Double microdroplet digital PCR (Polymerase Chain Reaction) detection primer group for enterocytozoon hepatopenaei and vibrio parahaemolyticus and kit thereof

Abstract

The invention discloses a double microdroplet digital PCR (polymerase chain reaction) detection primer group for enterocytozoon hepatopenaei and vibrio parahaemolyticus and a kit of the double microdroplet digital PCR detection primer group. The sequence of the EHP primer probe set is as shown in SEQ ID NO.1-3, and the sequence of the VPAHPND primer probe set is as shown in SEQ ID NO.6-6. The method has the advantages that absolute quantitative analysis of pathogens can be realized, the sensitivity and repeatability are better, the operation steps are simplified, the result interpretation is more visual and reliable, the two pathogens of EHP and VPAHPND can be simultaneously detected by adopting a two-color fluorescent probe method, and the prawn disease detection efficiency is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogen detection, in particular to the detection of Enterocytozoon hepatopenaei and Vibrio parahaemolyticus. Background Art

[0002] In recent years, a pathogen that is a specialized intracellular parasite has been found in the penaeid shrimp farming industry. It is called Enterocytozoon hepatopenaei (EHP), which belongs to the family Microsporidia and the genus Enterocytozoon. In 2003, the Monodon slow growth syndrome (MSGS) appeared in the Penaeus monodon cultured in Thailand. When exploring the cause, inclusion bodies of baculovirus or hepatopancreatic parvovirus or unconfirmed microsporidia were found in the hepatopancreas cells of penaeid shrimp. It was not until 2009 that it was successfully isolated and defined as a new species of the genus Sporozoan, Enterocytozoon hepatopenaei. Major economically cultured shrimp species such as Litopenaeus vannamei, Palaemon carincauda, and Penaeus monodon are the main infection targets of Enterocytozoon hepatopenaei. After infection, it will cause the growth of shrimp to slow down or stagnate, and it is one of the important pathogens affecting global shrimp farming production.

[0003] Acute hepatopancreatic necrosis disease is a new disease that can cause a large number and very rapid deaths of cultured penaeid shrimp in the early growth stage. Therefore, it is also called Early Mortality Syndrome (EMS) and was included in the list of aquatic animal diseases by the OIE in 2016. This disease usually occurs 7 - 30 days after the stocking of shrimp fry and can be observed within 30 days. It is easy to infect several major cultured penaeid shrimp varieties in the world, including Litopenaeus vannamei, Penaeus monodon, and Penaeus japonicus, among which Litopenaeus vannamei and Penaeus monodon are particularly susceptible. This disease has a wide range of damage and an extremely high mortality rate, often forcing aquaculture farmers to clear the pond or even have no production. Acute hepatopancreatic necrosis disease is caused by a Vibrio parahaemolyticus VPAHPND containing a special plasmid. In recent years, Vibrio harveyi and Vibrio campbellii have also been found to be able to carry pirVP and cause acute hepatopancreatic necrosis disease.

[0004] Nucleic acid amplification technology has been widely used in the detection of pathogens. Several molecular detection methods for the detection of EHP and VPAHPND have been established in previous studies. These methods include polymerase chain reaction (PCR), real-time PCR (qPCR), nested PCR, loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA). However, each of the above methods has some deficiencies. PCR and nested PCR have insufficient sensitivity and agarose gel electrophoresis must be performed, which may cause contamination. LAMP and RPA cannot be used for quantitative analysis. Although qPCR can be used for quantitative analysis, a standard curve is required. At the same time, for samples with a low content of pathogenic bacteria, qPCR quantification is inaccurate.

[0005] Droplet digital PCR (ddPCR) uses a specially designed droplet generation oil to encapsulate the PCR reaction system, forming 10 5 -10 6 water-in-oil reaction droplets containing independent systems. After the amplification reaction, the fluorescence signal is read, and the number of positive droplets and negative droplets in each reaction is measured. With the aid of the Poisson distribution principle, the proportion of positive droplets is approximated, and finally converted into the copy number value of the target to be measured. The PCR system has been dispersed into extremely small independent reactions before the reaction, greatly reducing the interference of other substances and improving the sensitivity of low-abundance targets. Droplet digital PCR (ddPCR) is a new absolute quantitative PCR technology with high sensitivity, high accuracy, and the ability to quantify without a standard curve. It is especially suitable for the detection of samples with a low content of pathogenic bacteria. ddPCR has been widely used in the fields of clinical medicine, environmental monitoring, animal diseases, etc. There is currently no report on the simultaneous detection of EHP and VPAHPND using ddPCR. Summary of the Invention

[0006] The purpose of the present invention is to provide a dual droplet digital PCR detection primer set and its kit for Enterocytozoon hepatopenaei and Vibrio parahaemolyticus, in order to solve the problem in the prior art of lacking technology for samples with a low content of Enterocytozoon hepatopenaei and Vibrio parahaemolyticus.

[0007] To achieve the above purpose, the present invention adopts the following technical solutions:

[0008] A dual droplet digital PCR detection primer set for Enterocytozoon hepatopenaei and Vibrio parahaemolyticus, comprising:

[0009] EHP primer-probe set:

[0010] EHP-F, whose sequence is shown in SEQ ID NO.1;

[0011] EHP-R, whose sequence is shown in SEQ ID NO.2;

[0012] EHP-P, whose sequence is shown in SEQ ID NO.3, has a fluorescent reporter group connected to its 5'-end and a fluorescent quencher group connected to its 3'-end;

[0013] VPAHPND primer-probe set:

[0014] VPAHPND-F, whose sequence is shown in SEQ ID NO.4;

[0015] VPAHPND-R, whose sequence is shown in SEQ ID NO.5;

[0016] VPAHPND-P, whose sequence is shown in SEQ ID NO.6, has a fluorescent reporter group connected to its 5'-end and a fluorescent quencher group connected to its 3'-end;

[0017] The fluorescent reporter groups connected to EHP-P and VPAHPND-P are different.

[0018] Further, FAM is connected to the 5'-end of EHP-P and MGB is connected to the 3'-end;

[0019] VIC is connected to the 5'-end of VPAHPND-P and MGB is connected to the 3'-end.

[0020] The present invention also provides an application of the detection primer set in preparing a kit for detecting Enterocytozoon hepatopenaei and Vibrio parahaemolyticus.

[0021] Further, the kit is a dual-droplet digital PCR detection kit.

[0022] Further, the kit includes a reaction solution containing components required for the reaction, the detection primer set according to claim 1 or 2, a negative control, and a positive control.

[0023] Further, the negative control is sterile ultrapure water, and the positive controls are plasmid DNA standards pUC57-EHP and pUC57-VPAHPND.

[0024] The present invention also provides a dual-droplet digital PCR detection system using the detection primer set, including a reaction solution containing components required for the reaction, the primers and probes according to claim 1 or 2, a sample to be detected, and ultrapure water.

[0025] Further, the system is 20 μL in total, including 2×ddPCR TM Supermix probe (Bio-Rad) 10 μL, each primer is 500 nM, each probe is 250 μM, the sample to be detected is 1 μL, and the balance is ultrapure water.

[0026] The advantages of the present invention are:

[0027] (1) It can achieve absolute quantitative analysis of pathogens. This invention is based on digital PCR technology to prepare 10 5 -10 6 water-in-oil reaction droplets containing independent systems. After the amplification reaction, the fluorescence signal is read, the number of positive droplets and negative droplets in each reaction is measured, and the proportion of positive droplets is approximated with the help of the Poisson distribution principle, and finally converted into the copy number value of the target to be measured.

[0028] (2) It has better sensitivity and repeatability, and is suitable for the detection of samples with low pathogen content. The PCR system has been dispersed into extremely small units for independent reaction before the reaction, greatly reducing the interference of other substances and avoiding the phenomenon of detection result errors that are prone to occur when detecting samples with less target components or complex matrices by other methods.

[0029] (3) It simplifies the operation steps, and the result interpretation is more intuitive and reliable. The detection method mainly relies on digital PCR technology and the two-color fluorescence probe method, without relying on the threshold (CT) of the amplification curve for quantification, and is not affected by the amplification efficiency. With the droplet digital PCR detection system, the number of DNA molecules can be directly counted, simplifying and saving the preparation time and detection time.

[0030] (4) By using the two-color fluorescence probe method, two pathogens, EHP and VPAHPND, can be detected simultaneously, improving the detection efficiency of shrimp diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The drawings described herein are used to provide a further understanding of the present invention, form a part of this application, and do not constitute an improper limitation to the present invention. In the drawings:

[0032] Figure 1 It is a schematic diagram for optimizing the primer and probe concentrations of the ddPCR method. Figure A is for EHP, and Figure B is for VPAHPND. 1-2: 500 nM primer and 250 nM probe; 3-4: 500 nM primer and 300 nM probe; 5-6: 500 nM primer and 200 nM probe; 7-8: 400 nM primer and 200 nM probe.

[0033] Figure 2 It is a schematic diagram for optimizing the annealing temperature of the ddPCR method. Figure A is for EHP, and Figure B is for VPAHPND. 1-2: 55 °C; 3-4: 55.9 °C; 5-6: 58.3 °C; 7-8: 59.6 °C; 9-10: 62.1 °C.

[0034] Figure 3Schematic diagram of the specificity of the ddPCR method. Figure A shows EHP, and Figure B shows VPAHPND. 1: White spot syndrome virus of shrimp; 2: Taura virus; 3: Yellow head virus of shrimp; 4: Vibrio harveyi; 5: Decapod iridescent virus 1; 6: Vibrio parahaemolyticus; 7: Bacteria causing necrotic hepatopancreatitis; 8: Infectious hypodermal and hematopoietic necrosis virus; 9: EHP; 10: VPAHPND; NC, negative control, negative control.

[0035] Figure 4 Schematic diagram of the sensitivity analysis of the ddPCR method for diluting plasmids with TE. Figure A shows EHP, 1 - 2: 2.6×10 4 copies / μl; 3 - 4: 2.6×10 3 copies / μl; 5 - 6: 2.6×10 2 copies / μl; 7 - 8: 2.6×10 1 copies / μl; 9 - 10: 2.6×10 0 copies / μl; 11 - 12: negative control, negative control. Figure B shows VPAHPND, 1 - 2: 5.0×10 4 copies / μl; 3 - 4: 5.0×10 3 copies / μl; 5 - 6: 5.0×10 2 copies / μl; 7 - 8: 5.0×10 1 copies / μl; 9 - 10: 5.0×10 0 copies / μl; 11 - 12: negative control, negative control.

[0036] Figure 5 Schematic diagram of the sensitivity analysis of the ddPCR method for diluting plasmids with shrimp DNA. Figure A shows EHP, and Figure B shows VPAHPND. 1 - 2: 2.6×10 4 copies / μl; 3 - 4: 2.6×10 3 copies / μl; 5 - 6: 2.6×10 2 copies / μl; 7 - 8: 2.6×10 1 copies / μl; 9 - 10: 2.6×10 0 copies / μl; 11 - 12: negative control, negative control. Figure B shows VPAHPND, 1 - 2: 5.0×10 4 copies / μl; 3 - 4: 5.0×10 3 copies / μl; 5 - 6: 5.0×102 copies / μl; 7 - 8: 5.0×10 1 copies / μl; 9 - 10: 5.0×10 0 copies / μl; 11 - 12: negative control, negative control.

[0037] Figure 6 Figures for the ddPCR test results of Sample 3, Sample 22, and Sample 25. Figure A is for EHP, and Figure B is for VPAHPND. 1 - 2: Sample 3; 3 - 4: Sample 22; 5 - 6: Sample 25. Detailed implementation manners

[0038] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments. Here, the illustrative embodiments and descriptions of the present invention are used to explain the present invention, but do not limit the present invention.

[0039] Unless otherwise specified in the specification, all are conventional solutions in the art. The reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are already publicly available.

[0040] Example 1 Establishment and optimization of a dual ddPCR reaction system

[0041] 1. Design of primers and probes

[0042] The specific gene SWP1 (GenBank No. MH365434.1) of EHP was selected as the ddPCR target gene sequence of EHP to design primers and probes, and the specific gene pirA (MH410659.1) of VPAHPND was selected as the ddPCR target gene sequence of VPAHPND to design primers and probes. The probe of EHP uses FAM as the fluorescent reporter group and MGB as the fluorescent quenching group; the probe of VPAHPND uses VIC as the fluorescent reporter group and MGB as the fluorescent quenching group. All primers and probes were synthesized by Shanghai Sangon Biological Engineering Co., Ltd.

[0043] EHP primer and probe set:

[0044] EHP - F (SEQ ID NO:1): TTGGCGGCACAATTCTCA

[0045] EHP - R (SEQ ID NO:2): GCTGTGTCTGTGTAAATATCGTCTCTT

[0046] EHP - P (SEQ ID NO:3): FAM - ACATTTTCACCATTGGTC - MGB

[0047] VPAHPND primer-probe set:

[0048] VPAHPND-F (SEQ ID NO:4): CAAACGGAGGCGTCACAGA

[0049] VPAHPND-R (SEQ ID NO:5): GACCGACTTCCGGGATGAT

[0050] VPAHPND-P (SEQ ID NO:6): VIC-TAGACAGCAAACATACACC-MGB

[0051] 2. Reaction system

[0052] Using the EHP primer-probe set and the VPAHPND primer-probe set, a dual-channel droplet digital PCR was established for detection. The components of the dual-channel droplet digital PCR reaction system are shown in Table 1, and ultrapure water was added to make the reaction system up to 20 μL. The QX200 TM droplet generator was used for droplet preparation, and then the prepared droplets were transferred to a 96-well PCR plate for PCR amplification. The reaction program was 95 °C for 10 minutes; 94 °C for 30 seconds, 55 °C for 1 minute, 40 cycles; 98 °C for 10 minutes. After PCR amplification, the QX200 droplet reader was used to read the droplets respectively. The copy number of each well was evaluated using QuantaSoft TM version 1.7.4.

[0053] Table 1 Dual ddPCR reaction system

[0054] System volume 20 μL Component Dosage <![CDATA[2×ddPCR TM Supermix probe (Bio-Rad)]]> 10 μL EHP-F 500 nM EHP-R 500 nM EHP-P 250 μM VPAHPND-F 500 nM VPAHPND-R 500 nM VPAHPND-P 250 nM Sample to be tested 1 μL Ultra-pure water Balance

[0055] 3. Optimization of primer-probe ratio

[0056] Based on the reaction system in Table 1 of the dual ddPCR, the final concentration ratios of the primers and probes selected for the optimization experiment were: 500 nM: 250 nM, 500 nM: 300 nM, 500 nM: 200 nM, 400 nM: 200 nM. The reaction program was 95 °C for 10 minutes; 94 °C for 30 seconds, 55 °C for 1 minute, 40 cycles; 98 °C for 10 minutes.

[0057] As Figure 1 shown, the results indicated that when the primer concentration was 500 nM and the probe concentration was 300 nM, the positive and negative droplets of VPAHPND and EHP were significantly separated; the negative droplet signal of VPAHPND seemed to be stronger than that of EHP, which might indicate that compared with the VIC fluorophore, the MGB quencher was more effective for the FAM fluorophore. When the primer concentration was 500 nM and the probe concentration was 250 nM, the positive and negative droplets of VPAHPND were significantly separated.

[0058] Finally, 500 nM:250 nM was selected as the optimal primer-probe concentration ratio for duplex ddPCR and used in subsequent experiments.

[0059] 4. Optimization of annealing temperature

[0060] The annealing temperature was optimized using 500 nM:250 nM as the optimal primer and probe concentrations. Based on the reaction system in Table 1 of duplex ddPCR, annealing temperatures of 55°C, 55.9°C, 58.3°C, 59.6°C, and 62.1°C were selected. The reaction program was 95°C for 10 minutes; 94°C for 30 seconds, 55 - 62.1°C for 1 minute, 40 cycles; 98°C for 10 minutes.

[0061] As Figure 2 shown, the results indicate that as the annealing temperature increases, the difference between positive and negative droplets of EHP decreases. When the annealing temperature is 55°C, the difference between positive and negative droplets of EHP is the largest. The annealing temperature has little effect on VPAHPND. Therefore, 55°C was selected as the optimal annealing temperature and used in subsequent experiments.

[0062] Example 2 Specificity experiment of duplex ddPCR

[0063] Shrimp samples infected with WSSV, TSV, YHV, VH, DIV1, VP, NHPB, IHHNV, EHP, and VPAHPND were used as specific samples for the duplex ddPCR specificity experiment. Ultra-pure water was used as a negative control, and each reaction was repeated twice. The droplet generation graph obtained from the reaction and the resulting reaction copy number analysis were used to determine the specificity of duplex ddPCR for EHP and VPAHPND.

[0064] As Figure 3 shown, the results indicate that both EHP-positive samples and VPAHPND-positive samples can be correctly detected, while the detection results of other specific samples are negative. Therefore, the ddPCR method has high specificity.

[0065] Example 3 Sensitivity experiment of duplex ddPCR

[0066] The plasmid DNAs of EHP and VPAHPND were serially diluted 10-fold with 1×TE. The concentration gradient of the diluted EHP plasmid DNA was 2.6×10 0 ~2.6×10 4 copies / μL, and the concentration gradient of the diluted VPAHPND plasmid DNA was 5×10 0 ~5×10 4copies / μL. Ultra-pure water was used as a negative control, and each reaction was repeated twice. The detection limit concentration was repeatedly detected 8 times to determine the analytical sensitivity. In addition, the EHP and VPAHPND plasmids were serially diluted with shrimp DNA without EHP and VPAHPND. Each dilution was tested twice to evaluate whether the presence of shrimp DNA would affect the sensitivity of ddPCR.

[0067] As Figure 4 and Figure 5 shown, the ddPCR results showed that the lowest detection concentration of the TE-diluted plasmid for EHP was 2.6×10 0 copies / μl, and the lowest detection concentration of the shrimp DNA-diluted plasmid for EHP was 2.6×10 0 copies / μL. The lowest detection concentration of the TE-diluted plasmid for VPAHPND was 5.0×10 0 copies / μL, and the lowest detection concentration of the shrimp DNA-diluted plasmid for VPAHPND was 5.0×10 0 copies / μL. The results indicated that regardless of whether the plasmid was diluted with TE or shrimp DNA, the lowest detection concentration of EHP was 2.6×10 0 copies / μL, and the lowest detection concentration of VPAHPND was 5.0×10 0 copies / μL.

[0068] Example 4 Dual ddPCR Repeatability Experiment

[0069] Two concentrations were selected for both the EHP plasmid DNA and the VPAHPND plasmid DNA: a high concentration of 10 3 copies / μL and a low concentration of 10 1 copies / μL. Each concentration was repeatedly detected three times in three independent trials to evaluate the repeatability of the ddPCR method.

[0070] As shown in Table 2, the maximum CV(%) value for the within-group repeat experiment was 0.08, and the maximum CV(%) value for the between-group repeat experiment was 0.08. The ddPCR detection method had good repeatability.

[0071] Table 2 Results of the Repeatability Analysis of ddPCR

[0072]

[0073] Example 5 Comparison of Dual ddPCR and qPCR in the Detection of Actual Samples

[0074] Twenty-six clinical specimens were repeatedly detected using both the ddPCR method and the qPCR method simultaneously to compare the two detection effects.

[0075] The results are shown in Tables 3 and 4,

[0076] Table 3 Copy numbers of EHP detected by ddPCR and qPCR in clinical samples

[0077]

[0078]

[0079] Table 4 Copy numbers of VPAHPND detected by ddPCR and qPCR in clinical samples

[0080]

[0081]

[0082] Among 26 clinical samples, 14 (53.84%) were detected as EHP positive by the ddPCR method. Among the 14 positive samples, 11 were also positive (42.31%) when using the qPCR method.

[0083] When using the ddPCR and qPCR methods, 5 (23.08%) of the 26 clinical samples were detected as positive for VPAHPND.

[0084] The viral load range of EHP detected by ddPCR was from 1.4 to 4400.04 copies, while the viral load range of EHP detected by qPCR was from 10.06 to 13857.64 copies. The viral load range of VPAHPND detected by ddPCR was from 5.4 to 33.3 copies, while the viral load range of VPAHPND detected by qPCR was from 23.46 to 109.52 copies.

[0085] As Figure 6 shown, even at very low pathogen copies, high signals of ddPCR can be observed, indicating that ddPCR is more suitable for detecting low-concentration samples than qPCR.

[0086] The technical solutions provided by the embodiments of the present invention have been introduced in detail above. Specific examples are used in this article to elaborate on the principles and implementation manners of the embodiments of the present invention. The descriptions of the above embodiments are only applicable to help understand the principles of the embodiments of the present invention; at the same time, for those of ordinary skill in the art, according to the embodiments of the present invention, there will be changes in the specific implementation manners and application scopes. In summary, the content of this specification should not be construed as a limitation to the present invention.

Claims

1. A dual droplet digital PCR detection primer set for Enterocytozoon hepatopenaei and Vibrio parahaemolyticus, characterized in that: It includes: EHP primer-probe set: EHP-F, whose sequence is shown in SEQ ID NO.1; EHP-R, whose sequence is shown in SEQ ID NO.2; EHP-P, whose sequence is shown in SEQ ID NO.3, with a fluorescent reporter group connected to its 5'-end and a fluorescent quenching group connected to its 3'-end; VPAHPND primer-probe set: VPAHPND-F, whose sequence is shown in SEQ ID NO.4; VPAHPND-R, whose sequence is shown in SEQ ID NO.5; VPAHPND-P, whose sequence is shown in SEQ ID NO.6, with a fluorescent reporter group connected to its 5'-end and a fluorescent quenching group connected to its 3'-end; The fluorescent reporter groups connected to EHP-P and VPAHPND-P are different.

2. The dual droplet digital PCR detection primer set for Enterocytozoon hepatopenaei and Vibrio parahaemolyticus according to claim 1, characterized in that: FAM is connected to the 5'-end of EHP-P, and MGB is connected to the 3'-end; VIC is connected to the 5'-end of VPAHPND-P, and MGB is connected to the 3'-end.

3. Use of a detection primer set as claimed in claim 1 or 2 in the preparation of a kit for detecting Enterocytozoon hepatopenaei and Vibrio parahaemolyticus.

4. The use according to claim 3, characterized in that: The kit is a dual droplet digital PCR detection kit.

5. The use according to claim 3 or 4, characterized in that: The kit includes a reaction solution containing the components required for the reaction, the detection primer set as claimed in claim 1 or 2, a negative control, and a positive control.

6. The use according to claim 5, characterized in that: The negative control is sterile ultrapure water, and the positive controls are plasmid DNA standards pUC57-EHP and pUC57-VPAHPND.

7. A dual droplet digital PCR detection system using the detection primer set as claimed in claim 1 or 2, characterized in that: It includes a reaction solution containing the components required for the reaction, the primers and probes as claimed in claim 1 or 2, a sample to be tested, and ultrapure water.

8. The dual droplet digital PCR detection system using the detection primer set as claimed in claim 7, characterized in that: The system is 20 μL in total and contains 2×ddPCR TM Supermix probe (Bio-Rad) 10 μL, each primer is 500 nM, each probe is 250 μM, 1 μL of the sample to be tested, and the balance is ultrapure water.

Images