KASP molecular markers related to soybean seed germination and their applications

By developing KASP molecular markers related to soybean seed germination and using fluorescent quantitative PCR technology to identify the genotype of the SNP site S08_7394400, the problems of time-consuming, labor-intensive and inaccurate traditional breeding methods were solved, and efficient screening of soybean seeds with high germination rates was achieved, thereby improving breeding efficiency and yield.

CN120330376BActive Publication Date: 2025-09-09XIANGHU LABORATORY +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510798445.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-16
Publication Date
2025-09-09
Estimated Expiration
2045-06-16

AI Technical Summary

Technical Problem

Traditional breeding methods are time-consuming, labor-intensive, and easily affected by external environmental interference. It is difficult to accurately screen soybean seeds with high germination rates, which affects seed vitality and yield.

Method used

Develop KASP molecular markers related to soybean seed germination, use fluorescence quantitative PCR technology to identify the genotype of SNP site S08_7394400, judge seed germination vitality by fluorescence signal, and screen high-vigor varieties.

Benefits of technology

It has achieved sensitive, efficient and low-cost identification and screening of soybean seeds with high germination rates, shortened breeding time, improved breeding efficiency, reduced agricultural production costs and increased yields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330376B_ABST
    Figure CN120330376B_ABST
Patent Text Reader

Abstract

This application provides KASP molecular markers associated with soybean seed germination and their applications. Specifically, the present invention developed a KASP molecular marker S08_7394400, which is significantly associated with soybean seed germination. This marker site contains a C / A mutation (i.e., a C / A mutation at position 13 of the sequence shown in SEQ ID NO: 1). Primers were designed to rapidly detect the soybean genotype at this marker site, revealing that soybean seeds with a CC genotype exhibited high germination vigor, while soybean seeds with an AA genotype exhibited low germination vigor. Using the KASP molecular marker, the present invention can rapidly and accurately identify and screen soybean seeds with high germination vigor, thereby shortening soybean breeding time, reducing agricultural production costs, and increasing soybean yields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetic breeding, in particular to a KASP molecular marker related to soybean seed germination vitality and its application. Background Art

[0002] Seed germination is the first and most important stage in the plant growth cycle and plays a crucial role in crop yield (Rajjou et al., 2012). However, soybean seeds are short-lived and prone to deterioration, resulting in a significant decrease in seed vigor and, in turn, a reduced germination rate. Studies have shown a significant positive correlation between soybean seed germination rate and yield (Caverzan et al., 2018). In practical production, soybean seeds with a high germination rate can effectively improve field emergence uniformity, reduce seed sowing requirements, lower agricultural production costs, increase soybean yield, and reduce my country's dependence on imported soybeans (Kaya et al., 2016). Therefore, identifying key genes regulating soybean germination and elucidating their molecular mechanisms are crucial for high-yield soybean breeding.

[0003] Traditional breeding methods rely on screening individual plants based on the germination phenotype of offspring. This method is time-consuming, labor-intensive, and susceptible to environmental interference, resulting in low accuracy. Developing specific molecular markers to assist breeding, leveraging base differences within target genes, is one of the best approaches for improving the efficiency of soybean breeding for high germination rates. Molecular markers offer the advantages of early selection, environmental indifference, rapidity, efficiency, and precision, making them widely used in crop breeding. Competitive allele-specific PCR (KASP) is a high-throughput genotyping technique based on known single nucleotide polymorphisms (SNPs). It enables precise biallelic detection of SNPs and insertions / deletions at specific loci in a wide range of genomic DNA samples. The principle is to design two forward primers and a universal reverse primer for each allelic SNP locus. Each forward primer has a specific sequence that binds to a different fluorescent marker. KASP is currently widely used in soybean molecular marker breeding. Therefore, the development of KASP molecular markers related to soybean seed germination and their application in early breeding and low-generation material selection will play a significant role in reducing breeding workload and improving breeding efficiency. Summary of the Invention

[0004] The present invention aims to provide a KASP molecular marker associated with soybean seed germination and its use. Specifically, one aspect of the present invention provides a KASP molecular marker associated with soybean seed germination, the DNA fragment of which is shown in SEQ ID NO:1, wherein the sequence shown in SEQ ID NO:1 contains a C / A base mutation at position 13. Another aspect of the present invention provides the use of the KASP molecular marker described herein for identifying soybean seed germination vigor. This KASP marker can sensitively, efficiently, and cost-effectively predict soybean seed germination vigor, facilitating the selection of varieties with high seed germination vigor and shortening soybean breeding time.

[0005] In this case, the present invention includes but is not limited to the following:

[0006] In one aspect, the present invention provides a KASP molecular marker associated with soybean seed germination, wherein the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1, and there is a C / A base mutation at position 13 of the sequence shown in SEQ ID NO: 1.

[0007] In another aspect, the present invention provides a primer set for detecting the KASP molecular marker described in the present invention, comprising: an upstream primer F1', an upstream primer F2', and a downstream universal primer R, the nucleotide sequence of the upstream primer F1' is 5'-TGAAAAAAAAAGAGTAAATTTAGGAGCCC-3', the nucleotide sequence of the upstream primer F2' is 5'-TGAAAAAAAAAGAGTAAATTTAGGAGCCA-3', and the nucleotide sequence of the downstream universal primer R is 5'-CAGTCTTATAGTGTTTCTGTTGCCTTA-3'.

[0008] In one aspect, the 5' ends of the upstream primers F1' and F2' of the present invention are connected with tags for distinguishing the base types at the KASP molecular markers.

[0009] In one aspect, a linker sequence is connected between the upstream primer F1' and / or the upstream primer F2' and the tag of the present invention.

[0010] In one aspect, the linker sequence connected between the 5' end of the upstream primer F1' and the tag is GAAGGTGACCAAGTTCATGCT, and the linker sequence connected between the 5' end of the upstream primer F2' and the tag is GAAGGTCGGAGTCAACGGATT.

[0011] In one aspect, the label for distinguishing the base type at the KASP molecular marker of the present invention is a fluorescent reporter group.

[0012] In one aspect, the fluorescent reporter group of the present invention is selected from FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 and TexasRed.

[0013] In one aspect, the fluorescent reporter group connected to the upstream primer F1' of the present invention is FAM, and the fluorescent reporter group connected to the upstream primer F2' is HEX.

[0014] Preferably, in the primer set of the present invention, the upstream primer F1' sequence of the present invention is shown in SEQ ID NO: 2, and the 5' end is connected to FAM; the upstream primer F2' sequence is shown in SEQ ID NO: 3, and the 5' end is connected to HEX.

[0015] In another aspect, the present invention provides a primer set for detecting the KASP molecular marker of the present invention, the primer set comprising:

[0016] The upstream primer F1' sequence is shown in SEQ ID NO: 2 (i.e., the upstream primer F1 in Example 2), and FAM is connected to the 5' end; the upstream primer F2' sequence is shown in SEQ ID NO: 3 (i.e., the upstream primer F2 in Example 2), and HEX is connected to the 5' end; and the downstream universal primer is shown in SEQ ID NO: 4.

[0017] In another aspect, the present invention provides a detection kit comprising the primer set of the present invention.

[0018] In another aspect, the present invention provides use of the KASP molecular marker of the present invention, the primer set of the present invention, or the detection kit of the present invention in any of the following:

[0019] (1) Application in identifying soybean seed germination vigor;

[0020] (2) Application in improving soybean germplasm resources;

[0021] (3) Application in increasing soybean yield.

[0022] In one aspect, the present invention also provides a method for identifying soybean seed germination vigor, comprising the following steps:

[0023] Using the genomic DNA of the soybean sample to be tested as a template, the template is amplified by fluorescent quantitative PCR using the primer set or the detection kit of the present invention. After the PCR amplification is completed, the fluorescent signal is read, the fluorescent signal is analyzed and converted, the genotype is identified, and the germination vigor of the soybean seeds is determined based on the genotype;

[0024] If the genotype at the KASP molecular marker site S08_7394400 is CC, the soybean seed germination activity is high;

[0025] If the genotype at the KASP molecular marker site S08_7394400 is AA, the soybean seed germination activity is low;

[0026] The KASP molecular marker site S08_7394400 is located at 7,394,400 bp on chromosome 8 of the soybean genome, and the full gene sequence version of the soybean genome is Glycine max Wm82.a4.v1.

[0027] In one aspect, in the fluorescent quantitative PCR reaction system of the base type at the marker site S08_7394400 of the present invention, the upstream primer F1, the upstream primer F2, and the downstream universal primer R are mixed in a volume ratio of 2:2:5 (for example, total system 10 μL: mixed primers: 0.14 μL, 2× KASP Mix (for example, LGC-GEN brand, product number: LGC-KBS-1050-122): 4.86 μL, genomic DNA: 5 μL).

[0028] In one aspect, the fluorescent quantitative PCR reaction conditions for the base type at the marker site S08_7394400 of the present invention are: (1) 30°C for 1 min, (2) 94°C for 20 s, (3) 55°C for 1 min, and (4) 30°C for 1 min, and steps (2) to (3) are cycled 40 times.

[0029] The beneficial technical effects of the present invention include but are not limited to:

[0030] The use of KASP molecular markers can sensitively, efficiently and cost-effectively identify and screen soybean seeds with high germination vitality, which is conducive to shortening the breeding time of soybeans, thereby reducing agricultural production costs and increasing soybean yields, which is of great significance for ensuring food safety in my country. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The results of the GR3_GLM genome-wide association analysis of soybean seed germination are shown, where GR3: 2-day germination rate; GLM: general linear model.

[0032] Figure 2 The results of the GR3_MLM genome-wide association analysis of soybean seed germination are shown, where GR3: 2-day germination rate; MLM: mixed linear model.

[0033] Figure 3The results of the GR4_GLM genome-wide association analysis of soybean seed germination are shown, where GR4: 3-day germination rate; GLM: general linear model.

[0034] Figure 4 The results of the GR4_MLM genome-wide association analysis of soybean seed germination are shown, where GR4: 3-day germination rate; MLM: mixed linear model.

[0035] Figure 5 The KASP typing result diagram is shown, where blue represents CC genotype, red represents AA genotype, and × represents blank control.

[0036] Figure 6 The germination phenotype data of two different genotype materials at the S08-7394400 locus are shown. DETAILED DESCRIPTION

[0037] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.

[0038] Example 1: Obtaining SNP sites significantly associated with soybean seed germination vigor

[0039] This study used two analytical models, GLM (Generalized Linear Models) and MLM (mixed linear model) (Lipka et al., 2012), to conduct a genome-wide association study (GWAS) on phenotype data from germination of 438 resequenced soybean accessions (231 soybean cultivars and 207 soybean landraces) at different stages of germination. Multiple GWAS results mapped a total of 14 significant SNPs on chromosome 8 (Table 1).

[0040] Table 1 14 significant SNPs co-located by GWAS

[0041]

[0042] Haplotype analysis of these significant SNPs revealed significant differences in seed germination between different haplotypes at the SNP locus S08_7394400 (C / A), which is significantly associated with soybean seed germination vigor. The germination rate of soybean varieties with the CC genotype was 95.5%, while that of varieties with the AA genotype was 55% (seed germination rate = number of seeds germinated on the second day / total number of seeds). This locus is located at position 7,394,400 bp on chromosome 8 in soybean Wm82.a4.v1 and undergoes a C-to-A substitution. The genotypes at this locus are CC and AA. The nucleotide sequence of this SNP is shown in SEQ ID NO: 1. Seed germination procedures: Before germination, soybean seeds were sterilized using chlorine gas generated by 90 ml of sodium hypochlorite and 10 ml of concentrated hydrochloric acid. Subsequently, 50 seeds were placed on a piece of filter paper placed in a 0.9% agar medium with 15 ml of water. The seeds were incubated in the dark at 25°C for two days. Germination was then counted to calculate the germination rate (GR). Seeds were considered germinated when the radicle broke through the seed coat. Three replicate germination experiments were conducted, and the average germination rate was calculated.

[0043] SEQ ID NO: 1 (the bold and underlined SNP site is S08_7394400 (C / A))

[0044] AATTTAGGAGCC C / A TAAGGCAACAGAAACACTATAAGACTGTTTTTGTTTTAATGGAGGTGTTAAGAATAGTCCCACATCGGATAATTCATGAACATGATAAGTGTTTATATAGTTGAGTAGACCATCCTCTTATGAATTGGTTTTTTAAAGGGACCATTTAGATGCCTTTGCTGCACTATAAAATTTAATATGGTATCAGAGCCTAGTCATATAGAGATTTAATAAGAATGAACCAATAAATAATGATAGATTTTTTT.

[0045] Example 2: Development of KASP-labeled specific primers

[0046] Based on the above-mentioned SNP mutation sites, the KASP molecular marker primer set was designed. The KASP marker primer set contains three primers: two specific primers designed for the base differences of the key SNP sites, namely upstream primer F1 (with a FAM fluorescent tag connected to its 5' end, and the underlined part is the adapter sequence), upstream primer F2 (with a HEX fluorescent tag connected to its 5' end, and the underlined part is the adapter sequence), and a universal downstream primer. The primer sequences are as follows:

[0047] Upstream primer F1 5'-3' sequence (SEQ ID NO: 2): GAAGGTGACCAAGTTCATGCT TGAAAAAAAAAGAGTAAATTTAGGAGCCC

[0048] Upstream primer F2 5'-3' sequence (SEQ ID NO: 3): GAAGGTCGGAGTCAACGGATT TGAAAAAAAAAGAGTAAATTTAGGAGCCA

[0049] Downstream universal primer R: 5'-3' sequence (SEQ ID NO: 4): CAGTCTTATAGTGTTTCTGTTGCCTTA

[0050] Genomic DNA from soybean samples was extracted using the CTAB method disclosed in Patent ZL202410324512.7 (Patent Publication No. CN117987592B). Fluorescence quantitative PCR amplification was performed using the KASP primer combination using the DNA from the soybean sample as a template. After amplification, the fluorescent signal was read to identify the genotype, and the germination vigor of the soybean seeds was determined based on the genotype. If the identified genotype was CC, the seed germination vigor of the soybean sample was determined to be high; if the identified genotype was AA, the seed germination vigor of the soybean sample was determined to be low.

[0051] The fluorescence quantitative PCR amplification system is as follows: 10 μL total system, including 0.14 μL of mixed primers, 4.86 μL of 2×KASP Master Mix (LGC-GEN brand, product number: LGC-KBS-1050-122), and 5 μL of genomic DNA.

[0052] The volume ratio of the upstream primer F1, upstream primer F2 and downstream universal primer R in the above-mentioned KASP mixed primer is 2:2:5.

[0053] The reaction conditions for the above-mentioned fluorescence quantitative PCR amplification are:

[0054]

[0055] After the reaction is completed, the fluorescence quantitative PCR instrument automatically performs fluorescence data analysis on the PCR reaction products.

[0056] When using primers S08-7394400 for genotyping of soybean seed germination vigor, when the alleles at the SNP site are all CC, the test sample binds to the specific FAM detection primer and releases a blue fluorescent group, so that the fluorescent color can be used to determine that it is a genotype with high seed vigor (the typing result of the KASP marker is defined as: CC). When the alleles at the SNP site are all AA, the test sample binds to the specific HEX detection primer and releases a red fluorescent group, so that the fluorescent color can be used to determine that it is a genotype with low seed vigor (the typing result of the KASP marker is defined as: AA) (see Figure 5 ).

[0057] Example 3: Detection of genotypes of SNP sites of different soybean varieties using KASP molecular markers and their application in identifying soybean seed germination vigor

[0058] The primer set of Example 2 was used to genotype 78 soybean materials of two genotypes at the S08_7394400 SNP site. The results showed that the primer set of Example 2 was able to successfully genotype the S08_7394400 SNP site (see Table 2). When the alleles at the SNP site were all C, the test sample bound to the specific FAM detection primer and released blue fluorescence. The seed germination process was carried out according to the seed germination steps of Example 1. The statistical average germination rate was 96.7%. When the alleles at the SNP site were all A, the test sample bound to the specific HEX detection primer and released red fluorescence. The average germination rate was 57.8%. The germination rate of the CC genotype was significantly higher than that of the AA genotype material ( Figure 6 ).

[0059] Table 2 Genotyping of 78 soybean materials

[0060]

[0061] In summary, the present invention conducted genome-wide association analysis on natural soybean populations and, combined with haplotype analysis, screened for a significantly associated SNP site, S08_7394400 (C / A), associated with soybean seed germination. The corresponding KASP marker was then developed. Seed germination vigor of the CC genotype at this site was significantly higher than that of the AA genotype.

Claims

1. A molecular marker related to soybean seed germination, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and there is a C / A base mutation at position 13 of the sequence shown in SEQ ID NO:

1.

2. A primer set for detecting the molecular marker according to claim 1, characterized in that: The primer set includes: an upstream primer F1', an upstream primer F2' and a downstream universal primer R, the nucleotide sequence of the upstream primer F1' is 5'-TGAAAAAAAAAGAGTAAATTTAGGAGCCC-3', the nucleotide sequence of the upstream primer F2' is 5'-TGAAAAAAAAAGAGTAAATTTAGGAGCCA-3', and the nucleotide sequence of the downstream universal primer R is 5'-CAGTCTTATAGTGTTTCTGTTGCCTTA-3'.

3. The primer set according to claim 2, characterized in that The 5' ends of the upstream primers F1' and F2' are connected with tags for distinguishing the base type at the 13th position of the molecular marker.

4. The primer set according to claim 3, characterized in that A linker sequence is connected between the upstream primer F1' and / or the upstream primer F2' and the tag.

5. The primer set according to claim 4, characterized in that The linker sequence connected between the 5' end of the upstream primer F1' and the tag is GAAGGTGACCAAGTTCATGCT, and the linker sequence connected between the 5' end of the upstream primer F2' and the tag is GAAGGTCGGAGTCAACGGATT.

6. The primer set according to any one of claims 3 to 5, characterized in that The tag used to distinguish the base type at position 13 of the molecular marker is a fluorescent reporter group.

7. The primer set according to claim 6, characterized in that The fluorescent reporter group is selected from FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 and TexasRed.

8. A detection kit, characterized in that: The kit comprises the primer set according to any one of claims 2 to 7.

9. Use of the molecular marker according to claim 1, the primer set according to any one of claims 2 to 7, or the detection kit according to claim 8 in any of the following: (1) Application in identifying soybean seed germination vigor; (2) Application in improving soybean germplasm resources, wherein the improved soybean germplasm resources are for increasing the germination vitality of soybean seeds.

10. A method for identifying soybean seed germination vigor, characterized in that: The following steps are involved: Using the genomic DNA of the soybean sample to be tested as a template, performing fluorescent quantitative PCR amplification on the template using the primer set described in any one of claims 2 to 7 or the detection kit described in claim 8, reading the fluorescent signal after the PCR amplification is completed, analyzing and converting the fluorescent signal, identifying the genotype, and determining the germination vigor of the soybean seeds based on the genotype; If the genotype at the molecular marker site S08_7394400 is CC, the soybean seed germination activity is high; If the genotype at the molecular marker site S08_7394400 is AA, the soybean seed germination activity is low; The molecular marker site S08_7394400 is located at 7,394,400 bp on chromosome 8 of the soybean genome, and the full gene sequence version of the soybean genome is soybean Wm82.a4.v1.

Citation Information

Patent Citations

  • A KASP molecular marker related to soybean main stem node number and its application

    CN117987592B

  • SNP (Single Nucleotide Polymorphism) molecular marker related to soybean plant height character as well as detection primer and application of SNP molecular marker

    CN116875722A

  • KASP molecular marker related to salt tolerance character in soybean germination period and application of KASP molecular marker

    CN117025829A