Method for producing fuel ethanol by using furfural residue enzymolysis liquid glucose
The direct fermentation of furfural slag enzymatic sugar solution for the production of fuel ethanol through Saccharomyces cerevisiae YW-008, solving the problem of insufficient resource utilization of furfural slag, and achieving efficient conversion and environmentally friendly fuel ethanol production.
Patent Information
- Application Number
- CN202510240101.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2025-07-18
AI Technical Summary
In the prior art, the resource utilization of furfural slag is not yet mature and it is difficult to efficiently convert it into fuel ethanol, resulting in waste of resources and environmental pollution.
Saccharomyces cerevisiae YW-008 is used to produce fuel ethanol through primary seed culture and diluted secondary seed culture and fermentation of the diluted furfural residue enzymatic sugar solution, and directly fermentation is used to produce fuel ethanol to avoid detoxification and purification steps.
The efficient conversion of furfural slag enzymatic sugar solution was achieved, the sugar alcohol conversion rate reached more than 90%, and the ethanol concentration in the fermentation liquid was higher than 50g/L, which had industrialization potential and reduced waste pollution.
Smart Images

Figure CN120330071A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biochemistry, and particularly relates to a Saccharomyces cerevisiae and its application in producing fuel ethanol from enzymatically hydrolyzed sugar solution of furfural residue. Background Art
[0002] Fuel ethanol is a renewable energy source obtained from plant raw materials (such as corn, sugarcane, wheat, rice, etc.) through a fermentation process. Currently, it has been widely used as an alternative fuel, synergist, or blending component in the power systems of vehicles such as motor vehicles. Fuel ethanol helps reduce greenhouse gas emissions, reduce dependence on fossil energy, improve air quality, etc., and is therefore regarded as an environmentally friendly energy source. With the increasing demand for fuel ethanol, some agricultural production may shift from food production to energy crop production, which has triggered the issue of conflict between "food and fuel", potentially leading to rising food prices and affecting the food security of the global poor.
[0003] Saccharomyces cerevisiae is a food-grade safe microorganism that can rapidly consume sugars. In an anaerobic environment, it can produce a relatively high concentration of ethanol at an excellent fermentation rate and has good tolerance to high sugar and high ethanol concentrations, making it the preferred strain in industrial ethanol production. Moreover, Saccharomyces cerevisiae has strong tolerance to organic acids such as acetic acid, aldehydes, phenols, etc. produced after the hydrolysis of lignocellulose, and also has great advantages in the application of fermenting ethanol using lignocellulose hydrolysis raw materials such as furfural residue.
[0004] Furfural is an important organic chemical raw material widely used in fields such as chemical industry, pharmaceuticals, plastics, and pesticides. Currently, the global production of furfural is mainly concentrated in the Asia-Pacific region (especially China), Latin America (such as Brazil), and some major agricultural production countries. The production process of furfural mainly involves reacting lignocellulose raw materials (such as agricultural waste) with an acid (such as concentrated sulfuric acid) to produce furfural and then separating and extracting it. In this process, the remaining solid part is the furfural residue.
[0005] The current main utilization methods of furfural residue include: 1) It can be directly converted into heat energy through pyrolysis, incineration, etc. to supply the energy demand in industrial production; 2) Pyrolysis is carried out under high temperature and anaerobic conditions to produce biochar for soil improvement, wastewater treatment, air purification, etc.; 3) Utilizing its characteristics rich in minerals such as lignin, cellulose, nitrogen, phosphorus, and potassium, it can be used as an organic fertilizer after certain processing; 4) A series of valuable chemicals can be obtained by further chemical conversion or microbial fermentation of the lignin, cellulose, etc. contained in furfural. Although there has been some research on the resource utilization of furfural residue at present, the related technologies are still in the development stage. Many efficient and low-cost conversion technologies are not yet mature. Summary of the Invention
[0006] In order to solve the problems mentioned in the above background art, the present invention provides a method for fermentatively producing fuel ethanol that makes full use of the raw material of furfural residue enzymatic hydrolysate and is simple and efficient.
[0007] In order to achieve the above object, the present invention adopts the following technical solutions:
[0008] A Saccharomyces cerevisiae YW-008 is preserved in the "China Center for Type Culture Collection" with the preservation number CCTCC M NO: 2025070 and the preservation date of January 9, 2025.
[0009] A method for producing fuel ethanol using furfural residue enzymatic hydrolysate as a raw material, comprising the following steps:
[0010] S1. Using Saccharomyces cerevisiae YW-008 preserved in a glycerol tube as a seed, performing first-stage seed culture with a complex medium. The main components of the complex medium include: Yeast Extract 10 g / L, Peptone 20 g / L, Glucose 30 g / L;
[0011] S2. Using the first-stage seed as a seed, performing second-stage seed culture with a diluted furfural residue enzymatic hydrolysate as the medium;
[0012] S3. Using the second-stage seed as a seed, performing ethanol fermentation with furfural residue enzymatic hydrolysate as the medium to obtain a fermentation broth containing ethanol;
[0013] S4. Distilling to obtain fuel ethanol.
[0014] The furfural residue enzymatic hydrolysate in the above method is a sugar solution obtained by enzymatic hydrolysis of the residue-type material remaining after furfural production with a complex cellulase. The preferred conditions are: the glucose content is greater than 100 g / L, and the acetic acid content is less than 12 g / L. The more preferred conditions are: the glucose content is greater than 110 g / L, and the acetic acid content is less than 10 g / L.
[0015] In the above method, the dilution factor of the diluted furfural residue enzymatic hydrolysate is preferably 3 - 4 times.
[0016] The above fermentation method has the following parameters: fermentation temperature 30 °C, fermentation pH 5.5, the first-stage seed culture time is 8 - 12 hours, and the inoculation ratio of the first-stage seed to the second-stage seed is 1:25 - 1:50; the second-stage seed culture time is 10 - 14 hours, and the inoculation ratio of the second-stage seed to the fermentation medium is 1:8 - 1:12; the fermentation time is 36 - 60 hours.
[0017] The preferred solutions are as follows: the preferred time for primary seed culture is 9 - 11 hours, the preferred inoculation ratio for inoculating primary seeds into secondary seeds is 1:30 - 1:45; the preferred time for secondary seed culture is 10 - 12 hours; the preferred inoculation ratio for inoculating secondary seeds into the fermentation medium is 1:9 - 1:11; the preferred fermentation time is 36 - 48 hours.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] The strain used has the properties of low nutrient requirements, strong tolerance to inhibitors in furfural residue enzymatic hydrolysate, and high sugar - alcohol conversion rate.
[0020] The whole process requires few auxiliary raw materials, mainly uses the industrial waste raw material furfural residue enzymatic hydrolysate, and the raw material does not need to be detoxified and purified and can be directly fermented.
[0021] Experiments have confirmed that by applying the Saccharomyces cerevisiae and fermentation process of the present invention, the sugar - alcohol conversion rate is high, reaching more than 90% of the theoretical value, and the ethanol concentration in the fermentation broth is higher than 50 g / L, which basically has the potential for actual industrialization. Description of the Drawings
[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0023] Figure 1 It is the growth curve of the strain in the sterilized fermentation medium.
[0024] Figure 2 It is the growth of the strain, glucose consumption, and ethanol production in a 5L fermenter. Detailed Embodiments
[0025] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.
[0026] The culture medium used in the present invention is as follows:
[0027] First-stage seed culture medium (complex medium): yeast extract 10 g / L, peptone 20 g / L, glucose 30 g / L, sterilized at 115°C for 30 minutes.
[0028] Second-stage seed culture medium: furfural residue enzymatic hydrolysate sugar solution diluted 3 - 4 times, supplemented with 10 g / L glucose, pH adjusted to 5.5 with NaOH, sterilized at 115°C for 30 minutes.
[0029] Fermentation medium: furfural residue enzymatic hydrolysate sugar solution, pH adjusted to 5.5 with NaOH in the fermenter.
[0030] Example 1: Screening and identification of yeast strains
[0031] Strain screening. In the early stage of the laboratory, multiple Saccharomyces cerevisiae strains were isolated from sugarcane field soil. These preserved strains were inoculated into the complex medium and cultured for 12 hours, and then transferred to the fermentation medium sterilized at 115°C for 30 minutes. The absorbance value (OD600) at 600 nm of the fermentation broth was measured every 4 hours. The strain with the fastest OD600 growth rate and the highest final OD600 was selected as the strain for subsequent fermentation. In the present invention, this strain is YW-008. The growth curve of this strain in the sterilized fermentation medium is as Figure 1 .
[0032] The internal transcribed spacer (ITS) was amplified using the universal primers ITS1 and ITS4, and the 26s rDNA D1 / D2 region was amplified using the universal primers NL1 and NL4. The amplified DNA fragments were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and identification, and sequence alignment was performed using the NCBI database to confirm that this strain is Saccharomyces cerevisiae.
[0033] The amplified sequences of ITS1 and ITS4 are as follows:
[0034]
[0035] The amplification sequences of NL1 and NL4 are shown as follows:
[0036] TCGGGGGATTGCTTAGTACGGCGAGTGAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTGACCC。
[0037] Example 2: Preparation of glycerol stock seeds
[0038] Pick a well-grown single colony on the complex medium plate and inoculate it into a 100 ml Erlenmeyer flask containing 30 ml of complex medium. Incubate it on a shaker at 30 °C and 200 rpm for 12 hours. Centrifuge the cells at 5000 rpm for 5 minutes to collect the cell pellet, resuspend the cell pellet with an equal volume of strain preservation solution containing 30% glycerol and 0.9% NaCl, and store it frozen at -80 °C as the primary seed for fermentation.
[0039] Example 3: Ethanol fermentation
[0040] After naturally thawing the glycerol tube of strain YW-008, 350 μl of the bacterial suspension was inoculated into a 100 ml Erlenmeyer flask containing 35 ml of the primary seed medium, and cultured on a shaker at 30 °C and 200 rpm for 10 hours. 6.5 ml of the cultured primary seed was transferred to a 1 L Erlenmeyer flask containing 300 mL of the secondary seed medium, and cultured on a shaker at 30 °C and 200 rpm for 12 hours.
[0041] After the empty 5 L fermenter was sterilized, 3 L of the fermentation medium was loaded, and the pH was adjusted to 5.5 with 2 mol / L NaOH. Then, 70 - 100 μl / L of a defoamer composed of polyether and silicone in a 1:1 ratio and 300 mL of the cultured secondary seed were added. The fermentation temperature was 30 °C, the fermentation pH was 5.5, and the stirring speed was 300 rpm. During the fermentation process, the samples taken were centrifuged at 12000 rpm for 1 min, and the supernatant was taken and filtered through a 0.22 μm microporous membrane to remove the precipitate.
[0042] Example 4: Detection of Fermentation Samples
[0043] The concentrations of glucose, ethanol, acetic acid, and glycerol in the fermentation samples were measured using a high-performance liquid chromatography system SPD-M20A equipped with an LC-10AT differential refractive index detector (SHIMADZU, LTD, JAPAN) and an HPX-87H ion exchange column (300×7.8 mm, Bio-Rad, USA). The mobile phase was 5 mmol L-1 H2SO4, the flow rate was 0.6 mL min-1, and the column temperature was 45 °C. The results were as Figure 2 , at the end of fermentation, glucose was basically exhausted, and 60 g / L of ethanol was accumulated.
[0044] Comprehensive Analysis:
[0045] Through the implementation of the technical solution of this project, furfural residue hydrolysate sugar can be directly fermented to produce fuel ethanol without a detoxification process, converting the originally waste materials into liquid fuel, creating economic value while reducing environmental pollution caused by waste.
[0046] The above are only the preferred embodiments of the present invention and do not limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A Saccharomyces cerevisiae YW-008, which is preserved in the "China Center for Type Culture Collection" with the preservation number of CCTCC M NO: 2025070.
2. A method for producing fuel ethanol using furfural residue enzymatic hydrolysate, characterized in that, It includes the following steps: S1. Using the Saccharomyces cerevisiae YW-008 described in claim 1 preserved in a glycerol tube as a seed, and performing primary seed culture with a complex medium. S2. Using the primary seed as a seed, and performing secondary seed culture with a diluted enzymatic hydrolysate of furfural residue as the medium. S3. Using the secondary seed as a seed, and performing ethanol fermentation with the enzymatic hydrolysate of furfural residue as the medium to obtain a fermentation broth containing ethanol. S4. Distilling to obtain fuel ethanol.
3. The method for producing fuel ethanol by using furfural residue enzymatic hydrolysate as claimed in claim 2, wherein The main components of the complex medium in S1 include: 10 g / L of Yeast Extract, 20 g / L of Peptone, and 30 g / L of Glucose. The enzymatic hydrolysate of furfural residue is a sugar solution obtained by enzymatic hydrolysis of the residual slag-type material after furfural production with a complex cellulase.
4. The method for producing fuel ethanol by using furfural residue enzymatic hydrolysate as claimed in claim 2, wherein, The dilution factor of the diluted enzymatic hydrolysate of furfural residue is 3 - 4 times.
5. The method for producing fuel ethanol by using furfural residue enzymatic hydrolysate as claimed in claim 2, characterized in that The fermentation temperature is 30 °C, the fermentation pH is 5.5, the primary seed culture time is 8 - 12 hours, and the inoculation ratio of the primary seed to the secondary seed is 1:25 - 1:50; the secondary seed culture time is 10 - 14 hours, and the inoculation ratio of the secondary seed to the fermentation medium is 1:8 - 1:12; the fermentation time is 36 - 60 hours.
6. The method for producing fuel ethanol by using furfural residue enzymatic hydrolysate according to claim 4, characterized in that, For the sugar solution obtained by enzymatic hydrolysis with a complex cellulase, the conditions are: the glucose content is greater than 100 g / L, and the acetic acid content is less than 12 g / L.
7. A method for producing fuel ethanol using furfural residue enzymatic hydrolysate as claimed in claim 6, characterized in that, For the sugar solution obtained by enzymatic hydrolysis with a complex cellulase, the conditions are: the glucose content is greater than 110 g / L, and the acetic acid content is less than 10 g / L.
8. A method for producing fuel ethanol using furfural residue enzymatic hydrolysate as claimed in claim 5, characterized in that, The primary seed culture time is 9 - 11 hours, and the inoculation ratio of the primary seed to the secondary seed is 1:30 - 1:45; the secondary seed culture time is 10 - 12 hours; the inoculation ratio of the secondary seed to the fermentation medium is 1:9 - 1:11; the fermentation time is 36 - 48 hours.