluent and the diluted serum sample to each well of an ELISA plate pre-coated with capture antibodies. Incubate the plate at room temperature for 30 minutes, then wash. Add 100 μL of enzyme-antibody conjugate per well and incubate for 20 minutes. Remove unbound antibody conjugate and wash the plate again, then add the chromogenic substrate solution. Incubate the plate for 10 minutes, then add 100 μL of stop solution, such as sulfuric acid (approximately 0.3 M). Read the plate at 450 nm absorbance using a SpectraMax M5 or Clariostar plate reader. Serum hPCSK9 levels were calculated using a four-parameter logistic curve fitted to a standard curve, either in SoftMax Pro version 6.4.2 or Mars version 3.31. The final serum values were adjusted for the assay dilution. The percentage of protein knockdown (KD%) relative to the control was measured; unless otherwise indicated, the control was typically an animal sham-treated with a mediator (TSS).
[0387] Example 4.3. In vivo editing and serum hPCSK9 knockdown
[0388] LNPs were prepared as described in Example 1. The average particle size, polydispersity (pdi), total RNA content, and RNA encapsulation efficiency of the LNP formulation were analyzed as described in Example 1.
[0389] As described above, transgenic hPCSK9 mice (n=4 in all groups) were administered LNPs containing the sgRNAs indicated in Table 10 at a dose of 0.3 mg / kg body weight. Editing efficiency and the percentage of hPCSK9 knockdown (%KD) compared to the TSS-only negative control containing the specified sgRNAs are shown in Table 10, and editing efficiency and hPCSK9 KD levels are plotted in… Figure 3A and Figure 3B middle.
[0390] Table 10: Liver editing and hPCSK9 protein knockdown
[0391]
[0392]
[0393] As described above, male and female transgenic hPCSK9 mice (n=2 males and n=2 females for each group) were administered LNPs containing guides G016675, G016723, and G016704 selected from Table 10 at animal body weights of 1 mg / kg, 0.3 mg / kg, and 0.1 mg / kg. Table 11 shows the editing efficiency, hPCSK9 protein level, and hPCSK9 knockdown percentage of LNPs containing the specified sgRNAs compared to the TSS-mediated negative control alone. Editing efficiency, hPCSK9 protein level, and hPCSK9 KD level percentage are shown in Table 11. Figures 4A to 4C middle.
[0394] Table 11: Liver editing, serum hPCSK9 concentration and %KD serum hPCSK9
[0395]
[0396] Example 5. Off-target analysis
[0397] Example 5.1. Biochemical Off-Target Analysis
[0398] Using biochemical methods (see, for example, Cameron et al., Nature Methods. 6, 600-606; 2017), potential off-target genomic sites cleaved by Cas9 were identified using specific guides targeting PCSK9. Single guide RNAs targeting human PCSK9 were screened using genomic DNA reference material NA24385 from the Coriell Institute and two control guides with known off-target characteristics. The number of potential off-target sites was detected in biochemical assays using a guide concentration of 48 nM and a Cas9 protein concentration of 16 nM; the results are shown in Table 12.
[0399] Table 12: Biochemical Off-Target Analysis
[0400] Guidance ID target genes site G016735 PCSK9 5 G016704 PCSK9 11 G016723 PCSK9 28 G016650 PCSK9 31 G016662 PCSK9 31 G016707 PCSK9 33 G016714 PCSK9 55 G016675 PCSK9 77 G016696 PCSK9 87 G016649 PCSK9 152 G000644 EMX1 99 G000645 VEGFA 1021
[0401] Example 5.2. Targeted sequencing for validating potential off-target sites
[0402] Following editing in cells, amplicon sequencing was used to further assess potential off-target insertion / deletion formation of the test guide at potential off-target sites. Individual potential off-target sites for each guide were identified either by the biochemical assays described above or by computer simulation prediction.
[0403] In this experiment, three sgRNAs targeting human PCSK9 were evaluated in triplicate. Primary human hepatocytes (PHH, Gibco, batch number: Hu8284) were seeded and transfected with LNPs containing Cas9 mRNA and sgRNA. Each cell plate was treated with a single-dose transfection of 38.2 nM guide (equivalent to 250 ng mRNA) to achieve the dose saturation required for further downstream off-target assays. DNA was isolated from the cells by lysis and subjected to NGS. Some potential off-target sites did not meet the quality metrics and were not included in the “Characterized Sites” count in Table 13. Repair structures were manually examined at loci with statistically relevant insertion / deletion rates at off-target cleavage sites to confirm insertion / deletion repair structures.
[0404] Table 13: Assessment of potential off-target editing sites
[0405]
[0406] Example 6. In vitro editing in primary hepatocytes with dilution curves
[0407] The editing efficacy of PCSK9-targeting guide RNA was tested in primary cynomolgus monkey hepatocytes (PCH) (Gibco, batch number: PCH-C423).
[0408] Example 6.1. Cell Preparation
[0409] Thaw and resuspend PCH cells in hepatocyte thawing medium containing seeding supplement (Williams E medium (Gibco, catalog A12176-01)) and dexamethasone + mixed supplement (Gibco, catalog A15563, batch 2019842) and seeding supplement with FBS inclusions (Gibco, catalog A13450, batch 1970698), then centrifuge. Discard the supernatant and resuspend the clumps of cells in hepatocyte seeding medium with supplement packs (Invitrogen, catalog A1217601, and Gibco, catalog CM3000). Count the cells and seed them at a density of 40,000 cells / well in 96-well plates coated with bio-coated collagen I (Thermo Fisher, catalog 877272). The seeded cells were allowed to settle and adhere in a tissue culture incubator at 37°C and a 5% CO2 atmosphere for 4–6 hours. After incubation, the formation of the cell monolayer was examined and the cells were washed once with hepatocyte maintenance medium (Invitrogen, catalog A1217601, and Gibco, catalog CM4000).
[0410] Example 6.2. LNP Processing
[0411] LNPs were generally prepared as described in Example 1. The LNPs contained 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG by molar ratio. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA (SEQ ID NO: 1002) weight ratio of 1:2. Each LNP was applied to cells using an 8-point 3-fold dilution curve starting at 200 ng mRNA / 100 μl as shown in Table 14.
[0412] Table 14: Guide substances and mRNA concentrations for dose-response curves
[0413] Guide concentration (nM) mRNA(ng) 32.25 200 10.75 67 3.58 22.2 1.19 7.4 0.4 2.5 0.13 0.8 0.04 0.27 0.013 0.9
[0414] After LNP treatment, cells were incubated for 24 hours at 37°C in Williams E medium (Gibco, A1217601) with maintenance supplements and 3% fetal bovine serum. Samples were run in duplicate. After 72 hours, cells were harvested and analyzed by NGS as described in Example 1. EC50 values and mean edit results are shown in Tables 15 and 16. Dose-response curves were plotted... Figure 5A and Figure 5B middle.
[0415] Table 15: Editing efficiency and EC50 (nM) of selected guidelines
[0416]
[0417] Table 16: Editing efficiency and EC50 (nM) of selected guidelines
[0418]
[0419] Example 7. In vitro editing of primary human hepatocytes with dilution curves
[0420] The editing efficacy of PCSK9-targeting guide RNA was tested in primary human hepatocytes (PHH) (Gibco / Thermo Fisher batch number: HU8381).
[0421] Example 7.1. Cell Preparation
[0422] Thaw and resuspend PHH cells in hepatocyte thawing medium containing seeding supplement (Williams E medium (Gibco, catalog A12176-01)) and dexamethasone + mixed supplement (Gibco, catalog A15563, batch 2019842), and seeding supplement and FBS inclusions (Gibco, catalog A13450, batch 1970698), followed by centrifugation. Discard the supernatant and resuspend the clumps of cells in hepatocyte seeding medium with supplement packs (Invitrogen, catalog A1217601, and Gibco, catalog CM3000). Count the cells and seed them at a density of 40,000 cells / well in 96-well plates coated with bio-coated collagen I (Thermo Fisher, catalog 877272). The seeded cells were allowed to settle and adhere in a tissue culture incubator at 37°C and a 5% CO2 atmosphere for 4–6 hours. After incubation, the formation of the cell monolayer was examined and the cells were washed once with hepatocyte maintenance medium (Invitrogen, catalog A1217601, and Gibco, catalog CM4000).
[0423] Example 7.2. LNP Processing
[0424] LNPs were generally prepared as described in Example 1. The LNPs contained 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG by molar ratio. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA (SEQ ID NO: 1002) weight ratio of 1:2. Each LNP was applied to cells using an 8-point 3-fold dilution curve starting at 200 ng mRNA / 100 μl as shown in Table 17.
[0425] Table 17: Guide materials and mRNA concentrations for dose-response curves.
[0426]
[0427]
[0428] After LNP treatment, cells were incubated for 24 hours at 37°C in Williams E medium (Gibco, A1217601) with maintenance supplements and 3% fetal bovine serum. Samples were run in duplicate. After 72 hours, cells were harvested and analyzed by NGS as described in Example 1. EC50 values and mean edit results are shown in Tables 18, 19, and 20. Dose-response curves were plotted... Figures 6A to 6C middle.
[0429] Table 18: Editing efficiency and EC50 (nM) of selected guidelines
[0430]
[0431] Table 19: Editing efficiency and EC50 (nM) of selected guidelines
[0432]
[0433] Table 20: Editing efficiency and EC50 (nM) of selected guidelines
[0434]
[0435] Example 8. In vitro editing of primary human hepatocytes with dilution curves
[0436] The editing efficacy of PCSK9-targeting guide RNAs in two different guide forms was tested in primary human hepatocytes (PHH) (Gibco / Thermo Fisher, batch numbers: HU8300, HU8373A, HU8284).
[0437] Example 8.1. Preparation of PHH cells
[0438] Thaw and resuspend PHH cells in hepatocyte thawing medium containing seeding supplement (Williams E medium (Gibco, catalog A12176-01)) and dexamethasone + mixed supplement (Gibco, catalog A15563, batch 2019842), and seeding supplement and FBS inclusions (Gibco, catalog A13450, batch 1970698), followed by centrifugation. Discard the supernatant and resuspend the clumps of cells in hepatocyte seeding medium with supplement packs (Invitrogen, catalog A1217601, and Gibco, catalog CM3000). Count the cells and seed them at a density of 33,000 cells / well in 96-well plates coated with bio-coated collagen I (Thermo Fisher, catalog 877272). The seeded cells were allowed to settle and adhere in a tissue culture incubator at 37°C and a 5% CO2 atmosphere for 4–6 hours. After incubation, the formation of the cell monolayer was examined and the cells were washed once with hepatocyte maintenance medium (Invitrogen, catalog A1217601, and Gibco, catalog CM4000).
[0439] Example 8.2. LNP Processing and Editing
[0440] LNPs were generally prepared as described in Example 1. The LNPs contained 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG by molar ratio. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA (SEQ ID NO: 1002) weight ratio of 1:2. Each LNP was applied to cells using a 12-point dose-response curve starting with a dose of 450 ng of total RNA by weight.
[0441] After LNP treatment, cells were incubated for 24 hours at 37°C in Williams E medium (Gibco, A1217601) with maintenance supplements and 3% fetal bovine serum. Samples were run in duplicate. After 72 hours, cells were harvested and analyzed by NGS as described in Example 1. Dose-response curves were plotted. Figures 7A to 7C The EC50 values and average edit percentage results are shown in Tables 21A to 21C.
[0442] Table 21A: Editing efficiency and EC50 (nM) of the selected guidelines in PHH (batch number: HU8300)
[0443]
[0444] (*) Editing results were excluded from EC50 calculations because the percentage of edits was significantly lower than the dose that caused the maximum edit (≥5% difference).
[0445] Table 21B: Editing efficiency and EC50 (nM) of the selected guidelines in PHH (batch number: HU8373A)
[0446]
[0447]
[0448] Table 21C: Editing efficiency and EC50 (nM) of the selected guidelines in PHH (batch number: HU8284)
[0449]
[0450] Example 9. In vivo editing using two different guide forms in a humanized PCSK9 mouse model using lipid nanoparticles (LNPs).
[0451] In vivo editing efficiency tests were performed on the guide designs for the selected modifications from Table 2. Male transgenic mice containing the human PCSK9 gene sequence (hPCSK9) were used in each study involving mice. hPCSK9 mice were bred in a hybrid C57B6 / 129 background, backcrossed once with B6, and then crossbred for population expansion. The mouse PCSK9 gene was excised from the genome of the hPCSK9 mice. Animals were approximately 6 weeks old and weighed before administration. LNP was administered via the lateral tail vein at doses of 0.1, 0.3, and 1 mg per kilogram of body weight (e.g., 0.1 mg / kg or 0.1 mpk), respectively. Adverse reactions in animals were observed approximately 24 hours after administration. Seven days after administration, animals were euthanized by exsanguination under isoflurane anesthesia and cervical dislocation. Blood was collected via cardiac puncture into serum separation tubes or tubes containing buffered sodium citrate for plasma, as described herein. For studies involving in vivo editing, liver tissue was collected for DNA extraction and analysis.
[0452] For in vivo studies, genomic DNA was extracted from liver tissue using a bead-based extraction kit, such as the Zymo Quick-DNA 96 kit (Zymo Research, catalog number D3010), according to the manufacturer's protocol, which included homogenizing the tissue in lysis buffer (approximately 600 μL / 10 mg tissue). All DNA samples were normalized to a concentration of 100 ng / μL for PCR and subsequent NGS analysis, as described in Example 1.
[0453] Example 9.1. In vivo editing and serum hPCSK9 knockdown
[0454] Collect blood and separate serum as described above. Measure total PCSK9 serum levels using the Human PCSK9 ELISA Kit (Abcam, catalog ab209884). Prepare kit reagents and standards according to the manufacturer's protocol. Dilute mouse serum 5 to 10-fold. Add both the standard curve diluent and the diluted serum sample to each well of the ELISA plate. Add the antibody mixture containing capture and detection antibodies to each well containing either the standard or the sample. Incubate the plate at room temperature with shaking for 60 minutes, then wash. Add the chromogenic solution to the plate and incubate on a shaker in the dark for 10 minutes, then add the stop solution, such as sulfuric acid (approximately 0.3 M). Read the plate at 450 nm absorbance using a SpectraMax M5 or Clariostar plate reader. Calculate serum hPCSK9 levels using a four-parameter logistic curve fitted to the standard curve using SoftMax Pro software version 6.4.2 or Mars software version 3.31. Adjust the final serum values for the assay dilution. The percentage of protein knockdown (%KD) was determined relative to pre-drug levels.
[0455] The mean editing efficiency, serum hPCSK9 protein level, and percentage of serum hPCSK9 knockdown (%KD) compared to pre-drug administration are shown in Table 22. Liver editing, hPCSK9 protein level, and percentage of hPCSK9 KD level are plotted separately in Table 22. Figures 8A to 8C middle.
[0456] Table 22. Editing efficiency, hPCSK9 protein level, and knockdown percentage of the selected guideline
[0457]
[0458]
[0459]
[0460]
[0461]
[0462]
[0463]
[0464]
[0465]
[0466]
[0467]
[0468]
[0469]
[0470]
[0471]
[0472]
[0473]
Claims
1. A guide RNA, comprising: A. A targeting sequence comprising a sequence having at least 95%, 90%, 85% or 80% identity or complementarity to the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13 - 15, 17, 18 or 20; B. A targeting sequence comprising a sequence identical or complementary to at least 17, 18, 19 or 20 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13 - 15, 17, 18 or 20; or C. A targeting sequence comprising a targeting sequence identical to the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13 - 15, 17, 18 or 20.
2. The guide according to claim 1, comprising a targeting sequence identical to the nucleotide sequence of SEQ ID NO: 9, 14 or 18.
3. The guide RNA according to claim 1 or 2, further comprising one or more of the following: A. A shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein 1. At least one of the following nucleotide pairs in hairpin 1 is replaced by Watson - Crick pairing nucleotides: H1 - 1 and H1 - 12, H1 - 2 and H1 - 11, H1 - 3 and H1 - 10 or H1 - 4 and H1 - 9, and the hairpin 1 region optionally lacks a. Any one or two of H1 - 5 to H1 - 8, b. One, two or three of the following nucleotide pairs: H1 - 1 and H1 - 12, H1 - 2 and H1 - 11, H1 - 3 and H1 - 10 and H1 - 4 and H1 - 9, or c. 1 - 8 nucleotides of the hairpin 1 region; or 2. The shortened hairpin 1 region lacks 4 - 8 nucleotides, preferably 4 - 6 nucleotides; and a. One or more of positions H1 - 1, H1 - 2 or H1 - 3 are deleted or substituted relative to the exemplary SpyCas9 sgRNA - 1; or b. One or more of positions H1 - 6 to H1 - 10 are substituted relative to the exemplary SpyCas9 sgRNA - 1; or 3. The shortened hairpin 1 region lacks 5 - 10 nucleotides, preferably 5 - 6 nucleotides, and one or more of positions N18, H1 - 12 or n are substituted relative to the exemplary SpyCas9 sgRNA - 1; or B. A shortened upper stem region, wherein the shortened upper stem region lacks 1 - 6 nucleotides and wherein 6, 7, 8, 9, 10 or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to the exemplary SpyCas9 sgRNA - 1; or C. Substitutions at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2 - 2 and H2 - 14 relative to the exemplary SpyCas9 sgRNA, wherein the substituent nucleotide is neither a pyrimidine followed by an adenine nor an adenine preceded by a pyrimidine; or D. Exemplary SpyCas9 sgRNA-1 with an upper stem region, wherein the upper stem modification includes modification of any one or more of US1-US12 in the upper stem region.
4. The guide RNA according to claim 3, wherein the guide RNA lacks 6 nucleotides in the shortened hairpin 1.
5. The guide RNA according to claim 3, wherein the guide RNA lacks 8 nucleotides in the shortened hairpin 1.
6. The guide RNA according to any one of claims 3 to 5, wherein H-1 and H-3 are deleted.
7. The guide RNA according to any one of claims 3 to 6, wherein the guide RNA further comprises a 3' tail.
8. The guide RNA according to claim 7, wherein the length of the 3' tail is 1-4 nucleotides, optionally 1 nucleotide.
9. The guide RNA according to any one of claims 3 to 8, wherein the guide RNA comprises an upper stem region that includes modification of any one or more of US1-US12 in the upper stem region.
10. The guide RNA according to claim 1 or 2, which comprises a modified nucleotide sequence according to the pattern (mN*)3(N)13-17, wherein "m" represents a 2'-O-methyl modification, * represents a phosphorothioate bond, and N represents a 2'-OH and a phosphodiester bond.
11. The guide RNA according to claim 1, wherein the guide RNA comprises a modified nucleotide sequence selected from the sequences (SEQ ID NO: 501-512, optionally SEQ ID NO: 507 or 512) in Table 4A, wherein the modified nucleotide sequence is at the 3' of the guide sequence.
12. The guide RNA according to claim 11, which is modified according to the pattern of a nucleotide sequence selected from the sequences (SEQ ID NO: 601-612, optionally SEQ ID NO: 607 or 612) in Table 4B, wherein (mN*)3N17 refers to the targeting sequence according to claim 1 or 2.
13. The guide RNA according to any one of claims 1 to 12, wherein the guide RNA comprises a nucleotide sequence selected from SEQ ID NO: 121, 109, 101, 102, 107, 113-115, 117, 118, 120, 122 or 123 provided in Table 2, optionally SEQ ID NO: 109, 114, 118, 121, 122 or 123.
14. The guide RNA according to claim 13, wherein each nucleotide is any natural or unnatural nucleotide.
15. The guide RNA according to claim 14, wherein the guide RNA comprises a modified nucleotide sequence selected from SEQ ID NO: 221, 209, 201, 202, 207, 213-215, 217, 218, 220, 222 or 223 provided in Table 2, optionally SEQ ID NO: 209, 214, 218, 221, 222 or 223.
16. A composition comprising a guide RNA as described in any one of claims 1 to 15.
17. The composition according to claim 16, further comprising an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.
18. The composition according to claim 17, wherein the nucleic acid encoding the RNA-guided DNA binder comprises an mRNA comprising an open reading frame (ORF) encoding the RNA-guided DNA binder.
19. The composition according to claim 17 or 18, wherein the RNA-guided DNA binder is a Cas9 nuclease.
20. The composition according to claim 19, wherein the Cas9 is Streptococcus pyogenes Cas9.
21. The composition according to claim 20, wherein the Streptococcus pyogenes Cas9 comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 1001, 1004, 1007 or 1010, or an ORF encoding Streptococcus pyogenes Cas9 having at least 90% identity with a sequence selected from SEQ ID NO: 1003, 1006 and 1009.
22. The composition according to claim 21, wherein the ORF encoding the amino acid sequence has at least 95% identity with SEQ ID NO: 1003, 1006 or 1009.
23. The composition according to any one of claims 19 to 22, wherein the nuclease has double-stranded endonuclease activity.
24. The composition according to any one of claims 18 to 23, wherein the ORF is a modified ORF.
25. The composition according to claim 21, wherein the guide RNA comprises a targeting sequence identical to the nucleotide sequence of SEQ ID NO: 9 and the Streptococcus pyogenes Cas9 comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 1001, wherein the Streptococcus pyogenes Cas9 wherein the nuclease has double-stranded endonuclease activity.
26. The composition according to claim 21, wherein the guide RNA comprises a targeting sequence comprising a sequence identical to the nucleotide sequence of SEQ ID NO: 9 and the Streptococcus pyogenes Cas9 comprises an amino acid sequence comprising the amino acid sequence of SEQ ID NO: 1001.
27. The composition according to claim 21, wherein the guide RNA comprises a targeting sequence comprising a sequence identical to the nucleotide sequence of SEQ ID NO: 9, and wherein the Streptococcus pyogenes Cas9 comprises an ORF encoding Streptococcus pyogenes Cas9 having at least 90% identity with a sequence selected from SEQ ID NO: 1003, wherein the Streptococcus pyogenes Cas9 wherein the nuclease has double-stranded endonuclease activity.
28. The composition according to any one of claims 25 to 27, wherein the ORF is a modified ORF.
29. The composition according to any one of claims 25 to 28, wherein the guide RNA comprises the nucleotide sequence of SEQ ID NO: 121 or 109.
30. The composition according to any one of claims 25 to 28, wherein the guide RNA comprises a modified nucleotide sequence of SEQ ID NO: 221 or 209.
31. The composition according to any one of claims 16 to 30, further comprising a pharmaceutical excipient.
32. The composition according to any one of claims 16 to 31, wherein the guide RNA is associated with a lipid nanoparticle (LNP).
33. The composition according to claim 32, wherein the LNP comprises a cationic lipid.
34. The composition according to claim 33, wherein the cationic lipid is (9Z,12Z)-3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.
35. The composition according to any one of claims 32 to 34, wherein the LNP comprises a helper lipid.
36. The composition according to claim 35, wherein the helper lipid is cholesterol.
37. The composition according to any one of claims 32 to 36, wherein the LNP comprises a neutral lipid.
38. The composition according to claim 37, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).
39. The composition according to any one of claims 32 to 38, wherein the LNP comprises a stealth lipid.
40. The composition according to claim 39, wherein the stealth lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG).
41. The composition according to claim 32, wherein the LNP comprises (9Z,12Z)-3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate); DSPC; cholesterol; and PEG2k-DMG.
42. A pharmaceutical composition comprising the guide RNA according to any one of claims 1 to 15 or the composition according to any one of claims 16 to 41.
43. A pharmaceutical composition comprising a guide RNA as described in any one of claims 1 to 15 or a composition as described in any one of claims 16 to 41; or the use of a guide RNA as described in any one of claims 1 to 15 or a composition as described in any one of claims 16 to 41 for inducing a double-strand break or a single-strand break within the PCSK9 gene in a cell or reducing the expression of the PCSK9 gene in a cell.
44. The pharmaceutical composition or use according to claim 43, wherein the cell is a liver cell.
45. The pharmaceutical composition or use according to claim 44, wherein the cell is in a subject.
46. A pharmaceutical composition comprising a guide RNA as described in any one of claims 1 to 15 or a composition as described in any one of claims 16 to 41; or the use of a guide RNA as described in any one of claims 1 to 15 or a composition as described in any one of claims 16 to 41 for treating a subject suffering from a PCSK9-related disease.
47. A method for inducing a double-strand break or a single-strand break within the PCSK9 gene in a cell or reducing the expression of the PCSK9 protein in a cell, the method comprising contacting the cell with a guide RNA as described in any one of claims 1 to 15 and an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent or a composition as described in any one of claims 16 to 41.
48. The use of a guide RNA as described in any one of claims 1 to 15 or a composition as described in any one of claims 16 to 41 for preparing an agent for carrying out the method according to claim 47.
49. A human liver cell comprising an insertion or deletion of a nucleotide sequence selected from the genomic loci in Table 1.
50. The human liver cell according to claim 49, comprising an insertion or deletion in a nucleotide sequence selected from the following genomic loci: genomic loci selected from SEQ ID NO: 9, 1, 2, 7, 13 - 15, 17, 18 or 20.
51. A method for modifying a genomic locus in a human liver cell, the method comprising contacting the human liver cell with a guide RNA as described in any one of claims 1 to 15 and an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent or a composition as described in any one of claims 16 to 41.
52. The method according to claim 51, wherein the method is carried out in vivo.
53. The pharmaceutical composition, method or cell according to any one of claims 44, 45, 49 to 52, wherein the liver cell is a hepatocyte.
54. The pharmaceutical composition, method or cell according to claim 53, wherein the cell is in a subject suffering from a PCSK9-related disease.
55. A method for treating a PCSK9-related disease in a subject, the method comprising administering to the subject a guide RNA and an RNA-guided DNA binding agent as described in any one of claims 1 to 15, or a nucleic acid encoding an RNA-guided DNA binding agent, or a composition as described in any one of claims 16 to 41, or a pharmaceutical composition as described in claim 42.
56. A pharmaceutical composition, method or cell as described in any one of claims 42 to 55, further comprising determining the level of PCSK9 protein in a blood or serum sample of the subject.
57. Use of a guide RNA as described in any one of claims 1 to 15, or a composition as described in any one of claims 16 to 41, or a pharmaceutical composition as described in claim 42, for the preparation of an agent for carrying out any one of the methods as described in claim 47 or 51 to 56.
58. A kit comprising a guide RNA and an RNA-guided DNA binding agent as described in any one of claims 1 to 15, or a nucleic acid encoding an RNA-guided DNA binding agent, a composition as described in any one of claims 16 to 41, or a pharmaceutical composition as described in any one of claims 42 to 46.
59. A kit for use or for carrying out any one of the methods as described in claim 47 or 51 to 56.
Citation Information
Patent Citations
Improvements in and relating to cyclone separators
GB607786A
Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
US20140186958A1
Fusions of CAS9 domains and nucleic acid-editing domains
US20150166980A1
RNA Modification to Engineer Cas9 Activity
US20170114334A1
Targeted CRISPR Delivery Platforms
US20190338308A1