Plasmid-free genetically engineered bacterium for synthesizing lactoyl-N-fucopentasaccharide I, construction method of plasmid-free genetically engineered bacterium and application of plasmid-free genetically engineered bacterium in anti-EV71 virus
By screening Rhodobacter sp.CACIA14H1's α-1,2-fucosyltransferase Rh2FT and constructing plasmid-free recombinant strain NAH, the problems of low synthesis efficiency and antibiotic use of lactoyl-N-fucosaccharide I were solved, efficient production and anti-EV71 virus activity were achieved, and its application in the food and medicine fields was promoted.
Patent Information
- Application Number
- CN202510477203.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-07-18
AI Technical Summary
In the prior art, the amount of α-1,2-fucosyltransferase is limited and the catalytic activity is insufficient, resulting in low synthesis efficiency of lacticyl-N-fucosaccharide I. The production of plasmid-type strains requires the addition of antibiotics, which poses health risks and limits its application in the food and medicine fields.
The α-1,2-fucosyltransferase Rh2FT derived from Rhodobacter sp.CACIA14H1 was screened out, and a recombinant engineered strain NAH without plasmids and antibiotics was constructed. The genome was optimized through gene knockout and integration to achieve efficient synthesis of lacticyl-N-fucosaccharide I, and the strong promoter overexpression related enzymes were used to improve the synthesis efficiency.
The recombinant strain NAH can efficiently produce lacticyl-N-fucosaccharide I, with a yield of 0.89 g/L, and the product has anti-EV71 virus activity, can inhibit virus infection and replication, and has good clinical application prospects.
Smart Images

Figure CN120330155A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of microbial metabolic engineering and antiviral drugs, and particularly relates to a plasmid-free genetically engineered bacterium for synthesizing lacto-N-fucopentaose I, a construction method thereof, and an application thereof in anti-EV71 virus. Background Art
[0002] So far, breast milk has been widely regarded as the best nutritional source for infants because breast milk contains rich essential components such as immunoglobulins, hormones, and human milk oligosaccharides (HMOs). Lacto-N-fucopentaose I (LNFP I) belongs to fucosylated neutral human milk oligosaccharides and is a pentasaccharide formed by modifying fucose on the basis of LNT. Its concentration in breast milk is 0.8 - 5.0 g / L, with the highest concentration in colostrum and gradually decreasing over time. In addition, LNFP I has been found to have various functional activities, including promoting the establishment of the immune system, the development and repair of the nervous system, reducing inflammation in the body, antibacterial and antiviral, etc. Based on the importance of LNFP I for the growth and development of infants, domestic and foreign policies are gradually promoting the application of LNFP I as a food additive, food nutrient fortifier, etc. in the market. Therefore, it is crucial to achieve high-quality production of LNFP I.
[0003] Currently, LNFP I is mainly obtained through biological extraction, chemical synthesis, enzymatic preparation, and microbial cell factories. Based on the low cost, high efficiency, environmental protection, relatively mature large-scale production technology and process of biosynthesis, and the characteristics of safety and sustainable development, it has become the main source for obtaining LNFP I in recent years. During the construction of the de novo synthesis cell factory for LNFP I, α-1,2-fucosyltransferase is the key rate-limiting enzyme, and its catalytic activity determines the final titer of LNFP I synthesis. However, the number of reported α-1,2-fucosyltransferases available for the biosynthesis of LNFP I is small, and the catalytic activity is limited. Therefore, it is urgent to screen novel α-1,2-fucosyltransferases to increase the available enzymes and highly efficient enzymes in the synthesis process of LNFP I. In addition, the existing technology relies on plasmid-based strains for production, and antibiotics need to be added during the fermentation process to maintain the selective pressure of the recombinant bacteria, and the addition and use of antibiotics pose health and safety risks, which is not conducive to the application of LNFP I in the food and pharmaceutical fields. Therefore, it is urgent to construct new engineering strains to solve the problems existing in the current production of LNFP I. Summary of the Invention
[0004] To solve the problems of the reported α-1,2-fucosyltransferase, including its unsatisfactory yield in microbial fermentation products, low production titer, and the need to add plasmids and antibiotics during the production process, the present invention provides a recombinant bacterium. This recombinant bacterium can efficiently transform lactose to produce LNFPⅠ through a plasmid-free and antibiotic-free synthesis method. The produced LNFPI plays an important role in inhibiting the infection process of EV71 virus (EV71 is Enterovirus 71, the main pathogen of hand, foot, and mouth disease).
[0005] To solve the above technical problems, the technical solution adopted by the present invention is as follows:
[0006] In the first aspect, the present invention screens out an α-1,2-fucosyltransferase (NCBI number: ESW60479.1) from microorganisms, which is derived from Rhodobacter sp. CACIA14H1 and named Rh2FT. The α-1,2-fucosyltransferase Rh2FT can be used to synthesize LNFPⅠ; the amino acid sequence of the α-1,2-fucosyltransferase Rh2FT is shown in SEQ ID NO.1.
[0007] In the second aspect, the present invention also provides a recombinant engineering bacterium NAH containing the encoding gene of the above α-1,2-fucosyltransferase Rh2FT (NCBI number: ESW60479.1). The recombinant strain uses Escherichia coli as the starting strain and knocks out the UDP-glucose lipid carrier transferase encoding gene wcaJ (NCBI accession number: NP_416551.1), β-galactosidase encoding gene lacZ (NCBI accession number: NP_414878.1), UDP-N-acetylglucosamine-2-epimerase encoding gene wecB (NCBI accession number: YP_026253.1), sugar efflux protein encoding gene setA (NCBI accession number: YP_025293.1), glucose dehydrogenase encoding gene gcd (NCBI accession number: NP_414666.1), UDP-glucose-6-dehydrogenase encoding gene ugd (NCBI accession number: NC_000913.3), and glucosamine-6-phosphate deaminase encoding gene nagB (NCBI accession number: HDT3948271.1) in the genome of the starting strain;
[0008] Integrate the coding gene lgtA (nucleotide sequence as SEQ ID NO.2) encoding β-1,3-N-acetylglucosaminyltransferase at the ldhA and hemN sites in the strain genome, integrate the coding gene wbgO (nucleotide sequence as SEQ ID NO.3) encoding β-1,3-galactosyltransferase at the xylB and rph sites, and integrate the coding gene Rh (nucleotide sequence as SEQ ID NO.4) of the α-1,2-fucosyltransferase as described in claim 1 at the yghwx site; integrate the UDP-galactose-4-epimerase gene galE (nucleotide sequence as SEQ ID NO.8) at the yeel site, and integrate the β-galactoside permease gene lacY (nucleotide sequence as SEQ ID NO.5) at the yciQ site;
[0009] Overexpress the coding gene manA (nucleotide sequence as SEQ ID NO.6) of mannose-6-phosphate isomerase and the fucose synthesis gene cluster gmd-wcaG with the strong promoter tac70 on the genome; integrate the expression cassette containing the strong promoter tac70 into the natural promoter regions of the galU, galE, and glmU genes (nucleotide sequences as SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9) to achieve overexpression of the UDP-glucose pyrophosphorylase gene galU, UDP-galactose-4-epimerase galE, and N-acetylglucosamine-1-phosphate uridyltransferase / aminoglucose-1-phosphate acetyltransferase gene glmU; replace the natural promoter of the efflux protein coding gene mdfA (nucleotide sequence as SEQ ID NO.10) in the genome with the strong promoter J23100 from iGEM to achieve enhanced expression of mdfA.
[0010] In a third aspect, the present invention also provides a method for producing LNFPⅠ, using the above recombinant engineered bacterium as a fermentation strain to ferment and produce LNFPⅠ.
[0011] In one embodiment, the method for producing LNFPⅠ specifically includes the following steps:
[0012] 1) Inoculate the recombinant bacterium into a seed medium for culture to obtain a seed liquid;
[0013] 2) Inoculate the seed liquid obtained in step 1) into a fermentation medium (the fermentation medium contains glycerol with a concentration of 20 g / L), culture until the OD 600 reaches 0.6 - 0.8, add 3 g / L of lactose and 0.1 mM of IPTG to the culture system, and ferment to produce LNFPⅠ at 25°C.
[0014] In a fourth aspect, the present invention also provides an application of LNFP I in the preparation of an anti-EV71 virus pharmaceutical preparation.
[0015] In some embodiments, the pharmaceutical preparation comprises LNFP I and pharmaceutically acceptable excipients and carriers, and the LNFP I serves as an EV71 virus inhibitor.
[0016] In some embodiments, the pharmaceutical preparation is any one of a granule, a tablet, a pill, a capsule, an injection or a dispersant.
[0017] The beneficial effects of the invention are as follows:
[0018] 1) The recombinant strain NAH constructed in the present invention can efficiently produce lactyl-N-fucopentaose I, and the yield of lactyl-N-fucopentaose I in shake flask fermentation reaches 0.89 g / L.
[0019] 2) The newly screened α-1,2-fucosyltransferase Rh2FT is introduced into the recombinant strain of the present invention, enriching the number of enzymes capable of realizing the biosynthesis of lactyl-N-fucopentaose I.
[0020] 3) Through a large number of biological experiments, the present invention discovers that lactyl-N-fucopentaose I has anti-EV71 virus activity. Specifically, it can inhibit the cytopathic effect caused by EV71 virus, enhance the survival rate of infected cells, inhibit the replication and proliferation of EV71 virus in cells, and reduce the yield of progeny virus. This indicates that this compound has the potential to prepare specific therapeutic drugs for anti-EV71 infection and has good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 It is a metabolic pathway diagram of lactyl-N-fucopentaose I of the engineered strain NAH.
[0022] Figure 2 It is the HPLC detection result of the fermentation broth of lactyl-N-fucopentaose I of the engineered strain NAH.
[0023] Figure 3 It is the LC-MS detection result of the fermentation broth of lactyl-N-fucopentaose I synthesized by the engineered strain in Example 1; (A) Mass spectrum detection chart of LNPF I standard product, (B) Mass spectrum detection chart of the fermentation broth after the strain XZ-3 is transformed with the plasmid pTrc99a-Rh.
[0024] Figure 4 It is the cytotoxicity of LNFP I, compared with the normal group.
[0025] Figure 5Morphological observation of host RD cells after virus infection and after administration of LNFPI, and inhibitory effect of LNFP I on EV71 expression level.
[0026] Figure 6 LC-MS detection results of the fermentation broth of lactoyl-N-fucopentaose I of engineering strain NAH; (A) Mass spectrometry detection chart of LNPFⅠ standard product; (B) Mass spectrometry detection chart of the fermentation broth after strain XZ-3 was transformed with plasmid pTrc99a-Rh. Detailed implementation manners
[0027] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0028] The compositions of the culture media and the settings of relevant parameters for product detection in each embodiment are as follows:
[0029] Description of the fermentation medium for LNFPⅠ:
[0030] LB liquid medium (seed medium): peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L.
[0031] Glycerol quantitative medium (fermentation medium): 20 g / L glycerol (shake flask fermentation), yeast extract 5 g / L, 13.5 g / L potassium dihydrogen phosphate, 4.0 g / L diammonium hydrogen phosphate, 1.7 g / L citric acid, 1.4 g / L magnesium sulfate heptahydrate, 10 mL of metal ion elements (including 10 g / L ferrous sulfate, 2.25 g / L zinc sulfate heptahydrate, 1.0 g / L anhydrous copper sulfate, 0.35 g / L manganese sulfate monohydrate, 0.23 g / L sodium borate decahydrate, 0.11 g / L ammonium molybdate, 2.0 g / L calcium chloride dihydrate).
[0032] Shake flask fermentation of the strain: Pick a single colony and inoculate it into 4 mL of liquid LB medium, place it in a shaker and culture overnight at 37 °C. Pipette 1 mL of the culture solution and inoculate it into 25 mL of glycerol quantitative medium, and culture it in a shaker at 37 °C until the OD 600 is between 0.6 and 0.8, and then add lactose with a final concentration of 3 g / L as a substrate to generate lactoyl-N-fucopentaose I. Change the culture temperature to 25 °C and continue to culture for 72 h, then take the fermentation broth for HPLC detection of the generation of lactoyl-N-fucopentaose I.
[0033] Parameters for high performance liquid chromatography (HPLC) detection:
[0034] Chromatographic analysis was performed using a Huapu S6000 Plus ultra-high performance liquid chromatograph. Detector: refractive index detector; mobile phase: 100% 0.005N H2SO4; flow rate: 0.6 mL / min; chromatographic column: Rezex TM ROA-Organic Acid H + (8%), 300×7.8 mm, 8 μm; column temperature: 60 °C; injection volume: 10 μL.
[0035] Mass spectrometry detection (LC-MS) parameters:
[0036] Mass spectrometry analysis was performed using a MALDI SYNAPT Q-TOF mass spectrometer (Waters, Milford, MA, USA). Capillary: 3.5 kV; cone, 20 v; source block temperature, 100 °C; desolvation temperature, 400 °C; desolvation gas flow rate: 700 L / h; cone gas flow rate: 50 L / h; collision energy: 6 eV; mass range (m / z): 50 - 1000; detector voltage: 2000 V.
[0037] Mass spectrometry conditions: ionization mode is negative ion mode; scanning mode: SRM; spray voltage: 2500 W; capillary heating temperature is 320 °C, sheath gas flow rate is 45 Arb; auxiliary gas flow rate is 10 Arb; nebulizer temperature is 450 °C; Q1 resolution is 0.7 FWHM; Q3 resolution is 1.2 FWHM; CID collision energy is 2 mTorr.
[0038] Example 1
[0039] Using TeSA (NCBI accession number: BAC08546.1) as a positive control, potential α-1,2-fucosyltransferases were systematically screened, and homologous sequence alignment (BLAST analysis) was performed based on the NCBI database. An α-1,2-fucosyltransferase with potential catalytic activity (NCBI accession number: ESW60479.1) derived from Rhodobacter sp. CACIA14H1 was obtained and named Rh2FT. The amino acid sequence of Rh2FT is shown in SEQ ID NO.1. The sequence of Rh2FT was synthesized by Sangon Biotech after codon optimization. The Rh2FT coding gene was constructed into the Escherichia coli MG1655 expression vector pTrc99a by molecular cloning technology, and the recombinant plasmid pTrc99a-Rh was successfully constructed. The pTrc99a-Rh plasmid was chemically transformed into strain XZ-3 (see Table 2) and fermented for 80 h. After pretreatment of the fermented broth, mass spectrometry analysis was performed to detect the presence of the target product LNFPⅠ. By comparing the mass spectra with the LNFP I standard, it was found that both the fermentation product and the standard showed a characteristic peak at 852.29 m / z, indicating the presence of the target product LNFP I in the fermented broth (as shown in Appendix Figure 3 ). This conclusion first demonstrated the successful construction of the LNFP I synthesis pathway in the chassis strain XZ-3, and further confirmed that the α-1,2-fucosyltransferase Rh2FT can catalyze the specific glycosylation reaction of the substrate LNT and GDP-L-Fucose to generate the target product LNFP I.
[0040] Example 2
[0041] The UDP-glucose lipid carrier transferase coding gene wcaJ (NCBI accession number: NP_416551.1), β-galactosidase coding gene lacZ (NCBI accession number: NP_414878.1), glucosamine-6-phosphate deaminase coding gene nagB (NCBI accession number: HDT3948271.1), UDP-N-acetylglucosamine-2-epimerase coding gene wecB (NCBI accession number: YP_026253.1), UDP-glucose-6-dehydrogenase coding gene ugd (NCBI accession number: NC_000913.3), sugar export protein coding gene setA (NCBI accession number: YP_025293.1), and glucose dehydrogenase coding gene gcd (NCBI accession number: NP_414666.1) in the genome of the starting strain Escherichia coli MG1655 were knocked out. The gene knockout method and some of the primers used are specifically described in the patent with publication number CN 118813573A, and the remaining primers are shown in Table 1.
[0042] Integrate the codon-optimized β-1,3-N-acetylglucosaminyltransferase-encoding gene lgtA at the ldhA and hemN loci of the genome of the starting strain Escherichia coli MG1655; heterologously integrate the gene wbgO encoding β-1,3-galactosyltransferase into the genomic locus xylB of the strain for heterologous expression, and achieve double-copy integration of the β-1,3-galactosyltransferase gene wbgO at the rph locus; integrate the codon-optimized α-1,2-fucosyltransferase-encoding gene Rh at the yghwx locus; integrate the UDP-galactose-4-epimerase gene galE at the yeel locus; to optimize lactose transport efficiency, successfully integrate the β-galactoside permease gene lacY at the yciQ locus. Overexpress the mannose-6-phosphate isomerase-encoding gene manA and the fucose synthesis gene cluster gmd-wcaG on the genome with the strong promoter tac70; similarly, precisely integrate the expression cassette containing the strong promoter tac70 into the natural promoter regions of the galU, galE, and glmU genes to achieve overexpression of the UDP-glucose pyrophosphorylase gene galU, the UDP-galactose-4-epimerase galE, and the N-acetylglucosamine-1-phosphate uridyltransferase / aminoglucose-1-phosphate acetyltransferase gene glmU; similarly, replace the natural promoter of the efflux protein-encoding gene mdfA in the genome with the strong promoter J23100 from iGEM to achieve enhanced expression of mdfA, relieve the survival pressure of the strain, and improve the synthesis efficiency.
[0043] Table 1 Primer sequences for constructing recombinant engineering bacteria
[0044]
[0045]
[0046]
[0047] Example 3
[0048] Perform shake-flask fermentation on the successfully constructed NAH engineering strain. (Specific strain information is shown in Table 2) Shake-flask fermentation method: Pick a single colony and inoculate it into 4 mL of liquid LB medium, place it in a shaker and incubate overnight at 37 °C, pipette 1 mL of the culture solution and inoculate it into 25 mL of glycerol quantitative medium, and shake-culture it in a shaker at 37 °C until OD 600At 0.6 - 0.8, lactose with a final concentration of 3 g / L was then added as a substrate to produce lactyl-N-fucopentaose I. The culture temperature was changed to 25 °C and cultivation continued for 72 h. After fermentation, the fermentation supernatant was filtered through a 0.22 μm filter membrane to remove bacteria, and mass spectrometry (LC-MS) was used to qualitatively analyze the target product LNFPI. The mass spectrometry detection results showed that the target ion peak of [M-H] - 852.29 m / z was detected in the fermentation broth of strain NAH (as Figure 6 shown). By comparing the retention time with the LNFPI standard product, it was confirmed that the target product LNFPI was present in the fermentation broth. High performance liquid chromatography (HPLC) was used to quantitatively analyze the fermentation broth, and the detection results showed that there was a target peak of LNFP I in the fermentation broth. By comparing the peak area detected in the fermentation broth with the peak area of the standard product LNFP I at 1 g / L, the detection results showed that the yield of LNFP I in the fermentation broth was 0.89 g / L (as shown in Figure 2 the appendix).
[0049] Table 2 Information of the engineered strains for plasmid-free synthesis of lactyl-N-fucopentaose I
[0050]
[0051]
[0052]
[0053] Example 4
[0054] 1. Experimental content
[0055] Analysis of the anti-EV71 activity of lactyl-N-fucopentaose I: In this example, the anti-EV71 activity of lactyl-N-fucopentaose I was evaluated by combining the cytopathic effect analysis and the CCK-8 assay for detecting cell viability
[0056] 2. Experimental method
[0057] 2.1 Toxicity of lactyl-N-fucopentaose I to host RD cells
[0058] RD cells were seeded into 96-well plates at a cell density of 5000 cells per well. After the cells in the wells grew to 50 - 60%, the culture medium was discarded, and 2% DMEM medium containing different concentration gradients of LNFP I was added to continue culturing the cells. LNFP I was serially diluted at each concentration (100, 200, 400 μg / mL), with 6 replicate wells set for each gradient, and 2% DMEM without adding LNFP I was set as the control group. After culturing in an incubator for 48 h, 10 μL of CCK-8 solution was gently added and mixed well, taking care to avoid generating bubbles that could cause absorbance errors. After continued culturing for 2 h, the absorbance was measured at 450 nm and the survival rate of cells by LNFP I was calculated.
[0059] Survival rate = (OD value of experimental group / OD value of control group in 1) × 100%
[0060] 2.2 Inhibitory effect of lactosyl-N-fucopentaose I on EV71
[0061] RD cells were seeded in 6-well plates and cultured in a 37 °C, 5% CO2 incubator until confluent as a monolayer, then the cell culture medium was discarded; a blank group, a control group, and an experimental group were set up. Except for the blank group, cells in the remaining two groups were inoculated with EV71 virus at an MOI = 1, and cell maintenance medium containing different concentrations of the test compound was added and continued to be cultured, and visually inspected under a microscope after 24 h.
[0062] Meanwhile, 5000 cells were inoculated into each well of a 96-well plate and then inoculated with EV71 at an MOI = 1. LNFP I was serially diluted two-fold with 2% DMEM medium, and the gradients were set as (100, 200, 400 μg / mL) with six replicate wells. After culturing for 16 h, 10 μL of CCK-8 solution was added, and after continued culturing in an incubator for 2 h, the absorbance was measured at 450 nm, and the virus survival rate of LNFPI was calculated according to the cell survival rate.
[0063] 3. Experimental results
[0064] The test results of the toxicity of lactosyl-N-fucopentaose I to host RD cells are as Figure 4 shown. The results showed that at different LNFPI concentrations, the survival rates of RD cells were different. When treated with LNFPI for 2 h, each concentration of LNFPI (100, 200, 400 μg / mL) had no significant effect on the survival of RD cells (p > 0.05). Therefore, within the concentration range of 100 μg / mL to 400 μg / mL, LNFP I has no toxic effect on RD cells and has no effect on cell proliferation. The test results of the inhibitory effect of lactosyl-N-fucopentaose I on EV71 are as Figure 5 shown. Figure 5Microscopic examination results showed that EV71 infection could cause cytopathic effects, and mature progeny viruses were released after cell lysis. LNFP I could effectively reduce cytopathic effects and maintain cell numbers. Figure 5 The results showed that the LNFP I treatment group could reduce the cytopathic effects caused by EV71 virus infection, and with the increase in the concentration of LNFP I, the reduction effect of cytopathic effects was more obvious.
[0065] Example 5
[0066] 1. Experimental content
[0067] The capsid protein VP1 of EV71 virus is the main neutralization determinant of the virus. It directly determines the antigenicity of the virus and plays an important role in infecting host cells. Therefore, in this experiment, by measuring the expression level of the VP1 gene of the EV71 capsid protein under the action of LNFP I, the inhibitory effect of LNFP I on EV71 was further explored.
[0068] 2. Experimental method
[0069] After counting the cells with good growth, adjust them to 10 6 Plate each well in a 6-well plate, add LNFP I for treatment. After two hours of drug treatment, replace it with the corresponding sugar source medium containing EV71 with MOI = 1 and continue culturing. After 12 h of infection, extract the cell RNA and dilute the RNA concentration to within 0.1 ng - 1 μg. Mix the RNA sample, gDNA Purge, RNase Free water, and cDNA Synthesis SuperMix to reverse transcribe cDNA, and the system is shown in Table 3. Design the primers related to the VP1 capsid protein by searching Primer-bank and using NCBI primer-blast. The specific primer sequences are shown in Table 4. After configuring the relevant system and mixing well, perform amplification on an ABI 7300 OneStep PCR instrument according to the two-step method, and the specific system is shown in Table 5.
[0070] Table 3 cDNA synthesis system
[0071] Reagent Dosage Template RNA 1 μL gDNA Purge 1 μL RNase Free Water 8 μL cDNA Synthesis SuperMix 10 μL
[0072] Table 4 qPCR primer sequences
[0073] Genes Forward primers(5'-3') Reverse primers(5'-3') GAPDH GAAATGAATGGGCAGCCGTT ATCACCCGGAGGAGAAATCG VP1 GGAGATAGGGTGGCAGATG CCAATTTCAGCGGCTTGGAG
[0074] Table 5 qPCR amplification system
[0075] Reagent Dosage SYBR qPCR SuperMix Plus 10 μL Forward primer 1 μL Reverse primer 1 μL cDNA template 2 μL ROX I 0.4 μL RNase Free Water 5.6 μL
[0076] 3. Experimental results
[0077] The experimental results are asFigure 5 As shown. The results showed that LNFP I could effectively inhibit the expression of the VP1 gene of the EV71 capsid virus, and had a highly significant effect compared with the control group. LNFP I had strong inhibitory activity against EV71, could inhibit the cytopathic effect of RD cells caused by EV71 virus, and had the potential to be developed into a drug that could effectively combat EV71 infection clinically.
[0078] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. An α-1,2-fucosyltransferase, characterized in that, The α-1,2-fucosyltransferase is used for synthesizing lacto-N-fucopentaose I, and the amino acid sequence of the α-1,2-fucosyltransferase is as shown in SEQ ID NO.
1.
2. A recombinant engineering bacterium containing the encoding gene of the α-1,2-fucosyltransferase as described in claim 1.
3. A recombinant engineering bacterium, characterized in that, The recombinant strain uses Escherichia coli as the starting strain, and knocks out the encoding gene wcaJ of UDP-glucose lipid carrier transferase, the encoding gene lacZ of β-galactosidase, the encoding gene wecB of UDP-N-acetylglucosamine-2-isomerase, the encoding gene setA of sugar efflux protein, the encoding gene gcd of glucose dehydrogenase, the encoding gene ugd of UDP-glucose-6-dehydrogenase, and the encoding gene nagB of glucosamine-6-phosphate deaminase in the genome of the starting strain; and integrates the encoding gene lgtA of β-1,3-N-acetylglucosaminyltransferase at the ldhA and hemN sites in the strain genome, integrates the encoding gene wbgO of β-1,3-galactosyltransferase at the xylB and rph sites, integrates the encoding gene Rh of the α-1,2-fucosyltransferase as described in claim 1 at the yghwx site; integrates the UDP-galactose-4-epimerase gene galE at the yeel site, and integrates the β-galactoside permease gene lacY at the yciQ site; overexpresses the encoding gene manA of mannose-6-phosphate isomerase and the fucose synthesis gene cluster gmd-wcaG on the genome with the strong promoter tac70; integrates the expression cassette containing the strong promoter tac70 into the natural promoter regions of the galU, galE, and glmU genes to achieve overexpression of the UDP-glucose pyrophosphorylase gene galU, the UDP-galactose-4-epimerase galE, and the N-acetylglucosamine-1-phosphate uridylyltransferase / N-acetylglucosamine-1-phosphate acetyltransferase gene glmU; replaces the natural promoter of the efflux protein encoding gene mdfA in the genome with the strong promoter J23100 from iGEM to achieve enhanced expression of mdfA.
4. The recombinant strain according to claim 3, wherein, The starting strain is Escherichia coli MG1655.
5. A method for producing LNFPⅠ, characterized in that, Using the recombinant bacterium as described in claim 3 as the fermentation strain to ferment and produce LNFPⅠ.
6. The method according to claim 5, wherein Specifically, it includes the following steps: 1) Inoculate the recombinant bacterium into a seed medium for culture to obtain a seed solution; 2) Inoculate the seed solution obtained in step 1) into the fermentation medium and culture until the OD 600 is 0.6 - 0.8, add lactose to the culture system, and ferment at 25°C to produce LNFPⅠ.
7. Use of LNFPⅠ produced by the method as described in claim 5 or 6 in the preparation of an anti-EV71 virus pharmaceutical preparation.
8. The application according to claim 7, wherein The pharmaceutical preparation includes LNFP I and pharmaceutically acceptable excipients and carriers, and LNFP I is used as an EV71 virus inhibitor.
9. The application according to claim 7, wherein The pharmaceutical preparation is any one of granules, tablets, pills, capsules, injections or dispersants.
Citation Information
Patent Citations
Alpha-1, 2-fucosyltransferase for synthesizing LNFP I, recombinant engineering strain as well as construction method and application of alpha-1, 2-fucosyltransferase and recombinant engineering strain
CN118813573A