Application of Alkali Tolerance of Soybean GmNPF7.13 Gene

By cloning and silencing the soybean GmNPF7.13 gene, the problem of insufficient alkaline tolerance of soybean in soda saline-alkali soil was solved, and the soybean's ability to adapt to alkaline stress was enhanced, which has important breeding application potential.

CN120330255BActive Publication Date: 2025-09-19SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510790361.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2025-09-19
Estimated Expiration
2045-06-13

AI Technical Summary

Technical Problem

The existing technology lacks functional genes that can effectively improve the alkali tolerance of soybeans in soda saline-alkali soil. Alkali stress is seriously harmful to plants and related research is insufficient.

Method used

Using the soybean GmNPF7.13 gene, specific primers were designed for PCR amplification and cloning to construct a virus-mediated gene silencing vector VIGS-GmNPF7.13, which was used to silence or knock out the GmNPF7.13 gene and verify its ability to improve alkali tolerance in soybean.

Benefits of technology

Significantly increase the relative water content and chlorophyll content of soybeans, slow down leaf yellowing, enhance the alkali resistance of soybeans, and provide a theoretical basis and breeding application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330255B_ABST
    Figure CN120330255B_ABST
Patent Text Reader

Abstract

The present invention discloses soybean GmNPF7.13 Application of alkali-resistant genes in soybean GmNPF7.13 The nucleotide sequence of the gene is shown in SEQ ID NO.1. GmNPF7.13 Gene silencing vector is a vector that GmNPF7.13 The fragment was inserted into the multiple cloning site of the silencing vector empty VIGS-EV to achieve GmNPF7.13 Gene silencing. The present invention uses two independent verification systems, including two mutants and virus-induced GmNPF7.13 The gene silencing materials all showed enhanced alkali resistance and strong verification consistency. GmNPF7.13 The gene not only helps to analyze the response mechanism of soybean to alkaline stress, but can also be used as a target gene to create alkali-tolerant plants and expand the cultivation of soybeans in soda saline-alkali land. It has important theoretical significance and breeding application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biological agriculture and relates to soybean GmNPF7.13 Alkali-resistant application of genes. Background Art

[0002] Soybean [Glycine max (L.) Merr.] is one of the most important food, oil and high-protein feed crops in the world.

[0003] Alkali stress, primarily caused by sodium bicarbonate (NaHCO₃) and sodium carbonate (Na₂CO₃), poses not only a toxic risk due to high salt ions but also high pH stress, further disrupting the plant's rhizosphere environment, metabolic processes, and cellular homeostasis. Alkali stress severely restricts the normal growth and development of soybeans in soda saline-alkali soils by disrupting ion balance, inhibiting physiological metabolism, and inducing oxidative damage. It is a major obstacle to the sustainable development of the soybean industry. Therefore, it is urgent to identify key alkali-tolerant genes from genetic resources and analyze their mechanisms of action to promote the development of new alkali-tolerant varieties and the utilization of saline-alkali soil resources.

[0004] In the genetic improvement of salt and alkali tolerance, some studies have identified and functionally validated genes involved in salt stress responses. For example, in soybean, genes such as GmSALT3 and GmNHX1 have been reported to regulate sodium ion excretion or vacuolar sequestration, thereby improving salt tolerance. However, compared with salt stress, the high pH stress caused by alkaline stress is more complex and severe for plants, and related research is relatively lagging. In particular, functional genes for improving alkaline tolerance in crops are still relatively scarce.

[0005] The NPF (NRT1 / PTR) family, a multifunctional transmembrane transporter, is widely involved in the transport of substrates such as nitrate, small peptides, and hormones, and plays a regulatory role in plant responses to abiotic stress. Previous studies have reported that OsNPF7.2 regulates nitrogen use efficiency in rice, while AtNPF7.3 mediates nitrate transport across tissues and participates in salt and drought tolerance in Arabidopsis. GmNPF5.29 affects soybean nodule development, while GmNPF7.5 participates in the cotransport of nitrate and chloride. However, to date, there are no reports on the functional research or application of GmNPF7.13 in soybean responses to alkaline stress. Summary of the Invention

[0006] The purpose of the present invention is to provide a soybean alkali resistance related gene to address the deficiencies of the above-mentioned prior art. GmNPF7.13 specific use.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] A soybean alkali-tolerance-related gene GmNPF7.13The nucleotide sequence is shown in SEQ ID NO.1, with a total length of 1791 bases and an initiation codon of ATG. GmNPF7.13 It is a member gene of the NPF family located on soybean chromosome 1.

[0009] The soybean alkali-resistant gene GmNPF7.13 The encoded protein has an amino acid sequence as shown in SEQ ID NO. 2, encoding 596 amino acids.

[0010] GmNPF7.13 The gene silencing vector is preferably inserted into the recombination site of the virus-mediated gene silencing vector VIGS (Virus Induced Gene Silencing) empty vector (VIGS-EV, i.e. pBPMV-IA-V2-R2) by restriction endonuclease BamH Ⅰ and Sal Ⅰ Double enzyme digestion, insert the SEQ ID NO.7 GmNPF7.13 The resulting silencing vector was named VIGS- GmNPF7.13 .

[0011] In order to achieve the specific amplification of the above genes, the present invention also designed a pair of primers suitable for GmNPF7.13 Full-length PCR amplification and cloning: The upstream sequence of the primer pair is shown as F1, and the downstream sequence is shown as R1.

[0012] Upstream primer sequence (F1): 5'- TTCACCTCAATAAACAACCCTT -3' (SEQ ID NO. 3)

[0013] Downstream primer sequence (R1): 5'-GAGGCAGAAACTCGTGTAAGAA -3' (SEQ ID NO. 4)

[0014] This primer pair is suitable for common PCR, cDNA cloning or sequencing and other experimental operations.

[0015] The above soybean alkali-tolerant gene GmNPF7.13 , the use of the above-mentioned protein or the above-mentioned recombinant silencing vector in soybean resistance to alkali stress and the use in cultivating alkali-resistant plants.

[0016] Beneficial effects:

[0017] 1. Clear alkali resistance function: GmNPF7.13 The open reading frame is 1791 bp long and encodes 596 amino acids. Phenotypic analysis of soybean mutants and VIGS silenced materials showed that knockout or silencing GmNPF7.13 It can significantly increase the relative water content and chlorophyll content of soybeans, slow down leaf yellowing, and improve alkali resistance.

[0018] 2. Sufficient evidence: The present invention has been verified by two independent verification systems, including two mutants ( gmnpf7.13-1, gmnpf7.13-2 , one of which is an amino acid missense mutation and the other terminates prematurely in exon 5), as well as viral-induced GmNPF7.13 The gene silencing materials all showed enhanced alkali resistance, and the verification consistency was strong.

[0019] 3. Outstanding potential for breeding applications: The present invention reveals GmNPF7.13 The gene not only helps to analyze the response mechanism of soybean to alkaline stress, but can also be used as a target gene to create alkali-tolerant plants and expand the cultivation of soybeans in soda saline-alkali land. It has important theoretical significance and breeding application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 soybean mutants GmNPF7.13 The mutation position and amino acid changes of the gene are shown. GmNPF7.13 The mutation sites in exon 3 and exon 5 of the gene, and the resulting amino acid substitutions or premature translation termination.

[0021] Figure 2 GmNPF7.13 Gene mutation improves soybean alkali tolerance. a: Soybean phenotypes after normal culture and 18 days of alkali treatment. Scale bar = 10 cm. b: Leaf relative water content (RWC); c: Chlorophyll content (SPAD).

[0022] Figure 3 VIGS- GmNPF7.13 Schematic diagram of the vector. Bam H Ⅰ and Sal Ⅰ is the enzyme cutting site, inserted between the double enzyme cutting sites GmNPF7.13 Silence fragment.

[0023] Figure 4 GmNPF7.13 Obtaining gene silenced soybean plants. a: Gel electrophoresis after PCR amplification GmNPF7.13 The gene silenced lines were verified by fragment analysis. M: DL 2000 bp marker; 1: ddH2O negative control; 2: soybean VIGS empty vector (VIGS-EV) plant (amplified product is a 250 bp vector partial sequence); 3-5: soybean GmNPF7.13 Silence (VIGS- GmNPF7.13 ) plants (amplified product is 572 bp, i.e., 250 bp of vector sequence + silenced target gene GmNPF7.13 fragment 322 bp). b: GmNPF7.13 Relative expression level.

[0024] Figure 5 silence GmNPF7.13 Improving the alkali tolerance of soybean. a. Phenotypes after 8 days of normal culture or alkali treatment. VIGS-EV and VIGS- GmNPF7.13 represent the empty control plants and GmNPF7.13 Silent plants, scale bar = 2.5 cm. b: Relative water content (RWC) of soybean leaves; c: Chlorophyll content (SPAD) of soybean leaves. DETAILED DESCRIPTION

[0025] Example 1 Soybean GmNPF7.13 Gene cloning

[0026] The experimental material is the alkali-resistant soybean variety M8206, provided by the National Soybean Improvement Center of Nanjing Agricultural University. GmNPF7.13 The corresponding gene ID ( Glyma.01G200100 ), design specific primers, and clone GmNPF7.13 The full-length cDNA sequence of the gene was obtained. The specific method was as follows: soybean root tips were pulverized in liquid nitrogen, and RNA was extracted using the Plant RNA Rapid Extraction Kit (Kangwei Century, CW0598S). Two-step reverse transcription was performed using the HiScript® IIQ RT SuperMix for qPCR Reverse Transcription Kit (Vazyme, R223). The resulting cDNA fragment served as a template for PCR amplification using primer pair F1: 5'-TTCACCTCAATAAACAACCCTT -3' (SEQ ID NO. 3), R1: 5'-GAGGCAGAAACTCGTGTAAGAA -3' (SEQ ID NO. 4). A 50 μl PCR reaction mixture was prepared on ice: 2 μl of cDNA, 2 μl each of upstream and downstream primers, and 25 μl of 2× Super Kfx Master Mix. The volume was made up to 50 μl with ultrapure water. All components were mixed thoroughly before PCR amplification. Reaction conditions: 98°C for 3 min; 35 cycles of 98°C for 30 s, 58°C for 30 s, 72°C for 1 min; and 72°C for 5 min. The PCR product was recovered, sequenced, and analyzed. The results showed that the open reading frame of the gene is shown in SEQ ID NO. 1, with a total length of 1791 bp, encoding the 596 amino acids shown in SEQ ID NO. 2.

[0027] Example 2 Soybean mutants gmnpf7.13 Acquisition

[0028] Through the isoybean website created by Professor Song Qingxin's team at Nanjing Agricultural University (https: / / isoybean.org ) to find and obtain EMS soybean mutants. GmNPF7.13 Two mutants NJAU0395 ( gmnpf7.13- 1) and NJAU0217 ( gmnpf7.13- 2), where gmnpf7.13- 1 in the genome GmNPF7.13 There is a point mutation in the gene (C to T), which causes GmNPF7.13 The threonine (Thr) on the third exon mutates to isoleucine (Iie). gmnpf7.13- 2 In the genome ​ There is also a point mutation in the gene (C to T), which causes ​ Premature termination at the fifth exon.

[0029] Example 3 Soybean mutants ​ Improved alkali resistance

[0030] (1) Alkali stress treatment: Soybean sowing and culture conditions were the same as in Example 2. ​ -1 and ​ The -2 mutant and the control Williams 82 were treated when the second trifoliate leaf began to unfold (about 14 days after sowing). The control group was watered normally, while the treatment group was treated with an equal amount of 90 mmol / L NaHCO3:Na2CO3 (9:1), pH = 9.0 aqueous solution for alkaline stress.

[0031] (2) Determination of relative water content (RWC) of leaves: Take leaves from the same part of each plant pot and measure fresh weight (FW). Then soak the leaves in water for 24 hours, absorb the surface water with filter paper, and measure saturated fresh weight (TW). Finally, dry the leaves in an oven at 80℃ for one week and measure dry weight (DW). According to the formula The relative water content of leaves was calculated. The experiment was repeated three times, with 15 seedlings treated in each repeat.

[0032] (3) Leaf chlorophyll (Soil and Plant Analyzer Development, SPAD) content: Using a chlorophyll meter (SPAD-502, Konica Minolta, Japan), the SPAD values ​​of the middle leaf of the top, middle, and bottom trifoliate leaves of each seedling were measured and the average value was taken. The experiment was repeated three times, with 15 seedlings treated in each repeat.

[0033] (4) Result analysis: ​It can be seen that under normal watering conditions, the control Williams 82 and soybean mutant plants ​ -1 and ​ 2 The growth was good and relatively consistent; under alkaline stress, the leaves of all materials turned yellow and the plants became shorter ( ​ (a) Under control culture conditions, there was no significant difference in relative water content and chlorophyll content between the mutant and the control. However, after alkaline stress, the relative water content and chlorophyll content of leaves of all materials decreased significantly. ​ -1 and ​ 2 leaves had significantly higher relative water content and chlorophyll content than the control Williams 82 ( ​ b and c in ). The results show that ​ Gene mutation enhances soybean's alkali tolerance.

[0034] Example 4 Silence ​ Genetically enhancing soybean alkali tolerance

[0035] BPMV-mediated virus-induced gene silencing (VIGS) system was used to ​ The silencing system includes the helper plasmid pBPMV-IA-R1M and the silencing vector pBPMV-IA-V2-R2. According to the prediction results of the SGN VIGS website (https: / / vigs.solgenomics.net / ), the ​ The 322 bp coding region near the 3' end of the gene was used as ​ Gene silencing fragments. Designed using BioEdit – VIGS- ​ The one-step cloning primers F2: 5'-gaatcctctgcatgaggatccCCATTTTGCACATGCAATATAAGC -3' (SEQ ID NO.5), R2: 5'-ctctcgaggcctggagtcgacAAGCATCTTCTGGCAAATCCC -3' (SEQ ID NO.6), were used to clone the soybean variety Meng 8206. ​ The cDNA was used as a template for PCR amplification. The PCR amplification system and procedure were the same as in Example 1. The amplified product was separated by enzyme cutting sites. ​ Ⅰ and ​ Ⅰ was inserted into the vector VIGS-EV (i.e., pBPMV-IA-V2-R2) to construct ​ Gene silencing vector VIGS– ​ ,like ​ After sequencing to verify the correct positive clones, bacterial cultures with the correct bands were selected for culture preservation.

[0036] Extract the recombinant target gene silencing vector VIGS- ​ Plasmid, silencing vector empty VIGS-EV plasmid, and auxiliary plasmid pBPMV-IA-R1M, the plasmid concentration is concentrated at 800-1000 ng / µl to facilitate successful infection. The soybean material Nannong 1138-2 was selected, and after 5 days of germination until the true leaves are fully expanded, it was dark-treated for one day, and then prepared for infection. Take out the soybean plants after dark treatment, drop 20 µl of a 1:1 mixture of the auxiliary plasmid pBPMV-R1M and the silencing vector plasmid of the same concentration on the true leaves, rub and apply silicon carbide powder on the leaves, and then spray water to keep them moist. About two to three weeks after the infection, observe whether the upper leaves are diseased. If the soybean leaves show symptoms of bean pod mottle virus, the infection is considered successful. Collect samples of young leaves of successfully infected diseased plants, perform RNA extraction, PCR amplification and sequencing to verify the target gene, and detect by fluorescent quantitative PCR ​ Gene silencing efficiency; during the period, young leaf samples of diseased plants and leaf samples of empty plants were continuously collected.

[0037] (1) Alkali stress treatment: Williams 82 soybeans were infected about 5 days after germination. Young leaves from diseased plants and leaves from empty carrier plants were collected and placed in a mortar. An appropriate amount of PBS buffer and silicon carbide powder were added and ground into a homogenous slurry. The homogenate was evenly applied to the true leaves using an oil painting brush, slowly applying it from top to bottom along the veins, and repeated 3 times to ensure full infection. The culture conditions were the same as in Example 2. One week after infection, soybean plants showing symptoms of Bean Pod Mottle Virus and empty carriers were grouped into a control group and a treatment group. The treatment group was treated with a 90 mmol / L NaHCO3:Na2CO3 (9:1), pH = 9.0 aqueous solution, and the control group was treated with an equal amount of aqueous solution. After about 8 days of treatment, the phenotypic differences between the treatment and control groups were observed and recorded.

[0038] (2) The relative water content (RWC) and chlorophyll content (SPAD) of leaves were determined in the same manner as in Example 3.

[0039] (3) Result analysis: If soybean leaves show symptoms of pod mottle virus two to three weeks after infection, infection is likely successful. RNA from infected leaves was extracted and reverse transcribed, amplified by PCR, and then analyzed by gel electrophoresis. ​ The gene silenced plant fragments were verified, and the results were as follows ​ As shown in a, VIGS- ​ The plant amplified fragment size was 572 bp (vector fragment sequence 250 bp + silencing fragment 322 bp). ​ The amplified fragments and silenced target genes in plants ​The fragments are completely identical, and their corresponding sequences are shown in SEQ ID NO.7. ​ Fluorescence quantitative detection was performed on the leaves of the gene silenced plants with correct sequencing, and the results showed ​ The gene expression level was only 21.7% of that in the control plants ( ​ b) in the figure indicates that ​ Gene-silenced strains.

[0040] After 8 days of alkaline stress treatment, the growth rate of plants containing empty vector (VIGS-EV) and ​ Silenced plants (VIGS- ​ ) phenotype and conduct relevant physiological index measurements to explore ​ Effect of gene silencing on soybean alkali tolerance. Through observation, it was found that under 90 mmol / L NaHCO3:Na2CO3 (9:1) alkali stress treatment, ​ The phenotype of silenced plants was significantly better than that of the empty-load group: the leaves of empty-load plants were severely yellowed, while ​ The degree of leaf yellowing in silent plants was significantly reduced ( ​ (a) in the figure). Further analysis of physiological indicators showed that under control conditions, ​ The relative water content of leaves of silent plants and empty-loaded plants ( ​ b) and chlorophyll content ( ​ There was no significant difference in the c) content in the samples. However, under alkaline stress conditions, ​ The relative water content and chlorophyll content of the silenced plants were significantly higher than those of the empty control plants, indicating that the silenced plants ​ Enhanced soybean alkali resistance.

Claims

1. Soybeans GmNPF7.13 A gene silencing vector, characterized in that The silencing vector is a vector represented by SEQ ID NO.7 GmNPF7.13 The gene fragment was inserted into the multiple cloning site of the VIGS-EV plasmid.

2. Soybean alkali tolerance related genes GmNPF7.13 The application in improving the alkali resistance of soybean is characterized in that: Soybean alkali tolerance-related genes GmNPF7.13 The nucleotide sequence is shown in SEQ ID NO.1, which inhibits the gene GmNPF7.13 The expression of α-amino acid kinase can improve the alkali tolerance of soybean.

3. The use according to claim 2, characterized in that The applications include creation of soybean alkali-resistant germplasm and soybean stress-resistant breeding.

4. Use of the silencing vector according to claim 1 in improving the alkali resistance of soybean.

5. The use according to claim 4, characterized in that The applications include creation of soybean alkali-resistant germplasm and soybean stress-resistant breeding.

Citation Information

Patent Citations

  • Soybean salt-resistant gene GmCHS5 and application thereof

    CN107056908A

  • Maize transcription factor ZmHB127 and application thereof

    CN118064492A