RPA (recombinase polymerase amplification) primer probe for detecting pseudomonas aeruginosa, nucleic acid composition, application of nucleic acid composition and detection method of pseudomonas aeruginosa

Abstract

The invention provides an RPA (recombinase polymerase amplification) primer probe for detecting pseudomonas aeruginosa, a nucleic acid composition, application of the nucleic acid composition and a detection method of the pseudomonas aeruginosa, and relates to the technical field of biology. The RPA primer probe for detecting the pseudomonas aeruginosa, provided by the invention, is high in specificity, has the sensitivity of 5 * 10 < 1 > Copies / mu L, and can be used for detecting the pseudomonas aeruginosa. The nucleic acid composition for detecting the pseudomonas aeruginosa is used for detecting the pseudomonas aeruginosa, the sensitivity of the nucleic acid composition is 1 * 10 < 1 > Copies / mu L, and compared with an RPA primer probe, the nucleic acid composition has higher detection sensitivity and good application potential.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an RPA primer probe for detecting Pseudomonas aeruginosa, a nucleic acid combination thereof, and applications thereof, as well as a method for detecting Pseudomonas aeruginosa. Background Art

[0002] Pseudomonas aeruginosa (PA), also known as Pseudomonas aeruginosa, is a Gram-negative bacterium of the genus Pseudomonas, which is widely present in soil, water bodies and hospital environments and is a common opportunistic pathogen.

[0003] Research shows that the pollution problem of Pseudomonas aeruginosa in water is seriously harmful. When Pseudomonas aeruginosa contaminates mineral water, it will deteriorate the water quality, causing problems such as peculiar smell and abnormal color, seriously affecting the drinking experience of consumers. More importantly, Pseudomonas aeruginosa poses a greater health risk to people with low immunity, such as infants, the elderly, and those with underlying diseases. Drinking contaminated mineral water may lead to various diseases such as acute enteritis, meningitis, sepsis, and skin inflammation. Therefore, the pollution of Pseudomonas aeruginosa in mineral water not only affects the water quality but also may pose a serious threat to the health of consumers. The detection of Pseudomonas aeruginosa in water samples is very important at the present stage.

[0004] Traditional detection methods include culturing and counting colony-forming units, heterotrophic plate counting, spectrophotometry for measuring optical density, and flow cytometry, etc. Although their operations are very simple, they not only require enrichment but also the entire detection process takes a long time. Currently, commonly used molecular biology techniques such as multiplex polymerase chain reaction (PCR) and real-time PCR, etc., have also been used for the quantification and detection of bacteria. However, these detection methods require very cumbersome instruments with thermal cycling functions and the detection time takes about 3 hours.

[0005] In view of this, the present invention is specifically proposed. Summary of the Invention

[0006] The first object of the present invention is to provide an RPA primer probe for detecting Pseudomonas aeruginosa to solve the above technical problems.

[0007] The second object of the present invention is to provide the application of the above RPA primer probe for detecting Pseudomonas aeruginosa in the preparation of products for detecting Pseudomonas aeruginosa.

[0008] The third object of the present invention is to provide an RPA detection method for Pseudomonas aeruginosa.

[0009] The fourth object of the present invention is to provide a nucleic acid combination for detecting Pseudomonas aeruginosa.

[0010] The fifth object of the present invention is to provide the application of the above nucleic acid combination for detecting Pseudomonas aeruginosa in the preparation of products for detecting Pseudomonas aeruginosa.

[0011] The sixth object of the present invention is to provide an RPA-CRISPR / Cas12b detection method for Pseudomonas aeruginosa.

[0012] In order to achieve the above objects, the following technical solutions are specifically adopted:

[0013] In the first aspect, the present invention provides an RPA primer-probe for detecting Pseudomonas aeruginosa, including an upstream primer, a downstream primer and a probe;

[0014] The nucleic acid sequence of the upstream primer is as shown in SEQ ID NO.2;

[0015] The nucleic acid sequence of the downstream primer is as shown in SEQ ID NO.4;

[0016] The nucleic acid sequence of the probe is as shown in SEQ ID NO.6, wherein the base N in the nucleic acid sequence is replaced by a tetrahydrofuran residue THF.

[0017] As a further technical solution, in the nucleic acid sequence of the probe, a fluorescent group and a quenching group are respectively labeled upstream and downstream of the THF site; the quenching group is used for quenching the fluorescent group.

[0018] In the second aspect, the present invention provides the application of the above RPA primer-probe for detecting Pseudomonas aeruginosa in the preparation of products for detecting Pseudomonas aeruginosa.

[0019] In the third aspect, the present invention provides an RPA detection method for Pseudomonas aeruginosa, including the following steps:

[0020] Using the DNA of the sample to be tested as an amplification template, performing an RPA amplification reaction in an RPA reaction system with the above RPA primer-probe, and then analyzing the product obtained from the RPA amplification reaction.

[0021] As a further technical solution, the temperature of the RPA amplification reaction is 39-42 °C;

[0022] The concentration of the primer in the RPA reaction system is 1.25-10 μmol / L.

[0023] In the fourth aspect, the present invention provides a nucleic acid combination for detecting Pseudomonas aeruginosa, including an upstream primer, a downstream primer, sgRNA and a probe;

[0024] The nucleic acid sequence of the upstream primer is as shown in SEQ ID NO.2;

[0025] The nucleic acid sequence of the downstream primer is shown in SEQ ID NO. 4;

[0026] The nucleic acid sequence of the sgRNA is shown in SEQ ID NO. 8;

[0027] The nucleic acid sequence of the probe is shown in SEQ ID NO. 10.

[0028] As a further technical solution, the 5' end of the probe is labeled with a fluorophore, and the 3' end is labeled with a quencher group or biotin.

[0029] In a fifth aspect, the present invention provides the use of the above nucleic acid combination for detecting Pseudomonas aeruginosa in the preparation of a product for detecting Pseudomonas aeruginosa.

[0030] In a sixth aspect, the present invention provides an RPA-CRISPR / Cas12b detection method for Pseudomonas aeruginosa, comprising the following steps:

[0031] Using the DNA of the sample to be tested as an amplification template, performing an RPA amplification reaction in an RPA reaction system with the upstream primer and the downstream primer, and then using the sgRNA and the probe to perform a target sequence cleavage reaction on the product of the RPA amplification reaction in a CRISPR system, and then analyzing the product after the target sequence cleavage reaction;

[0032] The RPA reaction system contains Cas12b protein.

[0033] As a further technical solution, the temperature of the RPA amplification reaction is 37 - 42 °C, and the time is 10 - 30 min;

[0034] The temperature of the target sequence cleavage reaction is 37 - 42 °C.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] The RPA primer-probe for detecting Pseudomonas aeruginosa provided by the present invention has strong specificity, and the sensitivity is 5x10 1 Copies / μL, and it can be used for the detection of Pseudomonas aeruginosa.

[0037] The nucleic acid combination for detecting Pseudomonas aeruginosa provided by the present invention is used for the detection of Pseudomonas aeruginosa, and its sensitivity is 1x10 1 Copies / μL, which has higher detection sensitivity than the RPA primer-probe and has good application potential. Description of the Drawings

[0038] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0039] Figure 1 It is the lasR gene map;

[0040] Figure 2 It is the RPA amplification electrophoresis map of different RPA primer pairs (from left to right, 1-6 are primer pairs F1-R1, F2-R1, F3-R1, negative control F1-R1, negative control F2-R1, and negative control F3-R1);

[0041] Figure 3 It is the fluorescence intensity of different RPA primer pairs;

[0042] Figure 4 It is the fluorescence intensity of different RPA probes;

[0043] Figure 5 It is the fluorescence intensity of the RPA detection system at different temperatures;

[0044] Figure 6 It is the fluorescence intensity of the RPA detection system at different primer concentrations;

[0045] Figure 7 It is the sensitivity of the RPA detection system;

[0046] Figure 8 It is the sensitivity of the RPA detection system combined with the test strip (from left to right are 1x10 4 Copies / μL, 1x10 3 Copies / μL, 1x10 2 Copies / μL, 1x10 1 Copies / μL and NTC);

[0047] Figure 9 It is the sensitivity of the RPA detection system in water samples;

[0048] Figure 10 It is the sensitivity of the RPA detection system combined with the test strip in water samples (from left to right are 200CFU / reaction, 100CFU / reaction, 50CFU / reaction, 25CFU / reaction, and NTC);

[0049] Figure 11 It is the specificity of the RPA detection system;

[0050] Figure 12 Specificity of the RPA detection system combined with the test strip (from left to right are Salmonella enterica, Shigella flexneri, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella typhimurium, Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas aeruginosa, and ddH2O);

[0051] Figure 13 Fluorescence intensities of different sgRNAs;

[0052] Figure 14 Fluorescence intensities of the RPA-CRISPR / Cas12b detection system at different temperatures;

[0053] Figure 15 Fluorescence intensities at different RPA amplification times;

[0054] Figure 16 Standard line determination of the RPA-CRISPR / Cas12b detection system;

[0055] Figure 17 Sensitivity of the RPA-CRISPR / Cas12b detection system;

[0056] Figure 18 Sensitivity of the RPA-CRISPR / Cas12b detection system combined with the test strip (from left to right are 1x10 4 Copies / μL, 1x10 3 Copies / μL, 1x10 2 Copies / μL, 1x10 1 Copies / μL, and NTC);

[0057] Figure 19 Sensitivity of the RPA-CRISPR / Cas12b detection system in water samples;

[0058] Figure 20 Sensitivity of the RPA-CRISPR / Cas12b detection system combined with the test strip in water samples (from left to right are 200 CFU / reaction, 100 CFU / reaction, 50 CFU / reaction, 25 CFU / reaction, and NTC);

[0059] Figure 21 Specificity of the RPA-CRISPR / Cas12b detection system;

[0060] Figure 22Specificity of the RPA-CRISPR / Cas12b detection system combined with a test strip (from left to right: Salmonella enterica, Shigella flexneri, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella typhimurium, Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas aeruginosa, and ddH2O). Detailed implementation mode

[0061] The following will describe the implementation schemes of the present invention in detail in combination with the implementation modes and examples. However, those skilled in the art will understand that the following implementation modes and examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. Based on the examples in the present invention, all other examples obtained by those of ordinary skill in the art without creative efforts belong to the scope protected by the present invention. Those not specified in specific conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. Those reagents or instruments not specified in the manufacturer are all conventional products that can be obtained through commercial purchase.

[0062] In a first aspect, the present invention provides an RPA primer probe for detecting Pseudomonas aeruginosa, including an upstream primer, a downstream primer, and a probe;

[0063] The nucleic acid sequence of the upstream primer is shown in SEQ ID NO.2:

[0064] GCGGAAAACCGGGCCGAGGCCAACCGTTTC (SEQ ID NO.2);

[0065] The nucleic acid sequence of the downstream primer is shown in SEQ ID NO.4:

[0066] ATAATGGCCGCTACGCGGCGGGAGGTCACA (SEQ ID NO.4);

[0067] The nucleic acid sequence of the probe is shown in SEQ ID NO.6:

[0068] ATCGGTTATCTGCAACTGCTCGGAAGCCAATNTGAACTTCCATATGG (SEQ ID NO.6);

[0069] Among them, the base N in the nucleic acid sequence is replaced with the tetrahydrofuran residue THF.

[0070] The RPA primer probe for detecting Pseudomonas aeruginosa provided by the present invention has strong specificity, and the sensitivity is 5x10 1 Copies / μL and can be used for the detection of Pseudomonas aeruginosa.

[0071] In some alternative embodiments, in the nucleic acid sequence of the probe, a fluorescent group and a quenching group are respectively labeled upstream and downstream of the THF site; the quenching group is used for quenching the fluorescent group.

[0072] In some alternative embodiments, the sequence of the probe is: ATCGGTTATCTGCAACTGCTCGGAAGCCAA[FAM-dT][THF][BHQ1-dT]GAACTTCCATATGG-C3spacer.

[0073] In a second aspect, the present invention provides the use of the above-mentioned RPA primer-probe for detecting Pseudomonas aeruginosa in the preparation of a product for detecting Pseudomonas aeruginosa.

[0074] The RPA primer-probe provided by the present invention has strong specificity and high sensitivity, and can be used for preparing a product for detecting Pseudomonas aeruginosa.

[0075] In a third aspect, the present invention provides an RPA detection method for Pseudomonas aeruginosa, comprising the following steps:

[0076] Using the DNA of the sample to be tested as an amplification template, performing an RPA amplification reaction in an RPA reaction system with the above-mentioned RPA primer-probe, and then analyzing the product obtained from the RPA amplification reaction.

[0077] This detection method is simple and convenient, and has high sensitivity, and can detect Pseudomonas aeruginosa within 30 minutes.

[0078] In some alternative embodiments, the temperature of the RPA amplification reaction is 39 - 42 °C, preferably 42 °C;

[0079] The concentration of the primer in the RPA reaction system is 1.25 - 10 μmol / L, preferably 10 μmol / L.

[0080] In a fourth aspect, the present invention provides a nucleic acid combination for detecting Pseudomonas aeruginosa, comprising an upstream primer, a downstream primer, an sgRNA and a probe;

[0081] The nucleic acid sequence of the upstream primer is as shown in SEQ ID NO.2;

[0082] The nucleic acid sequence of the downstream primer is as shown in SEQ ID NO.4;

[0083] The nucleic acid sequence of the sgRNA is as shown in SEQ ID NO.8:

[0084] GUCUAAAGGACAGAUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCC CGUUGAACUUCAAGCGAAGUGGCACCAGUGGUGCGCCAUCGGCAA(SEQ ID NO.8);

[0085] The nucleic acid sequence of the probe is as shown in SEQ ID NO.10:

[0086] TTTTTTT(SEQ ID NO.10).

[0087] The nucleic acid combination for detecting Pseudomonas aeruginosa provided by the present invention is used for detecting Pseudomonas aeruginosa, and its sensitivity is 1x10 1 Copies / μL, which has higher detection sensitivity than the RPA primer probe and has good application potential.

[0088] In some alternative embodiments, the 5'-end of the probe is labeled with a fluorescent group, and the 3'-end is labeled with a quenching group or biotin.

[0089] In the fifth aspect, the present invention provides an application of the above nucleic acid combination for detecting Pseudomonas aeruginosa in the preparation of a product for detecting Pseudomonas aeruginosa.

[0090] The nucleic acid combination provided by the present invention has strong specificity and high sensitivity, and can be used for preparing a product for detecting Pseudomonas aeruginosa.

[0091] In the sixth aspect, the present invention provides an RPA-CRISPR / Cas12b detection method for Pseudomonas aeruginosa, comprising the following steps:

[0092] Using the DNA of the sample to be tested as an amplification template, performing an RPA amplification reaction in an RPA reaction system with the upstream primer and the downstream primer, then using the sgRNA and the probe to perform a target sequence cleavage reaction on the product of the RPA amplification reaction in a CRISPR system, and then analyzing the product after the target sequence cleavage reaction;

[0093] The RPA reaction system contains Cas12b protein.

[0094] This detection method is simple and convenient, has high sensitivity, and can detect Pseudomonas aeruginosa within 90 minutes.

[0095] In some alternative embodiments, the temperature of the RPA amplification reaction is 37-42°C, preferably 42°C, and the time is 10-30 minutes, preferably 30 minutes;

[0096] The temperature of the target sequence cleavage reaction is 37 - 42 °C, preferably 42 °C.

[0097] The present invention will be further illustrated by specific examples below. However, it should be understood that these examples are only for more detailed illustration and should not be construed as limiting the present invention in any form.

[0098] Example 1

[0099] 1 Materials and Equipment

[0100] 1.1 Strain Sources

[0101] The strains used in the experiment include Salmonella enterica, Shigella flexneri, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella typhimurium, Pseudomonas fluorescens, Pseudomonas putida, and Pseudomonas aeruginosa, as detailed in Table 1.

[0102] Table 1 Strains Used in the Experiment

[0103]

[0104] 1.2 Main Experimental Reagents

[0105] The main reagents for this experiment are shown in Table 2.

[0106] Table 2 Main Experimental Reagents

[0107]

[0108] 1.3 Main Experimental Equipment

[0109] The main instruments for this experiment are shown in Table 3.

[0110] Table 3 Main Experimental Instruments

[0111]

[0112] 1.4 Preparation of Main Media and Reagents

[0113] Tryptic Soy Broth Medium (TSB): Weigh 17 g of tryptone, 5 g of NaCl, 3 g of yeast extract powder, and 2.5 g of glucose using an electronic balance. Then add 1 L of pure water, mix well, and sterilize at high temperature using an autoclave. After cooling, store at room temperature.

[0114] Luria - Bertani Medium (LB): Weigh 10 g of tryptone, 10 g of NaCl, and 5 g of yeast extract powder using an electronic balance. Then add 1 L of pure water, mix well, and sterilize at high temperature using an autoclave. After cooling, store at room temperature.

[0115] Nutrient Agar Medium (NA): Weigh 3 g of beef extract, 10 g of peptone, 5 g of NaCl, and 15 g of agar using an electronic balance. Add them to 1 L of pure water, mix well, and then sterilize at high temperature using an autoclave. After cooling, store at room temperature.

[0116] 1x TAE Buffer: Take 20 ml of 50x TAE buffer, add pure water to make up to 1 L, mix well, and store at room temperature.

[0117] 1% Agarose Gel: Add 0.3 g of agarose to a 100 mL beaker, add 30 mL of 1x TAE buffer, heat using a microwave oven until fully dissolved, then add a nucleic acid stain, mix well, and pour into an agarose gel plate. Wait for it to cool and solidify before use.

[0118] 2 Experimental Methods

[0119] 2.1 Construction of Pseudomonas aeruginosa Standard Plasmid

[0120] Synthesize a puc57-lasR standard plasmid with a length of 720 bp according to the Pseudomonas aeruginosa lasR gene fragment (Gene ID: 881789), and send it to Beijing Tsingke Biotechnology Co., Ltd. for synthesis. The map of the lasR gene fragment is as Figure 1 shown.

[0121] 2.2 Design and Synthesis of RPA Primers

[0122] According to the requirements of primer design, use Primer 5.0 to design RPA primers at the selected sequence positions. A total of 3 upstream primers and 1 downstream primer were designed. The designed primers are shown in Table 4 and were synthesized and purified by Beijing Tsingke Biotechnology Co., Ltd.

[0123] Table 4 RPA Primer Sequences

[0124]

[0125] 2.3 Design and Synthesis of RPA Probes

[0126] Use Oligo and SnapGene software to design and synthesize probes in combination with the designed RPA primers. The designed RPA probes are shown in Table 5 and were synthesized and purified by Beijing Tsingke Biotechnology Co., Ltd.

[0127] Table 5 RPA Probe Sequences

[0128]

[0129] Note: In the sequence list, THF modification is represented by N.

[0130] 2.4 Screening of RPA Primers

[0131] Dilute the upstream and downstream primers to 10 μM respectively, and use the SynSor DNA / RNA Constant Temperature Rapid Amplification Kit (XS-R-101) of Beijing Xunshi Technology Co., Ltd. to amplify the target fragment. The specific operation steps are as follows:

[0132] 1. Add 25 μL of amplification buffer A to each lyophilized bead reaction tube.

[0133] 2. Add 2 μL of upstream primer and 2 μL of downstream primer to each reaction tube respectively.

[0134] 3. Add 2 μL of nucleic acid template to the reaction tube.

[0135] 4. Add 17 μL of ddH2O to the reaction tube.

[0136] 5. Finally, add 2.0 μL of magnesium acetate to the inner side of the reaction tube lid and invert it 8 - 10 times to mix well.

[0137] 6. After mixing, centrifuge (or quickly centrifuge) the reaction solution to the bottom of the tube, and immediately place the reaction tube in a metal bath for incubation at 42 °C for 30 min.

[0138] 7. After the reaction, take 5 μL of the supernatant and add 1 μL of 6xloading buffer loading buffer for agarose gel electrophoresis detection.

[0139] Screen out 2 pairs of RPA primers with better performance through the electrophoresis map, then select one of the probes according to the experimental method in Section 2.5 for testing, and finally screen out the best-performing set of RPA primer pairs through the combination of electrophoresis and fluorescence intensity for subsequent experiments.

[0140] 2.5 RPA detection method

[0141] Use the DNA Constant Temperature Rapid Amplification Kit (fluorescent type WLE8202KIT) of AmpFuture (Changzhou) Biotechnology Co., Ltd. to amplify and detect the target fragment. The specific operation steps are as follows:

[0142] 1. Add 29.4 μL of A buffer to each dry powder reaction tube;

[0143] 2. Add 2 μL of upstream primer, 2 μL of downstream primer and 0.6 μL of RPA fluorescent probe to each reaction tube respectively;

[0144] 3. Add 5 μL of nucleic acid template and 8.5 μL of ddH2O to the reaction tube in sequence;

[0145] 4. Finally, add 2.5 μL of B buffer to the reaction tube and mix well;

[0146] 5. After mixing, centrifuge the reaction solution to the bottom of the tube (or perform a quick centrifugation), and immediately place the reaction tube in a loop-mediated isothermal amplification instrument for incubation at 42 °C for 20 min. Read the fluorescence every 1 min.

[0147] 2.6 Screening of RPA probes

[0148] Detect according to the combination of the two designed RPA probes with the previously screened optimal RPA primers respectively. Control variables such as the experimental temperature and the concentrations of primers and probes. Follow the experimental method in Section 2.5. Judge the performance of the two probes according to the fluorescence intensity value after the reaction, and screen out the probe with the best performance for subsequent experiments.

[0149] 2.7 Optimization of RPA reaction conditions

[0150] 2.7.1 Optimization of RPA temperature

[0151] The reaction temperature range for RPA amplification is 37 - 42 °C, while the recommended reaction temperature range for the DNA constant-temperature rapid amplification kit (fluorescent type) is 39 - 42 °C. Therefore, select the four temperatures of 39 °C, 40 °C, 41 °C, and 42 °C to explore the optimal reaction temperature for the RPA detection system. Use the screened best RPA amplification primer pair and the best probe, prepare and detect according to the RPA detection system, and at the same time set a negative control with ddH2O as the template. After the reaction, select the reaction temperature that is most suitable for the two reaction systems according to the fluorescence intensity value for subsequent experiments.

[0152] 2.7.2 Optimization of RPA primer concentration

[0153] The concentration of RPA primers may affect the product content and efficiency of RPA amplification, thus affecting the performance and sensitivity of the entire RPA detection. Therefore, the concentration of RPA primers is also one of the factors that need to be considered. The initial concentration of the synthesized RPA primers is 10 μM. Dilute the selected best RPA primer pair two-fold to make the concentration reach 5 μM, 2.5 μM, and 1.25 μM. At the same time, set a negative control with ddH2O as the template, prepare according to the detection system in Section 2.5, and select the primer concentration that is most suitable for the reaction system according to the fluorescence intensity value after the reaction for subsequent experiments.

[0154] 2.8 Design and synthesis of primers and probes for RPA combined with strip detection

[0155] The sequences of the primers and probes designed for RPA combined with strip detection are shown in Table 6, and they are synthesized and purified by Beijing Tsingke Biotechnology Co., Ltd.

[0156] Table 6 Sequences of primers and probes for RPA combined with strip detection

[0157]

[0158] 2.9 RPA Binding Test Strip Detection Method

[0159] Use the DNA isothermal rapid amplification kit (test strip type WLE8202KIT) of Amp Future (Changzhou) Biotechnology Co., Ltd. in combination with the nucleic acid detection test strip (WLFS8204) for detection. The specific operation steps are as follows:

[0160] 1. Add 29.4 μL of AD buffer to the dry powder reaction tube;

[0161] 2. Add 2 μL (10 μM) of upstream primer, 2 μL (10 μM) of downstream primer and 0.6 μL (10 μM) of probe to each reaction tube respectively;

[0162] 3. Sequentially add 5 μL of nucleic acid template and 8.5 μL of ddH2O to the reaction tube;

[0163] 4. Finally, add 2.5 μL of B buffer to the reaction tube and invert it up and down 8 - 10 times to mix well;

[0164] 5. After mixing, quickly centrifuge the reaction solution or flick it to the bottom of the reaction tube, and immediately place the reaction tube in a constant temperature device for incubation at 42 °C for 20 min;

[0165] 6. After the reaction is completed, take 5 - 10 μL of the nucleic acid amplification product, dilute it 10 - 20 times with sterile ddH2O in a centrifuge tube and mix well. Take 80 μL of the diluted reaction product and drop it into the sample loading hole for the test strip to develop color, and observe the quality control line and the test line within 5 min to interpret the results.

[0166] 2.10 Sensitivity Test

[0167] 2.10.1 DNA - based Sensitivity

[0168] Calculate the copy number of Pseudomonas aeruginosa plasmid, dilute it multiple times and use it as a template to add to the RPA detection system respectively. Configure it according to the detection system in Section 2.5 under the best reaction conditions and put it into the loop - mediated isothermal amplification instrument to read the fluorescence intensity. Then configure it according to the detection system in Section 2.9 and insert the test strip. Judge the DNA - based sensitivity of the RPA detection method through the fluorescence intensity and the test strip results.

[0169] 2.10.2 Bacterium - based Sensitivity

[0170] Cultivate Pseudomonas aeruginosa. Take 100 μL of the second-generation bacterial liquid and perform 10-fold serial dilutions. Take 10 μL of the diluted liquid and evenly spread it on the plate medium. Spread 3 plates for each dilution gradient. According to the cultivation characteristics and conditions of Pseudomonas aeruginosa, cultivate at 37 °C for 48 h. Select appropriate gradient plates for colony counting, calculate the number of viable bacteria in the original second-generation bacterial liquid based on the dilution gradient and the amount of spread bacterial liquid, extract DNA, use Pseudomonas aeruginosa DNA as a template, select the optimal reaction conditions, configure according to the detection system in Section 2.5, put it into a loop-mediated isothermal amplification instrument to read the fluorescence intensity, and then configure according to the detection system in Section 2.9 and insert the test strip. Judge the sensitivity of the RPA detection method based on the bacteria through the fluorescence intensity and the test strip results.

[0171] 2.11 Bacterial strain resuscitation and genomic DNA extraction

[0172] Cultivate the pathogenic bacteria in Section 1.1 according to the cultivation conditions, and use the Tiangen Bacterial Genomic DNA Extraction Kit (DP302) for genomic extraction.

[0173] 2.12 Specificity detection

[0174] Extract the bacterial genomic DNA of the pathogenic bacteria in Section 1.1 according to the method in Section 2.11. Replace the Pseudomonas aeruginosa standard plasmid with the extracted bacterial genomic DNA, configure according to the detection system in Section 2.5 with the optimal reaction conditions, put it into a loop-mediated isothermal amplification instrument to read the fluorescence intensity, and then configure according to the detection system in Section 2.9 and insert the test strip. Judge the specificity of the RPA detection method through the fluorescence intensity and the test strip results.

[0175] 2.13 DNA extraction from water samples

[0176] Adopt the traditional SDS method to extract DNA from water.

[0177] 2.14 Detection of actual samples

[0178] 2.14.1 RPA detection

[0179] Replace the Pseudomonas aeruginosa standard plasmid with the DNA extracted from 20 artificially contaminated water samples, configure according to the detection system in Section 2.5 with the optimal reaction conditions, put it into a loop-mediated isothermal amplification instrument to read the fluorescence intensity, and judge the detection results of RPA for actual samples.

[0180] 2.14.2 Membrane filtration method detection

[0181] According to the national standard "Inspection Methods for Drinking Natural Mineral Water - National Food Safety Standard" (GB 8538-2022), the membrane filtration method is mainly used for the detection of Pseudomonas aeruginosa in water. Twenty samples were detected using the method in the national standard.

[0182] 3 Experimental Results

[0183] 3.1 Screening of RPA Primers for Pseudomonas aeruginosa

[0184] The performance of RPA primers is crucial for both the reaction efficiency and reaction speed of RPA. Different primer sequences were designed for the target gene, and 4 groups of RPA primers were obtained through combination. After amplifying the target gene with the 4 groups of RPA primers respectively, the amplified products were used for gel electrophoresis detection. The results are as Figure 2 shown. There are amplified bands in all four lanes. However, considering factors such as non-specific amplification and the length of the amplified fragment of the RPA primer, the RPA primer pair F1-R1 was excluded first, and the primer pairs F2-R1 and F3-R1 were selected for subsequent experiments.

[0185] Subsequently, the target gene was amplified using these two groups of RPA primers. According to the RPA detection system, probe P1 was selected to detect the RPA products. The experimental temperature was 42°C, and it was placed in an isothermal amplification instrument and reacted for 20 min using the FAM channel. Fluorescence signals were collected every 1 min. The results are as Figure 3 shown. When using the F2-R1 primer pair, the detected fluorescence intensity value was higher and could exceed 70000, and the value of the negative control was low without false positives. Therefore, the F2-R1 group of RPA primers was selected for subsequent experiments.

[0186] 3.2 Screening of Probes for RPA of Pseudomonas aeruginosa

[0187] The optimal RPA primer pair F2-R1 screened in the previous stage was combined with probes P1 and P2 respectively to form 2 different RPA detection systems, and the standard plasmid of Pseudomonas aeruginosa was used as the template for testing. The prepared detection systems were placed in a loop-mediated isothermal amplification instrument and reacted at 42°C for 20 min using the FAM channel. Fluorescence signals were collected every 1 min. Each different probe was repeated three times and the results were analyzed.

[0188] The results are as Figure 4 shown. Fluorescence signals appeared in both probes within 20 min. However, by comparing the results, when using probe P2, its fluorescence intensity value exceeded 70000 and was significantly higher than the fluorescence intensity value of about 50000 when using probe P1. Therefore, the performance of probe P2 is higher than that of probe P1, and finally probe P2 was determined as the best probe and used for subsequent experiments.

[0189] 3.3 Optimization of RPA Reaction Conditions

[0190] 3.3.1 RPA Temperature Optimization

[0191] To study the optimal temperature range for the RPA reaction, four temperature points of 39 °C, 40 °C, 41 °C, and 42 °C were selected for the experiment. At each temperature point, ddH2O was used as a negative control, and the prepared detection system was placed in a loop-mediated isothermal amplification instrument. The reaction was carried out for 20 minutes through the FAM channel, and the fluorescence signal was recorded every minute. At each temperature, the experiment was repeated three times, and then the obtained data were analyzed.

[0192] The results are as Figure 5 shown. During the 20-minute reaction time, as the amplification temperature gradually increased, the fluorescence intensity value of the RPA detection system gradually increased. After reacting for 20 minutes at 42 °C, the fluorescence intensity value exceeded 70000, significantly higher than the fluorescence intensity values at the other three temperatures. This may be because the RPA amplification efficiency at 42 °C is better than that at other temperatures, so the most obvious fluorescence signal is presented. Therefore, 42 °C was selected as the optimal reaction temperature for the RPA detection system.

[0193] 3.3.2 RPA Primer Concentration Optimization

[0194] The initial concentration of the RPA primer was 10 μmol / L. The change in primer concentration would affect the amplification efficiency and the amount of amplification products of RPA. The selected optimal upstream and downstream RPA primers were respectively diluted multiple times by a factor of two, successively diluted to concentrations of 5 μmol / L, 2.5 μmol / L, and 1.25 μmol / L. ddH2O was used as a negative control. The detection system of RPA was configured with each primer at different concentrations and placed in a loop-mediated isothermal amplification instrument. The reaction was carried out for 20 minutes through the FAM channel, and the fluorescence signal was recorded every minute. At each primer concentration, the experiment was repeated three times, and then the obtained data were analyzed.

[0195] The results are as Figure 6 shown. During the 20-minute reaction time, as the RPA primer concentration increased, the fluorescence intensity value of the detection system also increased, and the fluorescence intensity value reached the highest point close to 80000 when the RPA primer concentration was 10 μmol / L, slightly higher than the two groups of 2.5 μmol / L and 5 μmol / L. Considering reasons such as time cost, the RPA primer concentration of 10 μmol / L was selected for subsequent experiments.

[0196] 3.4 RPA Sensitivity Test

[0197] 3.4.1 DNA-Based Sensitivity

[0198] To verify the sensitivity of the RPA detection system, the plasmid of Pseudomonas aeruginosa was serially diluted to 1x10 4 Copies / μL, 1x10 3 Copies / μL, 1x10 2 Copies / μL, 5x10 1 Copies / μL and 1x10 1 Copies / μL. At these 5 concentrations, ddH2O was used as a negative control for detection. The RPA detection system was configured separately and placed in a loop-mediated isothermal amplification instrument. A 20-minute reaction was carried out through the FAM channel, and the fluorescence signal was recorded every minute. At each DNA concentration, the experiment was repeated three times, and then the obtained data were analyzed.

[0199] The results were as Figure 7 shown. There were no obvious specific amplification curves for the template at a concentration of 10 1 Copies / μL and the negative control. For templates at other concentrations, significant increases in the fluorescence amplification curves could be clearly seen, and the time when the fluorescence signal appeared was correspondingly delayed as the template concentration decreased. After repeated experiments, it was found that the detection results were almost the same. Therefore, it was proved that the detection limit of the RPA detection system based on DNA was 5x10 1 Copies / μL. When the RPA detection system was combined with a test strip to visualize the detection results, the results were as Figure 8 shown. It could be seen that there was still an obvious band at the T line at 1x10 2 Copies / μL, but there was no band at the T line at a concentration of 1x10 1 Copies / μL, and there was an obvious band at the C line. The determination result was negative. Therefore, the detection limit of the RPA detection system combined with the test strip was 1x10 2 Copies / μL.

[0200] 3.4.2 Sensitivity based on bacteria

[0201] Pseudomonas aeruginosa was cultured and the bacterial genomic DNA was extracted as a template. ddH2O was used as a negative control for detection. The RPA detection system was configured separately and placed in a loop-mediated isothermal amplification instrument. A 20-minute reaction was carried out through the FAM channel, and the fluorescence signal was recorded every minute. At each bacterial concentration, the experiment was repeated three times, and then the obtained data were analyzed.

[0202] The results were as Figure 9As shown, there was an obvious fluorescence intensity value when the viable cell count was 100 CFU, but there was no obvious fluorescence intensity value when the viable cell count was 50 CFU. Therefore, the detection limit of the RPA detection system based on Pseudomonas aeruginosa cells was 100 CFU / reaction. After combining the RPA detection system with the test strip and detecting again, the results were as Figure 10 shown. There were obvious bands at the T line and C line on the first two test strips. However, when the viable cell count decreased to 50 CFU, there was no band at the T line of the test strip, but there was still a band at the C line. Therefore, it was proved that the detection limit after combining the RPA detection system with the test strip could reach 100 CFU / reaction.

[0203] 3.5 Specificity detection of RPA

[0204] Using Pseudomonas aeruginosa as the positive control, Salmonella enterica, Shigella flexneri, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella typhimurium, Pseudomonas fluorescens, and Pseudomonas putida were used to detect the specificity of the RPA detection system. Genomic DNA of 9 kinds of bacteria was extracted as templates respectively, and ddH2O was used as the negative control for detection. The RPA detection systems were configured respectively and placed in the loop-mediated isothermal amplification instrument, and reacted through the FAM channel for 20 minutes, and the fluorescence signals were recorded every minute. Under each pathogenic bacterium, the experiment was repeated three times, and then the obtained data were analyzed.

[0205] The results were as Figure 11 shown. There was obvious fluorescence intensity using genomic DNA of Pseudomonas aeruginosa as the template, while the fluorescence intensities using genomic DNA of the other 8 kinds of bacteria as templates were almost no different from that of the negative control. Therefore, it was indicated that the RPA detection method had good specificity. When the RPA detection system was combined with the test strip, the results were as Figure 12 shown. It could be clearly seen that there was an obvious band at the T line and also a band at the C line of the test strip using genomic DNA of Pseudomonas aeruginosa as the template, while there was no band at the T line and there was a band at the C line for the results of other test strips. Therefore, it was proved that the RPA detection method combined with the test strip also had good specificity for Pseudomonas aeruginosa.

[0206] 3.6 Detection of actual samples

[0207] In order to compare the RPA detection system established in this study with the traditional detection method in the national standard, 20 water samples were collected in this study, artificially contaminated to different degrees, and DNA was extracted from each water sample respectively. Then, the 20 water samples were detected using the two methods respectively.

[0208] The detection results are shown in Table 7, where "+" represents a positive detection result and "-" represents a negative detection result. Among the 20 actual samples, the RPA detection method detected 13 positive samples and 7 negative samples, while the traditional membrane filtration method in the national standard detected 15 positive samples and 5 negative samples simultaneously, with a positive rate of 75%. Therefore, there is still a gap between the detection results of RPA for actual samples and the traditional detection method in the national standard, and the detection rate cannot reach 100%.

[0209] Table 7 Detection Results of RPA Detection Method in Actual Samples

[0210]

[0211] Example 2

[0212] 1 Materials and Equipment

[0213] 1.1 Strain Source

[0214] The main strains used and their sources are the same as those in Section 1.1 of Example 1.

[0215] 1.2 Main Experimental Reagents

[0216] The main reagents for this experiment are shown in Table 8, and other reagents are the same as those in Section 1.2 of Example 1.

[0217] Table 8 Main Experimental Reagents

[0218]

[0219] 1.3 Main Experimental Equipment

[0220] The electrothermal constant temperature water bath used in this experiment is from Shanghai Zhulan Instrument Technology Co., Ltd., and other experimental equipment is the same as that in Section 1.3 of Example 1.

[0221] 2 Experimental Methods

[0222] 2.1 Construction of Pseudomonas aeruginosa Standard Plasmid

[0223] The constructed and synthesized Pseudomonas aeruginosa standard plasmid is the same as that in Section 2.1 of Example 1.

[0224] 2.2 Design and Synthesis of sgRNA

[0225] Three sgRNAs were designed as required and are shown in Table 9, and were synthesized by Beijing Xunshi Technology Co., Ltd.

[0226] Table 9 sgRNA Sequences

[0227]

[0228] 2.3 Design and Synthesis of ssDNA and Biotin Probes

[0229] The sequences of the synthesized ssDNA fluorescent probe and biotin probe are shown in Table 10, and they were all synthesized by Beijing Xunshi Technology Co., Ltd.

[0230] Table 10 Sequences of ssDNA and biotin probes used in the experiment

[0231]

[0232] 2.4 One-tube two-step method for RPA amplification and CRISPR detection system

[0233] Use the SynSor DNA / RNA isothermal rapid amplification kit (XS-R-101) of Beijing Xunshi Technology Co., Ltd. and CRISPR / Cas12b protein for target fragment amplification and detection. The specific operation steps are as follows:

[0234] 1. Thoroughly mix the isothermal amplification lyophilized beads with 25 μL of amplification buffer A;

[0235] 2. Take 12 μL of the liquid after dissolving the lyophilized beads and place it on the lid of the eight-strip tube, and add 1.6 μL of nucleic acid template;

[0236] 3. Add 2 μL (10 μM) of the upstream primer and 2 μL (10 μM) of the downstream primer to the eight-strip tube respectively;

[0237] 4. Add 1.0 μL (350 mM) of magnesium acetate to the reaction tube and then cover the tube lid;

[0238] 5. Prepare a 10 μL CRISPR system according to the instruction manual of the Xunshi AaCas12b protein, which contains 1 μL of AaCas12b, 2.5 μL of 10x AaCas12b Buffer, 1 μL (100 ng / μL) of sgRNA and 0.5 μL (100 μM) of ssDNA, and the rest is made up to 10 μL with ddH2O. Add the prepared CRISPR system on the lid of a new eight-strip tube;

[0239] 6. Place the capped eight-strip tube in step 4 on a centrifuge, centrifuge instantaneously to make all components fall to the bottom of the tube, and vortex for 10 s to thoroughly mix;

[0240] 7. Discard the lid of the eight-strip tube in step 6, gently replace it with the lid of the eight-strip tube with the CRISPR system, avoid the CRISPR system falling into the tube, do not centrifuge, and immediately place the reaction tube in a constant temperature device and incubate at 42 °C for 30 min;

[0241] 8. After the RPA process is completed, perform an instantaneous centrifugation to mix the RPA system with the CRISPR system, vortex for 10 s, mix well, place it in a loop-mediated isothermal amplification instrument, incubate at 42 °C for 60 min, and read the fluorescence every 1 min.

[0242] 2.5 sgRNA Screening

[0243] Perform RPA amplification using the pair of primers with the best performance selected. Configure the detection system according to the method in 3.2.4, add different sgRNAs respectively, and screen out the sgRNA with the best performance through the fluorescence intensity value for subsequent experiments.

[0244] 2.6 Optimization of RPA-CRISPR / Cas12b Reaction Conditions

[0245] 2.6.1 Optimization of CRISPR Temperature

[0246] To reduce aerosol contamination and perform the reaction in one tube as much as possible, the reaction temperature is also a primary consideration. The common reaction temperature of Cas12b used in this study is 37 - 55 °C, but considering its combination with RPA, and the general temperature range of RPA is 37 °C - 42 °C. For the temperature ranges of the two reactions, select 6 temperatures: 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, and 42 °C to explore the optimal reaction temperature of CRISPR-Cas12b. Use the selected best RPA amplification primers and the best sgRNA, configure and detect according to the system in 3.2.4, and set a negative control with ddH2O as the template at the same time. After the reaction is completed, select the reaction temperature most suitable for the two reaction systems according to the fluorescence intensity value for subsequent experiments.

[0247] 2.6.2 Optimization of RPA Amplification Time

[0248] The corresponding amplification products can be obtained within 10 - 30 min for RPA amplification. To explore the influence of RPA amplification time on the RPA-CRISPR / Cas12b detection system, in this study, the RPA amplification products of 10 min, 20 min, and 30 min were combined with the CRISPR detection system respectively, and ddH2O was used as the negative control at the same time. After the reaction tubes were placed in the loop-mediated isothermal amplification instrument and the reaction was completed, the optimal amplification time of RPA was determined by the fluorescence intensity.

[0249] 2.7 Combination of RPA-CRISPR / Cas12b Detection System with Test Strip

[0250] Use the SynSor DNA / RNA isothermal rapid amplification kit (XS-R-101) and Synsor CRISPR single-target detection test strip (XS-R-102) of Beijing Xunshi Technology Co., Ltd. The specific operation steps are as follows:

[0251] 1. Thoroughly mix the isothermal amplification freeze-dried beads with 25 μL of amplification buffer A;

[0252] 2. Take 12 μL of the liquid after dissolving the freeze-dried beads and place it on the lid of the 8-strip tube, and add 1.6 μL of nucleic acid template;

[0253] 3. Take a new row of 8-strip tubes and add 2 μL of upstream primer and 2 μL of downstream primer respectively;

[0254] 4. Add 1.0 μL of magnesium acetate to the reaction tube. For multiple reactions, it is recommended to add magnesium acetate to the inner side of the reaction tube in step 3, and slowly cover the lid of the 8-strip tube in step 2 to avoid the liquid in the tube lid from falling. Do not mix for the time being;

[0255] 5. Prepare a 10 μL CRISPR system according to the instruction manual of Xunshi AaCas12b protein, which contains 1 μL of AaCas12b, 2.5 μL of 10x AaCas12b Buffer, 1 μL of sgRNA and 0.4 μL of biotin probe, and the rest is made up to 10 μL with ddH2O. Add the prepared CRISPR system to the lid of a new 8-strip tube;

[0256] 6. Place the capped 8-strip tube in step 4 on a centrifuge, centrifuge instantaneously to make all components fall to the bottom of the tube, and vortex for 10 s to mix thoroughly;

[0257] 7. Discard the lid of the 8-strip tube in step 6, gently replace it with the lid of the 8-strip tube with the CRISPR system, avoiding the CRISPR system from falling into the tube. Do not centrifuge, and immediately place the reaction tube in a constant temperature device and incubate at 42 °C for 30 min;

[0258] 8. After the RPA process is completed, centrifuge instantaneously to mix the RPA system and the CRISPR system, vortex for 10 s to mix well, and immediately place the reaction tube in a constant temperature device and incubate at 42 °C for 60 min;

[0259] 9. Add ddH2O to the product after the CRISPR reaction to 50 μL and vortex to mix;

[0260] 10. Insert the test strip into the reaction tube and do not exceed the MAX line. Place it at room temperature for 2 - 5 min. After the liquid level exceeds the C line and the T line, perform result analysis.

[0261] 2.8 Sensitivity test

[0262] 2.8.1 DNA-based Sensitivity

[0263] First, a baseline for judging negative and positive needs to be established. The baseline of the detection system is set by conducting experiments with ddH2O as the negative control multiple times. Using the constructed plasmid of Pseudomonas aeruginosa as the template, calculate the DNA copy number, perform 10-fold serial dilutions on it, use the serially diluted samples as DNA templates, select the optimal reaction conditions, configure the detection system for Pseudomonas aeruginosa according to the reaction system in Section 2.4, and put it into the loop-mediated isothermal amplification instrument after the reaction; configure the detection system for Pseudomonas aeruginosa according to the reaction system in Section 2.7, insert the test strip after the reaction, and judge the DNA-based sensitivity of the RPA-CRISPR / Cas12b detection system based on whether the fluorescence intensity exceeds the set standard line and the test strip results.

[0264] 2.8.2 Bacterium-based Sensitivity

[0265] According to the method in Section 2.10.2 of Example 1, culture Pseudomonas aeruginosa and extract the bacterial genomic DNA, select the optimal reaction conditions, configure the detection system for Pseudomonas aeruginosa according to the reaction system in Section 2.4, and put it into the loop-mediated isothermal amplification instrument after the reaction; configure the detection system for Pseudomonas aeruginosa according to the reaction system in Section 2.7, insert the test strip after the reaction, and judge the bacterium-based sensitivity of the RPA-CRISPR / Cas12b detection system based on whether the fluorescence intensity exceeds the set standard line and the test strip results.

[0266] 2.9 Bacterial Strain Recovery and Genomic DNA Extraction

[0267] The method is the same as that in Section 2.11 of Example 1.

[0268] 2.10 Specificity Detection

[0269] Extract the bacterial genomic DNA of the pathogenic bacteria in Section 1.1, replace the standard plasmid of Pseudomonas aeruginosa with the extracted DNA, select the optimal reaction conditions, configure the detection system for Pseudomonas aeruginosa according to the reaction system in Section 2.4, and put it into the loop-mediated isothermal amplification instrument after the reaction; configure the detection system for Pseudomonas aeruginosa according to the reaction system in Section 2.7, insert the test strip after the reaction, and judge the specificity of the RPA-CRISPR / Cas12b detection system based on whether the fluorescence intensity exceeds the set standard line and the test strip results.

[0270] 2.11 DNA Extraction from Water Samples

[0271] The method is the same as that in Section 2.13 of Example 1.

[0272] 2.12 Detection of Actual Samples

[0273] 2.12.1 RPA-CRISPR / Cas12b Detection

[0274] Replace the standard plasmid of Pseudomonas aeruginosa with the DNA extracted from 20 artificially contaminated water samples. Configure it according to the detection system in Section 2.4 under the optimal reaction conditions and put it into the loop-mediated isothermal amplification instrument to read the fluorescence intensity, so as to judge the detection result of RPA-CRISPR / Cas12b for the actual sample.

[0275] 2.12.2 Membrane Filtration Method Detection

[0276] The method is the same as that in Section 2.14.2 of Example 1.

[0277] 3 Experimental Results

[0278] 3.1 Screening of sgRNA for Pseudomonas aeruginosa

[0279] Design and synthesize 3 sgRNAs targeting the lasR gene sequence of Pseudomonas aeruginosa. After amplifying the target gene with the RPA primer pair F2-R1, configure the CRISPR detection system using 3 kinds of sgRNAs respectively, add the same RPA amplification product to control variables, place the configured detection system in the loop-mediated isothermal amplification instrument, carry out a 60-minute reaction through the FAM channel, and record the fluorescence signal every minute. Under each sgRNA, the experiment is repeated three times, and then the obtained data is analyzed.

[0280] The obtained results are as Figure 13 shown. When adding sgRNA553, the fluorescence curve has the fastest increase. The fluorescence intensity value of the detection system can reach 670000 at 60 min, which is much higher than the fluorescence intensity values of sgRNA553 and sgRNA618. Therefore, sgRNA553 is selected for subsequent experiments.

[0281] 3.2 Optimization of RPA-CRISPR / Cas12b Reaction Conditions

[0282] 3.2.1 Optimization of CRISPR Temperature

[0283] To study the optimal temperature range for the RPA-CRISPR / Cas12b reaction, six temperature points of 37 °C, 38 °C, 39 °C, 40 °C, 41 °C and 42 °C were selected for experiments. At each temperature point, ddH2O was used as a negative control, and the prepared detection system was placed in the loop-mediated isothermal amplification instrument. Carry out a 60-minute reaction through the FAM channel, and record the fluorescence signal every minute. At each temperature, the experiment is repeated three times, and then the obtained data is analyzed.

[0284] The results are as Figure 14As shown in the figure, the growth rate of the fluorescence curve is the highest at 42°C, and the fluorescence intensity value can exceed 400,000 after 60 minutes of reaction, which is significantly higher than the fluorescence intensity values at the other five temperatures. This may be because the activity of the thermophilic Cas12b protein reaches the highest under the condition of 42°C, so the most obvious fluorescence signal is presented. Therefore, 42°C is the optimal reaction temperature for the RPA-CRISPR / Cas12b detection system.

[0285] 3.2.2 Optimization of RPA amplification time

[0286] The RPA amplification time range is usually 10 - 30 minutes, which means that amplification products will appear from about 10 minutes. Therefore, to optimize the RPA amplification time, after amplifying for 10 minutes, 20 minutes, and 30 minutes respectively and combining with the CRISPR / Cas12b detection system, the prepared detection system is placed in a loop-mediated isothermal amplification instrument, and a 60-minute reaction is carried out through the FAM channel, and the fluorescence signal is recorded every minute. At each amplification time, the experiment is repeated three times, and then the obtained data is analyzed.

[0287] The results are as Figure 15 shown. As the amplification time increases, the fluorescence intensity value at 60 minutes also increases. When the amplification time is 30 minutes, the fluorescence intensity value is significantly higher than the other two groups and can approach 500,000. Therefore, the subsequent RPA amplification time is selected as 30 minutes.

[0288] 3.3 Sensitivity test

[0289] 3.3.1 DNA-based sensitivity

[0290] First, the baseline of this detection system needs to be set to judge whether the detection result is positive or negative. Using ddH2O as the template for multiple negative repeated tests, the prepared detection system is placed in a loop-mediated isothermal amplification instrument, and a 60-minute reaction is carried out through the FAM channel, and the fluorescence signal is recorded every minute. Then the obtained data is analyzed.

[0291] The results are as Figure 16 shown. Among the 8 groups of negative controls, the highest fluorescence intensity value at 60 minutes is about 15,000. Combining with Figure 17 the evaluation of the sensitivity of the DNA-based detection system, the value of 20,000 is selected as the baseline of this detection system. That is to say, when the fluorescence intensity value exceeds 20,000, it is judged that the presence of Pseudomonas aeruginosa is detected, and the detection result is judged as positive; on the contrary, when it is lower than 20,000, although there are also fluorescence curves and fluorescence intensity values, it is also considered that this result is caused by the negative control, so the detection result is judged as negative.

[0292] First, the Pseudomonas aeruginosa standard plasmid was diluted tenfold to 1x10¹ Copies / μL. 1x10 4 Copies / μL, 1x10 3 Copies / μL, 1x10 2 Copies / μL, and 1x10 1 Copies / μL of the template were added to each reaction tube respectively, with ddH₂O as the negative control. The genomic DNA was amplified using the RPA amplification system respectively, and the amplification products were detected using the optimized CRISPR detection system respectively. The prepared detection system was placed in a loop-mediated isothermal amplification instrument, and a 60-minute reaction was carried out through the FAM channel, and the fluorescence signal was recorded every minute. At each DNA concentration, the experiment was repeated three times, and then the obtained data were analyzed.

[0293] The results were as Figure 17 shown. When the DNA concentration was 1x10 1 Copies / μL, the fluorescence curve could still be seen after a 60-minute reaction, and the fluorescence intensity value exceeded 20,000, so it could be determined as positive. Therefore, the detection limit of this detection system was 1x10 1 Copies / μL. When the RPA-CRISPR / Cas12b detection system was combined with a test strip, the detection results were as Figure 18 shown. Using ddH₂O as the negative control, a band could still be observed on the T line of the test strip with a DNA concentration of 1x10 2 Copies / μL, and the detection result showed positive. While no band was observed on the T line of the remaining two test strips and an obvious band was observed on the C line, and the detection result was negative. Therefore, the detection limit of the detection system combined with the test strip was 1x10 2 Copies / μL.

[0294] 3.3.2 Sensitivity based on bacteria

[0295] Using the extracted Pseudomonas aeruginosa DNA as the template, after RPA amplification, the optimized CRISPR system was used to detect the amplification products. The prepared detection system was placed in a loop-mediated isothermal amplification instrument, and a 60-minute reaction was carried out through the FAM channel, and the fluorescence signal was recorded every minute. At each bacteria concentration, the experiment was repeated three times, and then the obtained data were analyzed.

[0296] The results were as Figure 19 shown. When the number of bacteria reached 50 CFU, there was still fluorescence intensity and the value was slightly higher than the baseline, and the detection result was determined as positive. Therefore, the detection limit of this detection system based on Pseudomonas aeruginosa bacteria was 50 CFU / reaction. When the detection system was combined with a test strip, the results were asFigure 20 As shown, the test strip's T line corresponding to 200 CFU has an obvious band, and the determination result is positive. For the other test strips, there is no band on the T line and an obvious band on the C line, and the determination result is negative. Therefore, the detection limit of this detection system combined with the test strip is 200 CFU / reaction.

[0297] 3.4 Specificity detection

[0298] Pseudomonas aeruginosa was used as the positive control, non-Pseudomonas aeruginosa (Salmonella enterica, Shigella flexneri, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella typhimurium, Pseudomonas fluorescens, and Pseudomonas putida) was used as the negative control, and ddH2O was used as the template-free control.

[0299] The genomic DNA of the bacteria was extracted as the sample to be tested. After amplification of the genomic DNA according to the RPA-CRISPR / Cas12b detection system, the above amplification products were detected. The prepared detection system was placed in a loop-mediated isothermal amplification instrument, and a 60-minute reaction was carried out through the FAM channel, and the fluorescence signal was recorded every minute. Under each pathogenic bacterium, the experiment was repeated three times, and then the obtained data was analyzed.

[0300] The detection results are as Figure 21 shown. The fluorescence intensity result in the 9th tube containing Pseudomonas aeruginosa was significantly positive and much higher than the fluorescence intensity values of the other 9 groups. The fluorescence intensity values in the other tubes were all lower than the baseline, and the result was judged to be negative. Therefore, it can be said that the specificity of this detection system is good.

[0301] The results of the RPA-CRISPR / Cas12b detection system combined with the test strip are presented as Figure 22 shown. The test strip results showed that only the T line of the test strip for Pseudomonas aeruginosa had an obvious band, and there was no obvious band on the T line of the other test strips and an obvious band on the C line. It can be judged that the detection result of the 9th test strip is positive, while the detection results of the other test strips are negative. Therefore, it is proved that the detection system also has good specificity after being combined with the lateral flow test strip.

[0302] 3.5 Detection of actual samples

[0303] To compare the RPA-CRISPR / Cas12b detection system established in this study with the traditional detection methods in the national standard, 20 water samples in this study were artificially contaminated to different degrees. After DNA extraction from the entire 20 water samples using the SDS method, the two methods were used for detection respectively. The detection results are shown in Table 11. In 20 actual samples, both the RPA-CRISPR / Cas12b detection method and the traditional detection method in the national standard detected 15 positive samples and 5 negative samples at the same time, and the positive rate was 75%, indicating that the RPA-CRISPR / Cas12b detection method established in this study is feasible and the detection rate is consistent with the traditional detection method in the national standard.

[0304] Table 11 Detection results of the RPA-CRISPR / Cas12b detection method in actual samples

[0305]

[0306] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An RPA primer probe for the detection of Pseudomonas aeruginosa, characterized in that, It includes a forward primer, a reverse primer and a probe; The nucleic acid sequence of the forward primer is shown as SEQ ID NO.2; The nucleic acid sequence of the reverse primer is shown as SEQ ID NO.4; The nucleic acid sequence of the probe is shown as SEQ ID NO.6, wherein the base N in the nucleic acid sequence is replaced by a tetrahydrofuran residue THF.

2. The RPA primer probe for Pseudomonas aeruginosa detection according to claim 1, wherein In the nucleic acid sequence of the probe, a fluorophore and a quencher are respectively labeled upstream and downstream of the THF site; the quencher is used for quenching the fluorophore.

3. Use of the RPA primer-probe for detecting Pseudomonas aeruginosa according to claim 1 or 2 in the preparation of a product for detecting Pseudomonas aeruginosa.

4. A recombinase polymerase amplification (RPA) detection method for Pseudomonas aeruginosa, characterized in that, It includes the following steps: Using the DNA of the sample to be tested as an amplification template, performing an RPA amplification reaction in an RPA reaction system with the RPA primer-probe according to claim 1 or 2, and then analyzing the product obtained from the RPA amplification reaction.

5. The RPA detection method for Pseudomonas aeruginosa according to claim 4, wherein The temperature of the RPA amplification reaction is 39 - 42°C; The concentration of the primer in the RPA reaction system is 1.25 - 10 μmol / L.

6. A nucleic acid combination for detecting Pseudomonas aeruginosa, characterized in that, It includes a forward primer, a reverse primer, an sgRNA and a probe; The nucleic acid sequence of the forward primer is shown as SEQ ID NO.2; The nucleic acid sequence of the reverse primer is shown as SEQ ID NO.4; The nucleic acid sequence of the sgRNA is shown as SEQ ID NO.8; The nucleic acid sequence of the probe is shown as SEQ ID NO.

10.

7. The nucleic acid combination for detecting Pseudomonas aeruginosa according to claim 6, wherein The 5'-end of the probe is labeled with a fluorophore, and the 3'-end is labeled with a quencher or biotin.

8. Use of the nucleic acid combination for detecting Pseudomonas aeruginosa according to claim 6 or 7 in the preparation of a product for detecting Pseudomonas aeruginosa.

9. An RPA-CRISPR / Cas12b detection method for Pseudomonas aeruginosa, characterized in that, It includes the following steps: Using the DNA of the sample to be tested as an amplification template, performing an RPA amplification reaction in an RPA reaction system with the forward primer and the reverse primer according to claim 6 or 7, then performing a target sequence cleavage reaction on the product of the RPA amplification reaction in a CRISPR system with the sgRNA and the probe according to claim 6 or 7, and then analyzing the product after the target sequence cleavage reaction; The RPA reaction system contains Cas12b protein.

10. The RPA-CRISPR / Cas12b detection method according to claim 9, wherein The temperature of the RPA amplification reaction is 37 - 42°C and the time is 10 - 30 min; The temperature of the target sequence cleavage reaction is 37 - 42°C.

Images