Multiplex fluorescent quantitative PCR (polymerase chain reaction) reagent for synchronously detecting five DNA (deoxyribonucleic acid) viruses related to infertility

Abstract

The invention discloses a multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) reagent for synchronously detecting five DNA (Deoxyribose Nucleic Acid) viruses related to infertility. The multiplex fluorescent quantitative PCR reagent comprises specific primers and probes aiming at a simian vacuolar virus 40, a molluscum contagiosum virus, a Merkel cell polyoma virus, a BK virus and a torque teno virus; according to the method, the five viruses can be synchronously detected in a single reaction tube, meanwhile, the load of the viruses can be quantified, the reagent has the advantages of being high in specificity and sensitivity, high in repeatability and reproducibility, easy to operate, short in consumed time and the like, and when large-scale clinical screening application is carried out, the reagent has the advantages of being high in specificity and sensitivity, good in repeatability and reproducibility and the like. The detection efficiency of the five viruses can be greatly improved, the detection cost can be reduced, and the detection result can provide important reference for the formulation of an individualized treatment scheme, so that the application has important value and significance for clinical rapid screening and diagnosis and improvement of the treatment effect.

Description

Technical Field

[0001] The invention belongs to the technical field of DNA virus detection, and in particular relates to a multiplex fluorescent quantitative PCR detection reagent capable of synchronously detecting five DNA viruses related to infertility. Background Art

[0002] The World Health Organization (WHO) defines infertility as a reproductive system disease, specifically referring to a couple who have not taken any contraceptive measures for more than one year and have normal sexual life but cannot successfully conceive. A variety of factors can lead to infertility, among which pathogenic microbial infection is an important cause of infertility. Among all the pathogenic microorganisms associated with infectious infertility, DNA viruses are a relatively common type. Existing research results show that Simian Vacuolating Virus 40 (SV40), BK virus (BK Polyomavirus, BKV), Molluscum Contagiosum Virus (MCV), Merkel Cell Polyomavirus (MCPyV), and Torque Teno Virus (TTV) are five highly prevalent DNA viruses associated with infertility.

[0003] Polyomavirus is a type of DNA virus that is widely spread around the world and can cause abnormal cell proliferation and differentiation. It is named because it can induce tumors. It mainly includes SV40, BKV, etc. Among them, SV40 is a small circular double-stranded DNA virus with a genome size of about 5.2kp. It can cause malignant transformation of a variety of normal human and animal cells. SV40 can infect renal tubular cells and urethral epithelial cells. Severe or repeated kidney infections can lead to chronic kidney disease, endocrine disorders (such as decreased erythropoietin and abnormal renin-angiotensin system), and ultimately damage the development environment of reproductive cells (sperm or eggs), thereby indirectly leading to infertility. In addition, SV40 infection of human urethral epithelial cells can cause urinary tract infection (UTI). Repeated UTI in women can cause uterine or fallopian tube infection and pelvic inflammatory disease (PID), which can lead to adhesion or obstruction of the fallopian tubes, ultimately increasing the risk of infertility.

[0004] BKV is a circular double-stranded DNA virus with a genome size of approximately 5.1kb. Existing research data show that BKV can be found in kidneys, semen, and urine. The latest research found that anti-BKV IgM antibodies can be detected in the umbilical cord blood of newborns born to mothers infected with BKV, and BKV DNA genomes have also been found in the placenta and kidneys of aborted fetuses, suggesting that BKV may pass through the maternal-fetal barrier and affect pregnancy outcomes.

[0005] MCV is a double-stranded linear DNA virus that replicates within the cytoplasm. Its genome size is approximately 185 - 195 kb. MCV can be transmitted through direct skin contact or indirectly through contact with contaminated objects. After infecting epidermal cells, it forms characteristic papules. MCV mainly affects children aged 2 - 5, immunocompromised patients, and sexually active young people. Recent research has found that MCV infection in men can cause asymptomatic mucosal colonization and inflammatory diseases such as urethritis, which can then lead to orchitis, prostatitis, and epididymitis, resulting in testicular damage or duct obstruction and ultimately affecting male fertility.

[0006] MCPyV belongs to the circular double-stranded DNA virus, with a genome size of approximately 5.4 kb. Serological studies have shown its direct association with Merkel cell carcinoma. MCPyV infection usually begins in children and adolescents and persists on the skin surface of most adults, indicating that its infection may accompany life. Recent research has found that MCPyV can be detected in semen, and it has also been found that it may be related to reduced sperm motility, abnormal sperm morphology, and increased sperm DNA fragmentation rate, ultimately potentially affecting male sperm quality.

[0007] TTV belongs to the non-enveloped single-stranded DNA virus, with a genome size of approximately 3.8 kb. TTV is usually associated with a variety of diseases and co-infections, including viral hepatitis, asthma, and autoimmune rheumatic diseases. Long-term airway inflammation can lead to systemic hypoxic state, affecting follicle development or luteal function.

[0008] Currently, the detection methods for the above five DNA viruses mainly include chemiluminescence immunoassay (CLIA) and real-time fluorescence quantitative PCR (qPCR), etc. Among them, chemiluminescence immunoassay determines the virus infection situation by detecting the presence of virus-specific antibodies or antigens. However, the detection results of antigens or antibodies cannot accurately judge the virus infection status, so it has great limitations in practical applications. In contrast, real-time fluorescence quantitative PCR technology monitors the PCR amplification process in real time through fluorescence signals and can accurately quantify the virus load, and has become an important method for pathogen infection laboratory and clinical diagnosis. However, the traditional single qPCR technology only uses a pair of primers and probes, and can only detect one target virus genome in one reaction. It is inefficient when facing multiple pathogen co-infections or the need for high-throughput screening, and the single detection cost is relatively high, which to a certain extent limits its wide application in clinical practice. So far, there is no targeted multiplex fluorescence quantitative PCR method for simultaneously detecting SV40, MCV, MCPyV, BKV, and TTV in clinical practice. Summary of the Invention

[0009] In view of the deficiencies of existing detection technologies, the present invention provides a multiplex fluorescence quantitative PCR reagent for simultaneously detecting five DNA viruses related to infertility. By using this method to conduct large-scale molecular screening on clinical samples of infertile patients, not only can the detection results be obtained quickly, providing an important basis for clinical diagnosis and treatment, but also the detection efficiency can be improved and the detection cost can be reduced. At the same time, it has important value and significance for the research work on the prevention and treatment of infectious infertility.

[0010] The multiplex fluorescence quantitative PCR reagent of the present invention for simultaneously detecting five DNA viruses related to infertility includes specific primers and probes for simian virus 40, molluscum contagiosum virus, Merkel cell polyomavirus, BK virus, and Torque teno virus: The specific primers for simian virus 40 are AGTCTTTTTGTCTTTTATTTCAGGTC and GCCTTCAACAGTAGCAACAGATG, and the probe is AAGCTGCTGCTGCTACTGGATTTTCAG; The specific primers for molluscum contagiosum virus are AGAGCATCTTGAGCGTRTTCAT and CCTACCTCAAGAGYTACATCGTCAT, and the probe is CAAGGTGCTGGTGGACAACATCTACATCAT; The specific primers for Merkel cell polyomavirus are GTGCATGCTTAAGCAACTTAGAGATTC and AGATGCAGTAAGCAGTAGTCAGTTTCTTCT, and the probe is TTTGCTATCAGTGCTTTATTCTTTGGTTTGGATTTC; The specific primers for BK virus are CTGCTCTAGCACTTTTGGGGGAC and GCAAGGGATGCAATTTGAACTTCTAT, and the probe is CTGCTGCTGCCACAGGATTTTCAGTG; The specific primers for Torque teno virus are CYGWGGGCGGGWGCCGDA and GCCWGWCCCGWGCCCGA, and the probe is CAAGGTGCTGGTGGACAACATCTACATCAT.

[0011] The detection reagent of the present invention also includes other conventional reagents for multiplex fluorescence quantitative PCR detection.

[0012] The method of using the above multiplex fluorescence quantitative PCR detection reagent is as follows: 1. Collect clinical plasma and reproductive tract samples from infertile patients (semen for male reproductive tract samples and vaginal swabs for female reproductive tract samples). Collect patient information and record it during sampling, register it, store it at low temperature during transportation, and then store it at -80°C. 2. Extract the viral DNA genome from blood or reproductive tract samples using the Tiangen Virus Genomic DNA / RNA Extraction Kit. 3. Using the DNA extracted in step 2 as a template, adopt specific primers and probes for the above five DNA viruses, and perform multiplex fluorescence quantitative PCR detection according to the reaction program and reaction system optimized by the Aikery Pro Taq HS Premixed Probe qPCR Kit (390A). Determine the results according to the Ct value. The reaction program is pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing and extension at 56°C for 30 s, for 40 cycles; collect fluorescence signals during the annealing and extension stage of each cycle.

[0013] The interpretation of the test results includes the following: I. Judgment of the validity of the amplification curve: 1. Amplification curve shape: It is a standard "S" curve, which needs to meet the requirements that the curve is smooth without serrated fluctuations and the plateau phase is normal. 2. Requirements for setting the threshold line: It is located in the middle of the exponential growth phase and should not be too high or too low. 3. Quality control requirements: The Cq value of the negative control / no template control should be UNDEF, and the difference in Ct values between replicates should be <0.5 (otherwise, re-test or re-extract nucleic acid).

[0014] II. Result interpretation criteria Table 1 Result interpretation criteria for multiplex fluorescence quantitative PCR ; III. Special instructions It is recommended to re-test and confirm samples in the suspicious interval; UNDEF indicates that the sample concentration is below the detection limit and is uniformly judged as negative; all positive results need to meet the amplification curve validity standard.

[0015] Advantages and technical effects of the present invention: 1. The present invention designs specific primers according to the highly conserved regions of the conserved genes of five DNA viruses, and uses specific probes for different viruses with different fluorescent labels to achieve the simultaneous detection of five viruses in one reaction system, and can also quantitatively detect the viral load while detecting the virus infection situation. 2. Specificity verification of this method found that there was no cross - reaction between each DNA virus and other pathogens, and the specificity was good. Sensitivity verification of this method found that the minimum detection limits of the five viruses could all reach 10 copies / μL, indicating that this method has high sensitivity. Repeatability verification of this method found that the coefficient of variation (CV) of both intra - batch and inter - batch repeatability was < 2%, indicating that this method has good repeatability and reproducibility. 3. The method of the present invention has the advantages of high sensitivity, strong specificity, good repeatability and reproducibility, providing an effective technical means for clinically diagnosing five viruses, namely SV40, MCV, MCPyV, BKV, and TTV. A multiplex fluorescence quantitative PCR detection method based on one - tube synchronous detection technology was developed, aiming to efficiently screen five DNA viruses related to infectious infertility. This method is efficient and accurate, suitable for clinical infection diagnosis, epidemiological monitoring and dynamic analysis of virus load, and can significantly improve the detection efficiency. Through large - scale clinical applications in high - risk populations such as infertile patients and pregnant women, the popularization of this technology will help to clarify the molecular mechanism of virus infection leading to reproductive dysfunction and adverse pregnancy outcomes, providing an important basis for clinical diagnosis and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the result of the specificity experiment of multiplex fluorescence quantitative PCR; Figure 2 It is the result of the amplification curve of the linear range verification of simian vacuolating virus 40 by multiplex fluorescence quantitative PCR; Figure 3 It is the result of the amplification curve of the linear range verification of molluscum contagiosum virus by multiplex fluorescence quantitative PCR; Figure 4 It is the result of the amplification curve of the linear range verification of Merkel cell polyomavirus by multiplex fluorescence quantitative PCR; Figure 5 It is the result of the amplification curve of the linear range verification of BK virus by multiplex fluorescence quantitative PCR; Figure 6 It is the result of the amplification curve of the linear range verification of torque teno virus by multiplex fluorescence quantitative PCR; Figure 7 It is the result graph of the standard curve of simian vacuolating virus 40 by multiplex fluorescence quantitative PCR; Figure 8 It is the result graph of the standard curve of molluscum contagiosum virus by multiplex fluorescence quantitative PCR; Figure 9 It is the result graph of the standard curve of Merkel cell polyomavirus by multiplex fluorescence quantitative PCR; Figure 10 It is the result graph of the standard curve of BK virus by multiplex fluorescence quantitative PCR; Figure 11 It is the result diagram of the standard curve of the multiplex fluorescence quantitative PCR for circovirus; Figure 12 It is the Sanger sequencing peak diagram of the products of some positive samples; Figure 13 It is the blats results of the products of some positive samples. Specific implementation manners

[0017] To further elaborate on the technical means and effects adopted by the present invention, the technical solution of the present invention will be further described below through specific implementation manners, but the present invention is not limited to the scope of the embodiments. It should be noted that the materials used in the following embodiments are not limited to those listed above, and other similar materials can be used for substitution. For instruments without specific conditions indicated, they are in accordance with conventional conditions or the conditions recommended by the manufacturer. Those skilled in the art should master the relevant knowledge of using conventional materials and instruments; the methods in the embodiments are conventional methods unless otherwise specified.

[0018] Example 1: Design of specific primers and probes 1. Download the full-length genomic nucleic acid sequences of Simian vacuolating virus 40, Molluscum contagiosum virus, Merkel cell polyomavirus, BK virus, and circovirus from the NCBI website; 2. Use Mega 11 software to align the nucleotide sequences, and use Primer Select software to design primers and probes for the Simian vacuolating virus 40 SV40 ori gene, Molluscum contagiosum virus MC031L gene, Merkel cell polyomavirus LTAg gene, BK virus VP2 gene, and circovirus ORF1 gene respectively; 3. Online BLAST evaluation of primers and probes: For the nucleotide sequences of the primers and probes preliminarily designed, use the BLAST search function in the NCBI website to perform alignment again, and select the primer and probe sequences with high specificity. The primers and probes are synthesized by Sangon Biotech Co., Ltd.; The nucleotide sequences of the specific primers and probes for five DNA viruses related to infectious infertility and sterility (SV40, MCV, MCPyV, BKV, TTV) are shown in Table 2; Table 2 Specific primers for five DNA viruses related to infectious infertility and sterility .

[0019] Example 2: Establishment of multiplex fluorescence quantitative PCR method 1. Construction and verification of plasmids The highly conserved nucleotide sequences of Simian vacuolating virus 40 and Molluscum contagiosum virus were ligated to the pUC57 vector to synthesize the positive plasmid GD2P3 (SEQ ID NO:1); the highly conserved nucleotide sequences of Merkel cell polyomavirus and BK virus were ligated to the pUC57 vector to synthesize the positive plasmid GD2P4 (SEQ ID NO:2), and the highly conserved nucleotide sequence of Torque teno virus was ligated to the pUC57 vector to synthesize the positive plasmid GD2P5 (SEQ ID NO:3). The plasmid construction was completed by Sangon Biotech Co., Ltd. After activating the synthesized plasmid glycerol bacteria, the plasmid was extracted and sequenced for verification. The concentration was measured by an ultraviolet spectrophotometer, and the copy number of the plasmid was calculated based on the length and concentration of each plasmid. The copy number results are shown in Table 3; Table 3 Results of plasmid copy number ; 2. Optimization of fluorescence quantitative reaction system (1) Optimization of multiplex fluorescence quantitative PCR reaction system Using the upstream and downstream primer asymmetry method, the final concentrations of the upstream primers of each target gene in the reaction system were set to 40 nM, 60 nM, 80 nM, 100 nM respectively, and the final concentrations of the downstream primers in the reaction system were set to 20 nM, 40 nM, 60 nM, 80 nM, 100 nM respectively. The "matrix method" was used to optimize the primer concentration. The Ct value and Std value results are shown in Table 4; the final concentrations of the probes in the reaction system were 20 nM, 40 nM, 60 nM, 80 nM, 100 nM respectively to optimize the probe concentration. The Ct value and Std value results are shown in Table 5. Three replicates were set for each gradient, and the average Ct value and Std value were calculated. According to the principles of relatively small Ct value, good amplification curve and in an "S" shape, high and concentrated fluorescence intensity, and the least primer dimers, etc., the optimal concentrations of the upstream and downstream primers in the reaction system were determined to be 60 nM; the optimal probe concentration was 80 nM; The final multiplex fluorescence quantitative PCR reaction system was determined as follows: Premix Ex Taq (Probe qPCR) (2×) 10 μL, 0.6 μL each of SV40-F / R, 0.6 μL each of MCV-F / R, 0.6 μL each of MCPyV-F / R, 0.6 μL each of BKV-F / R, 0.6 μL each of TTV-F / R, 0.8 μL of SV40-P, 0.8 μL of MCV-P, 0.8 μL of MCPyV-P, 0.8 μL of BKV-P, 0.8 μL of TTV-P, 1 μL of template, and made up to 20 μL with water; The multiplex fluorescence quantitative PCR reaction program was: pre-denaturation at 95 °C for 30 s; denaturation at 95 °C for 5 s, annealing and extension at 56 °C for 30 s, for 40 cycles.

[0020] Table 4 Results of final concentrations of upstream and downstream primers

[0021] Table 5 Results of final concentration of probe 。

[0022] Example 3: Evaluation of specificity, sensitivity and repeatability of primer-probe multiplex fluorescence quantitative PCR of the present invention 1. Verification of specificity of multiplex fluorescence quantitative PCR Select 9 DNA viruses (Herpes simplex virus type 1 HSV-1, Herpes simplex virus type 2 HSV-2, Varicella-zoster virus VZV, Human herpesvirus EDV, Cytomegalovirus CMV, Human papillomavirus type 6 HHV-6, Human papillomavirus type 7 HHV-7, Kaposi's sarcoma-associated herpesvirus KSHV, Hepatitis B virus HBV); select 9 RNA viruses (Hepatitis C virus HCV, Hepatitis E virus HEV, Hepatitis G virus HGV, Dengue virus type 4 DENV-4, Coxsackievirus type A8 CVA8, Coxsackievirus type A16 CVA16, Human immunodeficiency virus HIV, Echovirus ECHO, Human rhinovirus HRV) as specific detection pathogens; use the above virus genomic extracts and the 10 6 copies / μL plasmid standard prepared in Example 2 as templates to verify the specificity of the multiplex fluorescence quantitative detection method. The reaction system and reaction procedure are the same as in Example 2; The results are as Figure 1 shown. The primers and probes of the present invention can only have amplification curves when detecting plasmid standards of Simian vacuolating virus 40 (SV40), Molluscum contagiosum virus (MCV), Merkel cell polyomavirus (MCPyV), BK virus (BKV), and Torque teno virus (TTV). There is no amplification for the remaining viruses, indicating that there is no cross-reaction between the detection primers and probes of each DNA virus and other virus nucleic acid templates, and the specificity of this method is good.

[0023] 2. Verification of linear range of multiplex fluorescence quantitative PCR The positive plasmid standard was serially diluted by 10-fold gradient dilution to 10 7 copies / μL, 10 6 copies / μL, 10 5 copies μL, 10 4 copies / μL, 10 3 copies / μL. Sterile water was used as a negative control. Specific primers and probes for five DNAs were used respectively to verify the linear range of the multiplex fluorescence quantitative PCR detection method according to the reaction system and procedure in Example 2.

[0024] The results are as Figures 2 - 6 shown. It can be seen from the figure that the amplification efficiency is close to 100%; the consistency of the amplification efficiency is verified, and the efficiency deviation caused by factors such as inhibitors and primer dimers is excluded; it is ensured that when the Ct value of the subsequent detected unknown sample falls within the linear range, the calculation result is credible; a standard curve is established with the logarithm of the template concentration as the abscissa and the cycle number (Ct value) as the ordinate, as Figures 7 - 11 shown. The standard curve constructed based on the highly conserved sequence of simian virus 40 has an amplification efficiency of 95.78%, and the R 2 is 0.9998, indicating a good linear relationship; the standard curve constructed based on the highly conserved sequence of molluscum contagiosum virus has an amplification efficiency of 95.41%, and the R 2 is 1, indicating a good linear relationship; the standard curve constructed based on the highly conserved sequence of Merkel cell polyomavirus has an amplification efficiency of 93.53%, and the R 2 is 0.9999; indicating a good linear relationship; the standard curve constructed based on the highly conserved sequence of BK virus has an amplification efficiency of 108.2%, and the R 2 is 0.9988; indicating a good linear relationship; the standard curve constructed based on the highly conserved sequence of circovirus has an amplification efficiency of 93.51%, and the R 2 is 0.9991; indicating a good linear relationship.

[0025] 3. Evaluation of the sensitivity of multiplex fluorescence quantitative PCR Using the positive plasmid standard products with four gradients of 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, and 10 0 copies / μL as templates, and sterile water as the negative control, 20 repeated experiments were carried out respectively using the multiplex fluorescence quantitative PCR detection method according to the reaction system and reaction procedure in Example 2. If the detection rate can stably reach more than 95%, then it is finally determined as the lowest detection limit; The results are shown in Table 6. The lowest detection limit of the detection system of multiplex fluorescence quantitative PCR for the five DNA viruses is 10 copies / μL; Table 6 Verification results of the sensitivity of multiplex fluorescence quantitative PCR ; 4. Evaluation of the repeatability of multiplex fluorescence quantitative PCR

[0026] To verify the repeatability of the multiplex qPCR detection method, a concentration gradient of 10 6-10 1 Plasmid standards at -10 copies / μL were used as positive templates. For each template, three replicates were performed for intra-batch replication experiments for three consecutive days, and three replicates were performed for inter-batch replication experiments. The coefficient of variation (CV%) within and between batches was calculated based on the Ct values to evaluate the repeatability and reproducibility of the method. The results of the repeatability test are shown in Table 7. The results indicate that the coefficient of variation CV < 2%, demonstrating good repeatability and reproducibility of the present invention. Table 7 Results of the verification of the repeatability of multiplex fluorescence quantitative PCR 。

[0027] Example 4: Detection of clinical samples by multiplex fluorescence quantitative PCR Collect 1 mL of whole blood from 660 infertile clinical patients into sterile EP tubes. Carefully check the patient information, make good marks, register them, store them at 4°C throughout the transportation process, and store the samples at -80 °C until nucleic acid extraction. 1. Nucleic acid extraction The genomic DNA / RNA extraction kit from Tiangen was used to extract DNA. The specific operation steps are as follows: a. Preparation before the experiment: Before using the genomic DNA / RNA extraction kit from Tiangen, add 70 mL and 17 mL of absolute ethanol to the wash buffer PW and buffer GD respectively. b. Sample aliquoting: Aliquot 200 μL of blood into a new EP tube and add 20 μL of Protein K. c. Add the prepared 200 μL of Carrier RNA working solution to the EP tube, vortex for 15 min at 56°C, briefly centrifuge, add 250 μL of absolute ethanol, vortex for 15 sec, and then let it stand for 5 min. At this time, flocculent precipitates will be formed. d. Transfer the flocculent precipitate and solution mixture to the adsorption column, centrifuge at 8000 rpm for 1 min, discard the waste liquid, add 500 μL of buffer GD, centrifuge at 8000 rpm for 1 min, and discard the waste liquid. Place the adsorption column in the collection tube. e. Add 600 μL of wash buffer PW, let it stand for 2 min, centrifuge at 8000 rpm for 1 min, and discard the waste liquid. Repeat this step twice. f. Add 500 μL of absolute ethanol, centrifuge at 8000 rpm for 1 min, discard the waste liquid, then centrifuge at 12000 rpm for 3 min, and discard the waste liquid. h. Place the adsorption column into a new enzyme-free centrifuge tube. Drop 45 μL of RNase-Free ddH2O onto the middle position of the adsorption membrane in a suspended manner. After standing at room temperature for 5 min, centrifuge at 12,000 rpm for 3 min to collect the nucleic acid solution at the bottom of the tube. Aliquot according to the experimental situation and store at -20°C for later use.

[0028] 2. Multiplex fluorescence quantitative PCR detection Use the nucleic acid extracted in step 2 as a template. The reaction system refers to Example 2. The amplification program is: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 56°C for 30 s, for 40 cycles, and collect fluorescence during the extension stage of each cycle.

[0029] Detect 330 male and 330 female blood samples. Set negative controls as NTC (no-template negative) and NSC (blank control), with two replicates; at the same time, set a positive control as pentaplex positive plasmid 10 8 、10 5 、10 1 , and the detection results are shown in Table 8 below. Two of the five viruses were detected in the blood samples of infertile women. The detection of positive samples is as follows: the detection rate of MCV is 0.15% (5 / 330); the detection rate of BKV is 0.12% (5 / 330). One of the five viruses was detected in the blood samples of infertile men. The detection of positive samples is as follows: the detection rate of TTV is 0.09% (3 / 330).

[0030] Table 8 Multiplex fluorescence quantitative PCR positive results ; Perform nested PCR amplification on the positive samples of MCV, BKV, and TTV obtained from the above detection to amplify the MC031L region fragment (1337 bp) of MCV, the VP2 region fragment (1055 bp) of BKV, and the ORF1 region fragment (667 bp) of TTV. The amplification primers are shown in Table 9; Table 9 ; The reaction system is shown in Table 10: Table 10

[0031] The reaction conditions are 95°C for 5 min; 95°C for 30 s, 50°C for 30 s, 72°C for 3 min, for 40 cycles; 72°C for 7 min; The results showed that the fragment sizes were all consistent with the target fragment size. The PCR products with target bands were subjected to Sanger sequencing. The Sanger sequencing results of the PCR products in the MC031L region, the VP2 region, and the ORF1 region were as Figure 12 shown. The sequencing result peak maps were single and complete. The blast analysis results using the sequencing results were as Figure 13 shown, indicating strong homology; it shows that the positive samples detected by the multiplex fluorescence quantitative PCR of the present invention are the expected target gene fragments (the MCO31L region of MCV, the VP2 region of BKV, and the ORF1 region of TTV).

[0032] In summary, the detection method of the present invention has the advantages of high sensitivity, strong specificity, good repeatability, and simple operation. It can detect five viruses, namely SV40, MCV, MCPyV, BKV, and TTV, simultaneously, quickly, and accurately, improving the clinical screening speed of the five viruses and saving the detection cost.

Claims

1. A multiplex fluorescence quantitative PCR reagent for synchronously detecting five DNA viruses related to infertility, characterized in that: Including specific primers and probes for simian virus 40, molluscum contagiosum virus, Merkel cell polyomavirus, BK virus, and circovirus; The specific primers for simian virus 40 are AGTCTTTTTGTCTTTTATTTCAGGTC and GCCTTCAACAGTAGCAACAGATG, and the probe is AAGCTGCTGCTGCTACTGGATTTTCAG; The specific primers for molluscum contagiosum virus are AGAGCATCTTGAGCGTRTTCAT and CCTACCTCAAGAGYTACATCGTCAT, and the probe is CAAGGTGCTGGTGGACAACATCTACATCAT; The specific primers for Merkel cell polyomavirus are GTGCATGCTTAAGCAACTTAGAGATTC and AGATGCAGTAAGCAGTAGTCAGTTTCTTCT, and the probe is TTTGCTATCAGTGCTTTATTCTTTGGTTTGGATTTC; The specific primers for BK virus are CTGCTCTAGCACTTTTGGGGGAC and GCAAGGGATGCAATTTGAACTTCTAT, and the probe is CTGCTGCTGCCACAGGATTTTCAGTG; The specific primers for circovirus are CYGWGGGCGGGWGCCGDA and GCCWGWCCCGWGCCCGA, and the probe is CAAGGTGCTGGTGGACAACATCTACATCAT.

Images