Brassica napus BnARGOS gene and application thereof
By cloning and overexpressing the kale-type rape BnARGOS gene, the problem of increasing the length and horned fruit density of rape main inflorescence was solved, and the growth period was extended and the seed weight was increased, which significantly increased the yield of rape single plant.
Patent Information
- Application Number
- CN202510503764.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-22
- Publication Date
- 2025-07-18
AI Technical Summary
In the prior art, the length and horned fruit density of rapeseed main inflorescence are difficult to increase without increasing plant height, affecting yield, and there are few related research and lack of effective gene regulation methods.
By cloning and overexpressing the kale-type rape BnARGOS gene, recombinant expression vectors were constructed and transformed into the plant genome, delaying flowering time, increasing seed weight and main inflorescence horn fruit density.
Extend the growth period, significantly increase the yield of a single plant, increase the seed weight and the density of the main inflorescence horn fruit, and enhance the yield of rapeseed.
Smart Images
Figure BDA0005369178160000051 
Figure HDA0005369178170000011 
Figure HDA0005369178170000012
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of plant molecular biology, and particularly relates to the Brassica napus BnARGOS gene and its application. Background Art
[0002] Rapeseed is a typical cruciferous vegetable. Its main inflorescence is located at the top of the plant, and the siliques are mainly distributed at the tip of the main inflorescence and on the lateral branches, which are the main economic parts of rapeseed. The main inflorescence is very important for rapeseed yield and cultivating an ideal plant type. Plants with longer main inflorescences have higher plant heights, more siliques on the main inflorescence, and higher yields. In other words, it is difficult to increase the length of the main inflorescence without increasing the plant height. Considering the current requirements of high-density rapeseed production for mechanical sowing, it is very important to select germplasm resources with appropriate main inflorescence length and high silique density. SDMI is closely related to rapeseed yield. Rapeseed mainly produces seeds from the siliques on the main stem, and the number of siliques directly determines the number and yield of seeds.
[0003] At present, there are few related studies on rapeseed SDMI. Therefore, studying how SD affects rapeseed yield can provide important references for high-yield rapeseed. Therefore, narrowing the QTL interval of rapeseed SDMI, mining and identifying candidate genes related to SDMI, and studying the molecular mechanism of SDMI are of great significance for improving rapeseed yield and cultivating rapeseed plant types suitable for mechanization. Studying the functions of candidate genes can also provide a theoretical basis for regulating the silique density of the main inflorescence of rapeseed. Summary of the Invention
[0004] One object of the present invention is to provide the Brassica napus BnARGOS gene; a second object of the present invention is to provide a recombinant expression vector containing the Brassica napus BnARGOS gene; a third object of the present invention is to provide the application of the Brassica napus BnARGOS gene.
[0005] To achieve the above invention objects, the present invention provides the following technical solutions:
[0006] The present invention provides a Brassica napus BnARGOS protein, and the amino acid sequence of the Brassica napus BnARGOS protein is as shown in SEQ ID No.2 or SEQ ID No.4.
[0007] The present invention also provides a gene encoding the Brassica napus BnARGOS protein. Preferably, the sequence of the gene is as shown in SEQ ID No.1 or SEQ ID No.3. Among them, the gene with the sequence of SEQ ID No.1 is cloned from the fruit-dense parental material, and the gene with the sequence of SEQ ID No.3 is cloned from the fruit-scarce parental material.
[0008] The present invention also provides a recombinant expression vector containing the Brassica napus BnARGOS gene. Preferably, the recombinant expression vector is an overexpression vector. The recombinant expression vector is constructed by ligating the sequence shown in SEQ ID No.1 or SEQ ID No.3 downstream of the 35S promoter of the vector.
[0009] The present invention also provides the application of the Brassica napus BnARGOS gene or the expression vector in improving the SDMI of plants.
[0010] The present invention also provides the application of the Brassica napus BnARGOS gene or the expression vector in increasing the seed weight of plants.
[0011] The present invention also provides the application of the Brassica napus BnARGOS gene or the expression vector in regulating the flowering period of plants.
[0012] In a specific embodiment, the gene or the expression vector is transformed into the plant genome, the gene is overexpressed, and the flowering time of the plant is delayed, the SDMI of the plant is increased, and / or the seed weight of the plant is increased.
[0013] The present invention provides the Brassica napus BnARGOS gene and its encoded protein. After heterologously overexpressing the BnARGOS gene in Arabidopsis thaliana, positive plants were identified by fluorescence quantitative means, cultured to the T3 generation, and then the flowering period, grain weight, and SDMI of Arabidopsis thaliana were statistically analyzed. The results show that the BnARGOS gene affects the growth and development of plants, prolongs the growth period, increases the grain weight, significantly increases the SDMI, and thus increases the yield per plant. Description of the Drawings
[0014] Figure 1 Shown is the cloning of the BnARGOS gene.
[0015] Figure 2 Shown is the CDS sequence and the tertiary structure of the protein of fruit density / fruit sparsity.
[0016] Figure 3 Shown is the schematic diagram of the construction of the fusion vector.
[0017] Figure 4 Shown is the identification of the target fragment in Escherichia coli containing the overexpression vector. (M = Marker 2000; lanes 1-5 are positive clones).
[0018] Figure 5 Shown is the identification of the target fragment in Agrobacterium tumefaciens containing the overexpression vector. (M = Marker 2000; lanes 1-6 are positive clones).
[0019] Figure 6Shown is the identification of the expression level of BnARGOS in transgenic Arabidopsis thaliana. Among them, WT is wild-type Arabidopsis thaliana, Argos is the mutant, M-HU and X-HU are complementary transgenic Arabidopsis thaliana with dense or sparse fruits, and OE-M and OE-X are transgenic Arabidopsis thaliana overexpressing the genes for dense or sparse fruits.
[0020] Figure 7 Shown is the statistics of the flowering period of transgenic Arabidopsis thaliana. Among them, WT is wild-type Arabidopsis thaliana, Argos is the mutant, M-HU and X-HU are complementary transgenic Arabidopsis thaliana with dense or sparse fruits, and M-OE and X-OE are transgenic Arabidopsis thaliana overexpressing the genes for dense or sparse fruits.
[0021] Figure 8 Shown is the statistics of the seed size of transgenic Arabidopsis thaliana. WT is wild-type Arabidopsis thaliana, Argos is the mutant, M-HU and X-HU are complementary transgenic Arabidopsis thaliana with dense or sparse fruits, and M-OE and X-OE are transgenic Arabidopsis thaliana overexpressing the genes for dense or sparse fruits.
[0022] Figure 9 Shown is the statistics of the silique density of transgenic Arabidopsis thaliana. WT is wild-type Arabidopsis thaliana, Argos is the mutant, M-HU and X-HU are complementary transgenic Arabidopsis thaliana with dense or sparse fruits, and M-OE and X-OE are transgenic Arabidopsis thaliana overexpressing the genes for dense or sparse fruits. Specific implementation mode
[0023] The following examples are used to illustrate the present invention, but are not used to limit the scope of the present invention. Unless otherwise specified, the examples are carried out under conventional experimental conditions, such as those described in the Molecular Cloning Experiment Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001), or according to the conditions recommended by the manufacturer's instructions.
[0024] Enzymes and kits: The high-fidelity enzyme for gene cloning (ApexHF HSDNA Polymerase FS Master Mix) and DNA gel extraction kit were purchased from Hunan Akribio Co., Ltd.; restriction endonucleases were all purchased from Thermo Fisher Scientific (China) Co., Ltd.; DNA marker (BM5000 / BM2000) was purchased from Bomed Biotechnology Co., Ltd.; plasmid extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; RNA extraction kit and total RNA reverse transcription kit were purchased from TIANGEN; nucleic acid dye Super GelRedTM was purchased from Suzhou Yuheng Biotechnology Co., Ltd.; other chemicals: agarose was purchased from TransGen Biotech Co., Ltd., peptone, yeast extract, chloroform, isopentyl alcohol, ethanol, isopropanol, sodium chloride, etc. were of domestic analytical grade, and antibiotic powders such as kanamycin, rifampicin, and acetosyringone were purchased from Beijing Solarbio Science & Technology Co., Ltd.
[0025] Preparation of solutions: All reagents mentioned but not listed in this article were prepared according to the methods in the third edition of "Molecular Cloning: A Laboratory Manual", and biochemical reagents were of analytical grade or above.
[0026] LB liquid medium: Tryptone 10 g / L, Yeast extract 5 g / L, NaCl 10 g / L; LB solid medium: Tryptone 10 g / L, Yeast extract 5 g / L, NaCl 10 g / L, agar powder 15 g / L, made up to 1 L; LB selective medium: Before pouring the LB medium into plates, when the medium was autoclaved and cooled to 55 °C, the corresponding concentration of antibiotics was added, shaken well and then poured into plates.
[0027] Main instruments: PCR amplifier (BIO-RAD), high-speed centrifuge (Hettich MIKRO 200R), electrophoresis equipment (BIO-RAD), gel imaging system (BIO-RAD), fluorescence quantitative PCR instrument (ABI7500).
[0028] Example 1 Screening and cloning of BnARGOS gene in rapeseed
[0029] Using the fruit-dense rapeseed breeding material 6M023 and the fruit-sparse rapeseed breeding material 6M029 as parents, two sets of six-generation genetic analysis populations of two parents P1, P2 and reciprocal crosses F1, F2, B1, B2 were constructed respectively, and the major gene + polygene mixed inheritance analysis of the SDMI trait was carried out.
[0030] A DH mapping population was constructed, and simplified genome sequencing and genetic map construction were performed on two parental materials and the DH population. Combining the phenotypic data of the DH population in three environments over two years, it was found that SDMI and the number of siliques on the main inflorescence of rapeseed had overlapping QTLs in all three environments, located at 63 cM - 67.8 cM on chromosome C06.
[0031] Using the identified DH population with segregating SDMI in rapeseed, which contained 103 DH lines, 17 extreme lines were selected from each to construct BSA mixed pools of extreme phenotypes of SDMI for resequencing and QTL-seq analysis. A 0.15 Mb QTL interval was identified by QTL-seq based on resequencing, which overlapped with the previously identified QTL interval on C06.
[0032] All rapeseed genes within the above interval were queried from the public database (http: / / yanglab.hzau.edu.cn / BnIR). Based on the corresponding functional annotations, existing literature related to plant siliques, and QRT-PCR, a gene BnARGOS related to SDMI was screened.
[0033] All experimental materials were planted in the rapeseed experimental base of Southwest University and managed according to general field management. The main inflorescences of rapeseed at different flowering stages were collected, and the collected materials were quickly frozen in liquid nitrogen and stored in a -80 °C refrigerator for later use. Modified CTAB method was used for plant DNA extraction, and a kit from TIANGEN company was used for plant total RNA extraction.
[0034] Total RNA from the main inflorescences of the rapeseed parents with dense siliques 6M023 and sparse siliques 6M029 was separately extracted and reverse-transcribed into cDNA. 200 ng of RNA was reverse-transcribed into cDNA, and the reverse-transcription product cDNA solution was diluted 4 times as the PCR reaction template. Using the total RNA of rice from each tissue extracted as the template, it was reverse-transcribed into cDNA using TaKaRa's reverse-transcription kit, and the reaction system is shown in Table 1.
[0035] Table 1 Reaction system
[0036]
[0037] Note: During the reaction process, it was incubated at 37 °C for 15 min in a PCR instrument first, then at 85 °C for 5 s, and finally stored at -20 °C for later use.
[0038] Primers for BnARGOS were designed using Oligo6 software. The BnARGOS gene of rapeseed was amplified by PCR using the reverse-transcribed cDNA as the template.
[0039] Primer sequences:
[0040] BnARGOS-F: 5′-GCTCTAGAATGATTCGCAAAACCCCA-3′
[0041] BnARGOS-R: 5′-TCCCCCGGGTTACATAAAAGTGCGAGTTA CATCT-3′.
[0042] After the reaction, store at 4°C and detect by 1% agarose gel electrophoresis. If the band size meets the expected design, it is regarded as a valid result ( Figure 1 ). Use a gel extraction kit to cut and extract the target fragment. Ligate the product obtained from the above gel extraction to the T vector and transform Escherichia coli. Culture overnight at 37°C. Pick monoclonal colonies from the resistant LB medium into 600 μL of LB medium containing Kan and culture with shaking at 37°C for 4 h. Verify by colony PCR and send the bacterial solution with the band of the target gene fragment size for sequencing. The sequences are shown in SEQ ID No.1 and 3.
[0043] Using the fruit-dense and fruit-rare parents as templates, perform amplification and sequencing respectively. The results show that the BnARGOS sequence of the fruit-dense parent is consistent with the reference sequence, while there are SNP differences in the sequence of the fruit-rare parent, with four non-synonymous mutations, but the tertiary structure of the protein has not changed ( Figure 2 ).
[0044] Example 2 Construction of the pBin35SRed::BnARGOS Overexpression Vector
[0045] Design Xba I - Sma I as the insertion site according to the map of the final vector pBin35SRed and synthesize primers. The primer sequences are as follows:
[0046] In-BnARGOS-F: 5′-ATTTGGAGAGGACACGAATTCGCTCTAG AATGATTCGCAAAACCCCA-3′ (containing the restriction enzyme site Xba I)
[0047] In-BnARGOS-R: 5′-CCGCCTCGAGCCCGGGTCTAGATCCCCCGGGTTACATAAAAGTGCGAGTTACATCT-3′ (containing the restriction enzyme site Sma I).
[0048] Use high-fidelity enzyme to amplify the CDS containing BnARGOS of the fruit-dense and fruit-rare parents respectively to obtain the target fragment. The schematic diagram of the ligation product to the fusion expression vector is as shown in Figure 3 . Transform the ligation product into Escherichia coli competent cells and randomly pick monoclonal colonies for PCR identification. The primer sequences used are:
[0049] pBin35sRed-F primer: 5'-CGCACAATCCCACTATCCTT-3’
[0050] pBin35sRed-R primer: 5'-AAAAGACAAAAGTGGGGTAG-3'
[0051] The results are as Figure 4 shown.
[0052] Identify the correct monoclonal and verify by sequencing. Transform the verified plasmid into Agrobacterium tumefaciens GV3101 competent cells, pick monoclonal for identification, and the results are as Figure 5 shown.
[0053] Example 3 Homozygosis and phenotypic identification of Arabidopsis mutants
[0054] Purchase the Arabidopsis thaliana ARGOS gene (AT3G59900) mutant Atargos from the domestic Arabidopsis thaliana mutant website https: / / www.arashare.cn / index / . The T-DNA homozygosity identification primers SALK_019707-JD-F / R and SALK_094463-JD-F / R are downloaded and synthesized from the website http: / / signal.salk.edu / tdnaprimers.2.html. After planting Arabidopsis thaliana T-DNA mutants for 4 weeks, extract leaf DNA and perform homozygosity identification by the two-primer method or the three-primer method. Perform qRT-PCR identification using Arabidopsis thaliana seedling leaves and find that the expression level of Atargos is significantly lower than that of the wild type WT (p<0.0001). The results are as Figure 6 shown.
[0055] Example 4 Obtaining transgenic Arabidopsis thaliana
[0056] After waiting for wild-type Arabidopsis thaliana seeds and mutants Atargos (22°C, 16 h light / 8 h dark) to be cultured until they entered the full flowering stage, the floral dip method was used for transformation. The Arabidopsis thaliana was watered appropriately one day before transformation. The positive Agrobacterium liquid was shaken vigorously overnight in a liquid LB medium with double resistance to Kan and Rif. The injection solution concentration was adjusted to OD600 ≈ 0.8 or so through the transformation medium, and it was left standing in the dark for about 4 h. For the transformation of wild-type Arabidopsis thaliana, the floral dip method was used. A little of the transformation medium containing Agrobacterium was aspirated with a pipette tip and dropped onto the inflorescence of Arabidopsis thaliana, and it was cultured in the dark for 24 h. After taking it out after dark culture, it was cultured under normal culture conditions (22°C, 16 h light / 8 h dark). After the fruit pods matured, the T0 generation seeds were harvested together. The seeds that emitted red fluorescence under the irradiation of a green fluorescence excitation lamp were positive plants. After germination, three plant lines were randomly selected for further identification by qRT-PCR. It was found that the expression level of the Arabidopsis thaliana positive plant line BnARGOS was significantly increased. Wait for T3 homozygosity, and further perform qRT-PCR for identification and then count SDMI. The results are as Figure 6 shown. Three overexpression plant lines with expression levels significantly higher than that of WT and three complementary plant lines with expression levels significantly higher than that of Argos were obtained for M-OE and X-OE respectively.
[0057] Primer sequences:
[0058] qRT-BnARGOS-F: GAGGAAGAAACAACCGGAAAAA
[0059] qRT-BnARGOS-R: ACCAGAGATTCCAAACTGAAGT
[0060] At-Actin-F: GCAGACCGTATGAGCAAAG
[0061] At-Actin-R: GGAAGCAAGGATAGAACCAC
[0062] Example 5 Phenotype Statistics of Transgenic Arabidopsis thaliana
[0063] The flowering periods of the WT, Atargos, OE - BnARGOS, and HU - BnARGOS lines were counted: The average flowering time of WT was 43 ± 4 days, the flowering time of Atargos was approximately 42 ± 4 days, the flowering times of M - BnARGOS - OE - 4 and - 5 were 60 ± 4 days and 55 ± 5 days respectively, the flowering times of M - BnARGOS - HU - 2 and - 4 were 54 ± 5 days and 51 ± 5 days respectively, the flowering times of X - BnARGOS - OE - 6 and - 10 were 56 ± 3 days and 54 ± 7 days respectively, and the flowering times of X - BnARGOS - HU - 2 and - 6 were 49 ± 3 days and 52 ± 6 days respectively. The flowering times of the over - expression and complementary lines of BnARGOS were significantly delayed compared to WT (p < 0.0001), indicating that BnARGOS has the function of regulating flowering time, as Figure 7 shown.
[0064] The seed sizes of Arabidopsis over - expression lines, complementary lines, WT, and Atargos were observed under a stereomicroscope, the seed areas were estimated using CellSens Standard software, and the relative seed area (seed area / average WT seed area) was calculated. The results are as Figure 8 shown. The relative seed areas of M - BnARGOS - OE - 4 and - 5 were 1.06 ± 0.14 and 1.21 ± 0.12, the relative seed areas of X - BnARGOS - OE - 6 and 10 were 1.14 ± 0.13 and 1.15 ± 0.15 (p < 0.05, p < 0.0001), the relative seed area of WT was 1 ± 0.14, and the relative seed area of Atargos was 0.96 ± 0.13. Meanwhile, the thousand - seed weights of Arabidopsis were statistically analyzed: The thousand - seed weight of WT was 0.018 ± 0.0013 g, the thousand - seed weight of Atargos was 0.017 ± 0.0017 g, and the thousand - seed weights of M - BnARGOS - OE and X - BnARGOS - OE were 0.021 ± 0.0016 g and 0.020 ± 0.0014 g respectively (p < 0.0001), both significantly higher than those of WT and Atargos. The above results indicate that the seeds of the BnARGOS over - expression lines were significantly enlarged, as Figure 8 shown.
[0065] The main inflorescences of Arabidopsis plants, from the 1st to the 15th siliques at the bottom of the main inflorescence, were measured for length and investigated for the relative SDMI (the ratio of the SDMI of the transgenic line to the SDMI of WT planted in the same batch) trait. The results are as Figure 9As shown. The relative SDMI of M-BnARGOS-OE-4 and -5 were 1.17±0.11 and 1.19±0.12 respectively, the relative SDMI of M-BnARGOS-HU-2 and -14 were 1.17±0.15 and 1.3±0.16 respectively, the relative SDMI of X-BnARGOS-OE-6 and -10 were 1.16±0.17 and 1.15±0.17 respectively, the relative SDMI of X-BnARGOS-HU-2 and 6 were 1.15±0.15 and 1.2±0.15 respectively, the relative SDMI of Atargos was 0.84±0.12, all showed significant differences compared with WT. OE-BnARGOS could complement the phenotype of the mutant Atargos, and overexpression could significantly increase SDMI. The differences in SNPs of the fruit-sparse parents did not affect the silique density, indicating that BnARGOS cloned from rapeseed had the function of increasing silique density, as Figure 9 shown.
[0066] Although the present invention has been described in detail with general descriptions and specific embodiments above, some modifications or improvements can be made based on the present invention, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.
Claims
1. Brassica napus BnARGOS protein, characterized in that, Its amino acid sequence is as shown in SEQ ID No.3 or SEQ ID No.
4.
2. A gene encoding the BnARGOS protein according to claim 1.
3. The gene according to claim 2, wherein The sequence is as shown in SEQ ID No.1 or SEQ ID No.
3.
4. A recombinant expression vector containing the Brassica napus BnARGOS gene according to claim 2 or 3.
5. The recombinant expression vector according to claim 4, characterized in that, The recombinant expression vector is an overexpression vector.
6. Use of the gene according to claim 2 or 3 or the recombinant expression vector according to claim 4 or 5 in affecting plant growth and development and / or increasing the silique density per main inflorescence SDMI of plants.
7. The application according to claim 6, characterized in that, The affecting of plant growth and development includes delaying the flowering time of plants and increasing the seed weight of plants.
8. The application according to claim 6 or 7, characterized in that, Transfer the gene or the expression vector into the plant genome and overexpress the gene.