Application of neoliquiritin in preparation of medicine for treating myocardial hypertrophy

By using new glycyrrhizin to prepare into pharmaceutically acceptable dosage forms, the problem of lack of effective anti-myocardial hypertrophy drugs in the prior art has been solved, and the effect of significantly inhibiting cardiomyocyte hypertrophy is achieved, and the potential for developing anti-myocardial hypertrophy drugs is achieved.

CN120324451AActive Publication Date: 2025-07-18CHINA PHARM UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510753012.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2025-07-18
Estimated Expiration
2045-06-06

AI Technical Summary

Technical Problem

There is a lack of effective anti-myo hypertrophy drugs in the prior art, and the anti-myo hypertrophy effect of isoligergicin is weak and cannot effectively inhibit the hypertrophy of cardiomyocytes.

Method used

New glycyrrhizin is used as an active ingredient to prepare pharmaceutically acceptable dosage forms such as tablets, capsules or injections for the treatment of myocardial hypertrophy.

Benefits of technology

Neoglycyrrhizin significantly inhibits cardiomyocyte hypertrophy and has significant anti-myohypertrophy effects, which is far superior to isoglycyrrhizin, and has the prospect of developing anti-myohypertrophy drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120324451A_ABST
    Figure CN120324451A_ABST
Patent Text Reader

Abstract

The invention discloses an application of neoliquiritin in preparation of a medicine for treating myocardial hypertrophy. The invention discovers that the neoliquiritin has a remarkable myocardial hypertrophy resisting effect and has a prospect of being developed into the myocardial hypertrophy resisting medicine. Technicians in the field know that isoliquiritin is an isomeride of neoliquiritin, mother nucleus structures are flavanone skeletons, but the myocardial hypertrophy resistance effect of isoliquiritin is very weak and is far better than that of neoliquiritin, and the technical effect is unexpected by the technicians in the field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and particularly relates to the application of neoliquiritin in the preparation of drugs for treating myocardial hypertrophy. Background Art

[0002] Myocardial hypertrophy is an adaptive / decompensatory structural remodeling that occurs in the heart under long-term pressure overload (such as hypertension, aortic stenosis) or pathological stimuli (such as myocardial infarction, neuroendocrine disorders). Short-term myocardial hypertrophy is an adaptive response to maintain the normal systolic and diastolic functions of the heart, while long-term pathological myocardial hypertrophy can lead to cardiovascular complications such as heart failure, arrhythmia, and myocardial fibrosis. According to the World Health Organization, cardiovascular diseases are the main cause of global mortality. The main pathological features of pathological myocardial hypertrophy include an increase in the cross-sectional area of myocardial cells, myocardial systolic and diastolic disorders, ventricular wall thickening, and increased expression of hypertrophy markers such as atrial natriuretic peptide and brain natriuretic peptide.

[0003] The molecular formula of neoliquiritin is C 21 H 22 O9, and the CAS number is 5088-75-5. There is currently no report on the anti-myocardial hypertrophy activity of neoliquiritin. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of neoliquiritin in the preparation of drugs for treating myocardial hypertrophy.

[0005] The above object of the present invention is achieved by the following technical solutions:

[0006] The application of neoliquiritin in the preparation of anti-myocardial hypertrophy drugs.

[0007] Preferably, the anti-myocardial hypertrophy drug is formulated with neoliquiritin as the active ingredient and pharmaceutically acceptable excipients into a pharmaceutically acceptable dosage form.

[0008] More preferably, the excipients are solid, liquid or semi-solid excipients.

[0009] More preferably, the dosage form is tablets, capsules, soft capsules or injections.

[0010] Advantageous Effects:

[0011] The present invention discovers that neoliquiritin has a significant anti-myocardial hypertrophy effect. Isoliquiritin is an isomer of neoliquiritin, and their parent nuclear structures are both flavanone skeletons, but its anti-myocardial hypertrophy effect is very weak, far inferior to that of neoliquiritin. Therefore, neoliquiritin has the prospect of being developed into an anti-myocardial hypertrophy drug. Brief Description of the Drawings

[0012] Figure 1Results of staining of primary cardiomyocytes in each group;

[0013] Figure 2 Expression levels of cardiac hypertrophy markers in H9c2 cells of each group. Detailed implementation manners

[0014] The following describes the substantial content of the present invention in detail with reference to the embodiments, but does not limit the protection scope of the present invention thereto.

[0015] Example 1: Cell model based on neonatal rat ventricular myocytes (NRVM)

[0016] I. Experimental materials

[0017] Neoliquiritin (Hangzhou TargetMol Biotech Co., Ltd., 5088-75-5);

[0018] Isoliquiritin (Hangzhou TargetMol Biotech Co., Ltd., 5041-81-6);

[0019] 2-3-day-old Sprague Dawley rats (Hangzhou Ziyuan Laboratory Animal Technology Co., Ltd.);

[0020] 0.5% type II collagenase (Biosharp, BS164);

[0021] Red blood cell lysate (Beyotime, C3702);

[0022] 10×PBS (KeyGEN, KGB50011);

[0023] Percoll cell separation solution (Biosharp, BS909);

[0024] Fetal bovine serum (FBS, Gibco, 10270-106);

[0025] Trypsin (Gibco, 25200072);

[0026] DMEM high-glucose medium (containing double antibodies) (KeyGEN, KGM12800-500);

[0027] SteadyPure Quick RNA Extraction Kit (AG Inc., AG21023);

[0028] HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) (Vazyme, R212-01 / 02);

[0029] ChamQ SYBR Color qPCR Master Mix (Vazyme, Q411-02);

[0030] ABIQuant Studio 3 Real-Time Fluorescent Quantitative PCR Instrument (Thermo, American);

[0031] Primers designed by Premier 5.0 (GAPDH rat F: AGGTCGGTGTGAACGGATTTG; GAPDH rat R: TGTAGACCATGTAGTTGAGGTCA; ANP rat F: GCTTCCAGGCCATATTGGAG; ANP rat R: GGGGGGCATGACCTCATCTT; BNP rat F: GAGGTCACTCCTATCCTCTGG; BNP rat R: GCCATTTCCTCCGACTTTTCTC, Tsingke Biological Technology);

[0032] Angiotensin II (Ang II, Hangzhou TargetMol Biotechnology Co., Ltd., 4474-91-3).

[0033] II. Experimental Methods

[0034] 1. Acquisition and Culture of NRVM Cells

[0035] In this experiment, NRVM cells were isolated from 2- to 3-day-old Sprague-Dawley rats, with a purity of over 90% and good cell viability. The specific steps are as follows:

[0036] (1) All surgical instruments were sterilized and ready for use.

[0037] (2) Two culture dishes were placed in an ice box, and PBS solution was placed in the dishes for rinsing the heart.

[0038] (3) 2- to 3-day-old Sprague-Dawley rats (10) were wiped with alcohol cotton balls, and then the chest skin was disinfected with alcohol cotton balls.

[0039] (4) The sternum was horizontally cut with an ophthalmic curved scissors to extrude the heart, and the heart was taken out with an ophthalmic curved forceps and placed in a culture dish containing ice-bathed PBS solution.

[0040] (5) In another culture dish containing ice-bathed PBS solution, the heart was rinsed and squeezed with forceps to remove the blood in the heart.

[0041] (6) The heart tissue was cut into 1 mm with an ophthalmic curved scissors 3Small pieces were cut, and the minced heart was transferred into a 25 mL conical flask. Then, 5 mL of 0.5% type II collagenase solution was aspirated and added to the conical flask, and it was shaken and digested 6 - 8 times in a 37°C water bath.

[0042] (7) The supernatant was collected in a 15 mL centrifuge tube, and the digestion was terminated with 5 mL of high - glucose DMEM medium containing 10% FBS (with double antibiotics).

[0043] (8) The centrifuge tube was placed in a centrifuge at 1500 rpm and centrifuged for 3 min, and the supernatant was discarded.

[0044] (9) The collected cells were resuspended with high - glucose DMEM medium containing 10% FBS (with double antibiotics), the tissue mass was filtered through a filter, and diluted to an appropriate density and plated in a cell culture dish.

[0045] (10) In this experiment, neonatal rat ventricular myocytes (NRVM) and cardiac fibroblasts (PCF) were separated by differential attachment method. After incubation in an incubator at 37°C and 5% CO2 for 2 h, it was taken out, and the adherent cells (mainly fibroblasts and endothelial cells) were discarded, and the non - adherent cell suspension was aspirated.

[0046] (11) Erythrocyte lysis buffer was used to lyse red blood cells, and NRVM was purified by Percoll gradient, centrifuged at 1500 rpm for 3 min, and the supernatant was discarded.

[0047] (12) Finally, the cells were resuspended and continued to be cultured with DMEM containing 10% FBS for subsequent experiments.

[0048] 2. Preparation of angiotensin II solution

[0049] Weigh 1 mg of angiotensin II powder, add 955.84 μL of DMSO, vortex, and prepare a 1 mM stock solution, and finally dilute it to the concentration required for the experiment with the medium.

[0050] 3. Alexa fluor TM 488 phalloidin solution staining was used to detect the change in the surface area of primary neonatal rat cardiomyocytes

[0051] (1) Take NRVM cells in good growth state and inoculate 10,000 cells per well in a 96-well plate. Add an equal amount of high-glucose DMEM medium containing 10% FBS (containing double antibiotics) to each well. Divide them into a normal group (Control), a model group (Ang II), an Isoliquiritin group (10 μM), and a Neoliquiritin group (10 μM), with 6 replicate wells in each group. After culturing in an incubator at 37 °C and 5% CO2 for 24 h, the normal group is replaced with fresh medium, the model group is replaced with fresh medium containing 250 nM Ang II, the Isoliquiritin group is replaced with fresh medium containing 250 nM Ang II and 10 μM Isoliquiritin, and the Neoliquiritin group is replaced with fresh medium containing 250 nM Ang II and 10 μM Neoliquiritin.

[0052] (2) After grouping and culturing for 24 h, aspirate and discard the original medium. Add 100 μL of PBS to each well and rinse twice, 3 min for each rinse.

[0053] (3) Add 100 μL of 4% paraformaldehyde to each well and fix for 15 min. Then aspirate and discard the fixing solution, and gently wash 3 times with 100 μL of PBS, 3 min for each wash.

[0054] (4) Add 100 μL of 0.1% Tritonx-100 to each well and permeabilize at room temperature for 10 min. Aspirate and discard the permeabilizing solution, and wash 3 times with 100 μL of PBS, 3 min for each wash.

[0055] (5) Prepare a mixed staining solution. Dilute the two dyes in high-glucose DMEM medium (containing double antibiotics) according to the ratio of Alexa fluor TM 488 phalloidin stock solution 1:10,000 and Hoechst33342 solution 1:1500. After fully vortexing and mixing, store in the dark.

[0056] (6) Add 100 μL of the mixed staining solution to each well and incubate at 37 °C in the dark for 20 min.

[0057] (7) Aspirate and discard the mixed staining solution, and wash 3 times with 100 μL of PBS, 3 min for each wash.

[0058] (8) Finally, add 100 μL of PBS to each well, and then use a high-content imaging analyzer to collect cytoskeleton phenotype data.

[0059] (9) Image phenotype parameters were collected based on a high-content imaging system. A 40× water lens was selected, and the confocal mode was used. Nine fields of view were collected per well. The Alexa 488 channel was used to label the cytoskeleton, and the Hoechst 33342 channel was used to label the cell nucleus for cell morphology data collection. The images were saved as 12-bit TIFF files.

[0060] (10) Subsequently, Harmony 4.9 software was used to extract the phenotype data of the collected images. The data processing method for the cross-sectional area of cells was as follows: Find nuclei → Find cell - Alexa 488 → Calculate Cell F-actinArea [μm 2 (Method: Standard). That is, the Hoechst 33342 channel was used to label the cell nucleus. After localizing individual cells based on the labeled cell nucleus, the cytoskeleton was identified by the Find cell method using the Alexa488 channel, and the surface area of cardiomyocytes was calculated and output in text data format.

[0061] 4. Statistical analysis

[0062] GraphPad Prism 10.0 software was used to statistically analyze the experimental results. The results were expressed as mean ± standard deviation (mean ± SD). One-way ANOVA was used to test and analyze the significant differences between each group of data. Compared with the normal group, * indicates P < 0.05, ** indicates P < 0.01; compared with the model group, # indicates P < 0.05, ## indicates P < 0.01, all indicating that the differences were statistically significant.

[0063] III. Experimental results

[0064] The staining results of primary cardiomyocytes in each group were as Figure 1 shown in and Table 1. Compared with the normal group, the cell surface area of cardiomyocytes in the model group was significantly increased, indicating that the cardiomyocyte hypertrophy model was successfully established; compared with the model group, the cell surface area of cardiomyocytes in the neohesperidin group was significantly decreased and could be reduced to be basically the same as that of the normal group, indicating that neohesperidin has a significant anti-cardiomyocyte hypertrophy effect. Isoliquiritin is an isomer of neohesperidin, and their parent nucleus structures are both flavanone skeletons, but its anti-cardiomyocyte hypertrophy effect is less than 15% inhibition rate, far less than that of neohesperidin. Based on this, neohesperidin was used as the key compound for subsequent anti-cardiomyocyte hypertrophy research.

[0065] Table 1 Staining results of primary cardiomyocytes in each group

[0066] Group <![CDATA[NRVM - Cell surface area (μm 2 )]]> Inhibition rate Normal group (Group C) 1.651±0.316 / Model group (Group M) 2.410±0.031** / Neoliquiritin group <![CDATA[1.647±0.129 ## > 31.66% Isoliquiritin group <![CDATA[2.078±0.191 ns > 13.78%

[0067] Example 2: Cell Model Based on Rat Cardiomyocytes H9c2

[0068] I. Experimental Materials

[0069] Neoliquiritin (Hangzhou TargetMol Biotechnology Co., Ltd., 5088 - 75 - 5);

[0070] Rat cardiomyocytes (H9c2, National Cell Authentication Resource Center, Chinese Academy of Sciences (Shanghai, China));

[0071] Fetal Bovine Serum (FBS, Gibco, 10270 - 106);

[0072] Trypsin (Gibco, 25200072);

[0073] DMEM high - glucose medium (containing double antibiotics) (KeyGEN, KGM12800 - 500);

[0074] SteadyPure Quick RNA Extraction Kit (AG Inc., AG21023);

[0075] HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) (Vazyme, R212 - 01 / 02);

[0076] ChamQ SYBR Color qPCR Master Mix (Vazyme, Q411 - 02);

[0077] 480 Instrument II (Roche, Shanghai, China);

[0078] Primers designed by Premier 5.0 (GAPDH rat F: AGGTCGGTGTGAACGGATTTG; GAPDH rat R: TGTAGACCATGTAGTTGAGGTCA; ANP rat F: GCTTCCAGGCCATATTGGAG; ANP rat R: GGGGGGCATGACCTCATCTT; BNP rat F: GAGGTCACTCCTATCCTCTGG; BNP rat R: GCCATTTCCTCCGACTTTTCTC, Tsingke Biological Technology);

[0079] Angiotensin II (Ang II, Hangzhou TargetMol Biotechnology Co., Ltd., 4474 - 91 - 3).

[0080] II. Experimental Methods

[0081] 1. Prepare angiotensin II solution

[0082] Weigh 1 mg of angiotensin II powder, add 955.84 μL of DMSO, vortex, and prepare a 1 mM stock solution. Finally, dilute it to the required concentration for the experiment with the culture medium.

[0083] 2. Cell culture

[0084] Resuscitate H9c2 cells in DMEM high-glucose medium (containing double antibiotics) with 10% FBS, and culture and passage them in an incubator at 37 °C and 5% CO2 saturated humidity. Use cells from passages F4 - F8 for the experiment.

[0085] 3. Detect the mRNA expression levels of myocardial hypertrophy markers in H9c2 cells by fluorescence quantitative PCR (q-PCR)

[0086] (1) Take H9c2 cells in good growth state, inoculate 5000 cells per well in a 96-well plate, and add an equal amount of DMEM high-glucose medium (containing double antibiotics) with 10% FBS to each well. Divide them into a normal group (Control), a model group (Ang II), and a Neoliquiritin group (10 μM), with 6 replicate wells in each group. After culturing in an incubator at 37 °C and 5% CO2 for 24 h, replace the medium in the normal group with fresh medium, replace the medium in the model group with fresh medium containing 250 nM Ang II, and replace the medium in the Neoliquiritin group with fresh medium containing 250 nM Ang II and 10 μM Neoliquiritin.

[0087] (2) Take the cells after modeling and drug incubation for 24 h, and use the SteadyPure rapid RNA extraction kit to extract total cellular RNA. Then use the HiScript II.Q-RT SuperMix for reverse transcription reaction to synthesize cDNA. Finally, use the ChamQ SYBR Color qPCR Master Mix detection kit for qPCR experiments. The qPCR reaction uses a 20 μL system, including: 5 μL of 2×ChamQ SYBR Color qPCR Master Mix, 0.25 μL of Primer 1 (1 μM), 0.25 μL of Primer 2 (1 μM), 0.5 μL of cDNA, and make up to 20 μL with ddH20. React under a two-step PCR amplification program: pre-denaturation at 95 °C for 30 s, denaturation at 95 °C for 10 s, annealing and extension at 60 °C for 30 s, for a total of 40 cycles. After the experiment, verify the reliability of the reaction through the amplification curve and melting curve, and calculate the relative mRNA expression levels (2-ΔΔCt) of the target genes ANP and BNP for statistical analysis of the experimental data.

[0088] 4. Statistical analysis

[0089] The experimental results were statistically analyzed using GraphPad Prism 10.0 software, and the results were expressed as mean ± standard deviation (mean ± SD). One-way ANOVA was used to test and analyze the significant differences between each group of data. Compared with the normal group, * indicates P < 0.05, and ** indicates P < 0.01; compared with the model group, # indicates P < 0.05, ## indicates P < 0.01, both indicating that the differences are statistically significant.

[0090] III. Experimental results

[0091] To verify the effect of Neoliquiritin on myocardial hypertrophy, we conducted a verification experiment through an Ang II-induced myocardial hypertrophy model in H9c2 cells. The qPCR results of H9c2 cells are as Figure 2 shown in Table 2. Compared with the normal group, the expression levels of ANP and BNP mRNA in the model group cells were significantly increased, indicating that the myocardial hypertrophy model was successfully established; compared with the model group, the expression of ANP and BNP mRNA in the Neoliquiritin group cells decreased. Those skilled in the art know that ANP and BNP are important markers of myocardial hypertrophy. Therefore, the experimental results show that Neoliquiritin has an obvious anti-myocardial hypertrophy effect.

[0092] Table 2 Expression levels of myocardial hypertrophy markers in H9c2 cells of each group

[0093] Group ANPmRNA BNPmRNA Normal group (Group C) 0.927±0.103 0.916±0.108 Model group (Group M) 1.412±0.158* 1.293±0.034** Neoliquiritin group <![CDATA[0.959±0.199 # > <![CDATA[1.041±0.028 ## >

[0094] In summary, Neoliquiritin has a significant anti-myocardial hypertrophy effect and has the prospect of being developed into an anti-myocardial hypertrophy drug.

[0095] The role of the above embodiments is to specifically introduce the substantial content of the present invention, but those skilled in the art should know that the protection scope of the present invention should not be limited to this specific embodiment.

Claims

1. Application of neohesperidin in the preparation of anti - myocardial hypertrophy drugs.

2. The application according to claim 1, characterized in that: The anti - myocardial hypertrophy drug contains neohesperidin as the active ingredient and is made into a pharmaceutically acceptable dosage form with pharmaceutically acceptable excipients.

3. The application according to claim 2, characterized in that: The excipients are solid, liquid or semi - solid excipients.

4. The application according to claim 2, characterized in that: The dosage form is tablets, capsules, soft capsules or injections.

Citation Information

Patent Citations

  • Treatment medicine and healthy product including liquiritin

    CN101032505A

  • Machine learning-based organelle combination phenotype high-throughput drug screening method

    CN119541693A