Novel polynucleotide and method for producing l-alanine using same

Abstract

The present invention relates to a novel polynucleotide and a method for producing L-alanine using the same. The microorganism incorporating the novel polynucleotide in which the specific position of the promoter region of the alaT-encoding gene is changed according to the present invention exhibits a significantly increased ability to produce L-alanine, and thus the novel polynucleotide can be effectively used for the effective production of L-alanine.

Description

Technical Field

[0001] Cross - reference to related applications

[0002] This application claims the benefit of priority based on Korean Patent Application No. 10-2022-0190977, filed on December 30, 2022, and the entire contents disclosed in the document of the corresponding Korean patent application are incorporated as part of this specification.

[0003] The present invention relates to novel polynucleotides and a method for producing L-alanine using the same, and more particularly, to novel polynucleotides, recombinant vectors containing the polynucleotides, host cells transformed with the vectors, and a method for producing L-alanine using the host cells. Background Art

[0004] L-alanine is a colorless or white amino acid crystal, odorless but with a unique sweet taste, and is widely used in fields such as chemistry, food, and medicine. In the food industry, it enhances umami and has various physiological functions, such as promoting alcohol metabolism, protecting liver function, and promoting insulin secretion. Compared with other amino acids, L-alanine has the function of inhibiting the browning reaction, so it is used as an acidity regulator and is used in various ways, such as drugs for prostatic hypertrophy and sports products. Based on 2020, the annual production of alanine is approximately 500 tons, and the market size is estimated to be $250 million or more.

[0005] Most food additives or coloring additives are obtained by extraction from natural resources, chemical synthesis, or biological production, and L-alanine is mainly produced by chemical synthesis or enzymatic conversion. Recently, with the change in consumers' awareness of a healthy lifestyle, although natural substances are more expensive due to low production, they are still more favored than artificial products. Therefore, in addition to methods for producing petroleum-derived L-alanine, various studies have been conducted, for example, efforts have been made to develop microorganisms or fermentation process technologies for producing high-concentration amino acids.

[0006] Common methods for producing L-alanine include methods of fermentation using microorganisms such as Corynebacterium, Escherichia coli, Brevibacterium, Lactobacillussp., etc. (US 5559016 A).

[0007] However, with the increasing demand for L-alanine, the need to study more effectively producing high-concentration L-alanine has emerged.

[0008] Accordingly, as a result of developing a microorganism for producing high-concentration L-alanine, the present inventors have developed a new polynucleotide in which a specific position in the promoter region of the gene encoding alaT is mutated; and it has been confirmed that the production of L-alanine can be improved by using this polynucleotide, thereby completing the present invention. Summary of the Invention

[0009] [Technical Problem]

[0010] One embodiment of the present invention provides a polynucleotide in which, based on the nucleotide sequence represented by SEQ ID NO:2, the nucleotides corresponding to positions 88 and 90 are each replaced with T, and the nucleotide corresponding to position 91 is replaced with A.

[0011] Another embodiment of the present invention provides a vector containing this polynucleotide; and a vector containing a gene encoding a target protein operably linked to this polynucleotide.

[0012] Other embodiments of the present invention provide a host cell containing this polynucleotide; and a vector containing a gene encoding a target protein operably linked to this polynucleotide.

[0013] Other embodiments of the present invention provide a method for producing an amino acid, which includes culturing this host cell in a medium.

[0014] Other embodiments of the present invention provide a composition for producing an amino acid containing a host cell.

[0015] Other embodiments of the present invention provide the use of a polynucleotide, a vector containing this polynucleotide, or a host cell containing this vector for producing an amino acid, in which, based on the nucleotide sequence represented by SEQ ID NO:2, the nucleotides corresponding to positions 88 and 90 are each replaced with T, and the nucleotide corresponding to position 91 is replaced with A.

[0016] [Technical Solution]

[0017] The detailed explanation is as follows. On the other hand, each description and embodiment disclosed in the present invention can be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. In addition, the scope of the present application should not be considered limited to the specific descriptions described below.

[0018] The present invention provides a polynucleotide in which, based on the nucleotide sequence represented by SEQ ID NO:2, the nucleotides corresponding to positions 88 and 90 are each replaced with T, and the nucleotide corresponding to position 91 is replaced with A.

[0019] In this specification, the term "nucleotide sequence represented by SEQ ID NO:2" may refer to a part of the promoter sequence of the gene encoding aminotransferase.

[0020] In this specification, the term "aminotransferase" may be used interchangeably with "transaminase" and refers to an enzyme having the function of reversibly producing L-alanine from pyruvate. The use of the cofactor L-valine at that time may affect the reduction of by-products.

[0021] In this specification, the term "L-alanine" is one of the essential amino acids and refers to the L-amino acid having the chemical formula HO2CCH(NH2)CH3.

[0022] This polynucleotide may have promoter activity.

[0023] In this specification, the term "promoter" refers to the untranslated nucleotide sequence upstream of the coding region, which contains a binding site for polymerase and has transcriptional initiation activity for the mRNA of the promoter target gene, that is, the DNA region that binds polymerase to initiate gene transcription. The promoter may be located at the 5'-site of the mRNA transcription start site. Subsequently, the target gene of the promoter may be the gene encoding aminotransferase, but is not limited thereto.

[0024] The polynucleotide of the present invention is a part of the nucleotide sequence represented by SEQ ID NO:2, that is, the promoter sequence of the gene encoding aminotransferase, which has mutated, and specifically, the mutation may be that the nucleotides corresponding to the 88th and 90th positions of the sequence are respectively replaced by T, and the nucleotide corresponding to the 91st position is replaced by A. Therefore, this polynucleotide may consist of the nucleotide sequence of SEQ ID NO:1.

[0025] The term "mutation" refers to a genetically or non-genetically stable phenotypic change, and in this specification, it may be designated by being used interchangeably with "mutant".

[0026] Specifically, this polynucleotide may have increased promoter activity compared to the polynucleotide without mutation (wild-type polynucleotide). Therefore, this polynucleotide can control (increase) the expression of the target gene operably linked to this polynucleotide and the activity of the protein encoded by the target gene. In addition, it can control the expression of genes other than the target gene.

[0027] This polynucleotide can have the activity of improving the amino acid production ability (yield) of the host cell, such as the L-alanine production ability (yield) by being introduced into an appropriate host cell. Therefore, this polynucleotide can be used to improve the amino acid production ability (yield), and specifically, it can be used to improve the L-alanine production ability (yield).

[0028] Specifically, the polynucleotide may consist of the nucleotide sequence of SEQ ID NO:1.

[0029] In addition, the nucleotide sequence of the present invention can be modified by conventionally known mutagenesis, such as direct evolution and site-directed mutagenesis, etc.

[0030] Therefore, the polynucleotide may include the following polynucleotides: polynucleotides containing a nucleotide sequence having at least 60% or higher, specifically 70% or higher, more specifically 80% or higher, more specifically 83% or higher, 84% or higher, 88% or higher, 90% or higher, 93% or higher, 95% or higher or 97% or higher homology with the nucleotide sequence of SEQ ID NO:1. As long as it is a sequence homologous to this sequence, and it is a polynucleotide sequence having substantially the same or corresponding biological activity (promoter activity) and / or the required activity (such as the activity of increasing the production of L-alanine in host cells), even if there are cases of deletion, modification, substitution or addition of some sequences in the polynucleotide sequence, it can be included within the scope of this application.

[0031] In this specification, the term "identity (or homology)" refers to the degree corresponding to a specified nucleic acid sequence or amino acid sequence, and can be expressed as a percentage (%). In the case of homology with nucleic acids, the well-documented algorithms BLAST (see: Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873, 1993) or Pearson's FASTA (see: Methods Enzymol., 183, 63, 1990) can be used for determination. Based on this algorithm BLAST, programs named BLASTN or BLASTX have been developed (see: http: / / www.ncbi.nlm.nih.gov).

[0032] In one embodiment, a polynucleotide comprising a specific nucleic acid sequence provided in this specification can be interpreted as comprising a polynucleotide fragment that not only contains the specific nucleic acid sequence or a nucleic acid sequence substantially equivalent thereto, but also contains a nucleic acid sequence complementary to the specific nucleic acid sequence. Specifically, the complementary polynucleotide can hybridize at a Tm value that can be appropriately adjusted by those skilled in the art according to the purpose. For example, the Tm value is 55 °C, 60 °C, 63 °C or 65 °C; and the complementary polynucleotide can be analyzed under the conditions described below: These conditions are specifically described in known literature. For example, the following conditions can be listed: Conditions that allow genes with high complementarity of 60% or higher, 70% or higher, 80% or higher, 85% or higher, 90% or higher, 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, 99.5% or higher or 99.9% or higher to hybridize and genes with complementarity lower than the above not to hybridize, or conditions for washing once, specifically twice or three times, at a salt concentration and temperature corresponding to the following: 60 °C, 1×SSC (saline-sodium citrate buffer) and 0.1% (w / v) SDS (sodium dodecyl sulfate); 60 °C, 0.1×SSC and 0.1% SDS; or 68 °C, 0.1×SSC and 0.1% SDS, which are the washing conditions for general Southern hybridization, and similar conditions, but not limited to this. Hybridization requires two nucleotides to have complementary sequences, but depending on the hybridization stringency, base mismatches are allowed between the bases. The term "complementary" can be used to describe the relationship between nucleobases that can hybridize with each other. For example, in the case of DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. The appropriate stringency for hybridizing a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and this is well known in the relevant art (see Sambrook et al., ibid., 9.50-9.51, 11.7-11.8).

[0033] In particular, when the corresponding polynucleotide is used as a promoter and linked to a target gene, the expression "consisting of the nucleotide sequence of SEQ ID NO:1" does not exclude the cases of addition and / or deletion and / or mutation of nucleotides, which may occur during the process of linking to the target gene using restriction enzymes.

[0034] For example, it can include, but is not limited to, a polynucleotide having biological activity (promoter activity) and / or target activity (such as the activity of increasing the production of L-alanine in a host cell) consisting of the nucleotide sequence represented by SEQ ID NO:1, as long as it is a nucleotide sequence having the biological activity (promoter activity) and / or target activity (such as the activity of increasing L-alanine production) of this application by hybridizing with all or part of the complementary sequence of the nucleotide sequence of SEQ ID NO:1 under stringent conditions.

[0035] In addition, the polynucleotide of the present invention can be operably linked to a gene encoding a target protein.

[0036] In the present specification, the term "gene expression regulatory sequence" refers to a sequence that contains the polynucleotide of the present invention and can express the target gene operably linked thereto.

[0037] In the present specification, the term "operably linked" refers to functionally linking the polynucleotide having promoter activity of the present invention to a gene sequence to initiate and mediate transcription of the target gene. An operable linkage can be prepared using genetic recombination techniques known in the art, and site-specific DNA cleavage and ligation can be constructed using cleavage and ligase enzymes and the like in the art, but are not limited thereto.

[0038] In addition, the gene expression regulatory sequence of the present invention, in addition to the promoter for gene transcription, can further contain any operon sequences for regulating transcription, sequences encoding appropriate mRNA ribosome binding sites, and DNA for regulating transcription and translation termination, etc.

[0039] For example, in addition to the promoter, the regulatory sequence applicable to prokaryotes can further contain a ribosome binding site, but is not limited thereto. If those skilled in the art need it, the polynucleotide having promoter activity of the present invention can constitute the sequence for regulating gene expression described above.

[0040] In the present invention, the target gene refers to a gene encoding a target protein to regulate its expression in microorganisms.

[0041] For example, it can be a gene involved in amino acid production, but is not limited thereto. Specifically, the gene can be a gene encoding an enzyme related to amino acid biosynthesis, but is not limited thereto. More specifically, the gene can be a gene encoding aminotransferase, but is not limited thereto.

[0042] In addition, the present invention provides a vector containing a polynucleotide, in which, based on the nucleotide sequence represented by SEQ ID NO:2, the nucleotides corresponding to the 88th and 90th positions are respectively substituted with T, and the nucleotide corresponding to the 91st position is substituted with A.

[0043] The polynucleotide is as described above.

[0044] The vector can further contain a gene encoding a target protein operably linked to the polynucleotide.

[0045] In this specification, the term "vector" refers to a DNA product that contains the base sequence of a polynucleotide encoding a target protein, which is operably linked to appropriate regulatory sequences so as to express the target protein in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, any operator sequences for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating transcription and / or translation termination. The vector can be transformed into a suitable host cell and then expressed independently of the host cell's genome or integrated into the host cell's genome.

[0046] In the present invention, the vector is not particularly limited as long as it can replicate in the host, and it can be selected from all common vectors. Examples of common vectors may include plasmids, cosmids, viruses, phages, etc. in their natural or recombinant states. For example, as vectors, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc. can be used as phage vectors or cosmid vectors, and vectors based on pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, and pET, etc. can be used as plasmid vectors. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector, etc. can be exemplified, but not limited thereto.

[0047] The available vectors in this specification can be known expression vectors and / or vectors for inserting polynucleotides into the host cell chromosome. Inserting the polynucleotide into the host cell chromosome can be carried out by any method known in the art, such as homologous recombination or the CRISPR system, but not limited thereto. The vector may further contain a selection marker for confirming whether it has been inserted into the chromosome. The selection marker is used to select the cells transformed with the vector, that is, to confirm whether the polynucleotide has been inserted, and it can be selected from genes providing a selective phenotype (such as drug resistance, auxotrophy, tolerance to cytotoxic agents, or expression of surface proteins) and used. In an environment treated with a selection agent, only the cells expressing the selection marker survive or exhibit other phenotypes, so the transformed cells can be selected.

[0048] In addition, the present invention provides a host cell that contains a polynucleotide and a gene encoding a target protein operably linked to the polynucleotide.

[0049] The polynucleotide and the gene encoding the target protein operably linked to the polynucleotide are as described above.

[0050] The host cell can be a microorganism, but not limited thereto.

[0051] In this specification, the term "microorganism" is a concept that includes all wild-type microorganisms or microorganisms in which natural or artificial genetic modifications have occurred, and includes all microorganisms in which a specific mechanism is weakened or strengthened due to reasons such as the insertion of foreign genes or the enhancement or attenuation of the activity of endogenous genes.

[0052] In the present invention, the microorganism may contain polynucleotides, and specifically, may contain polynucleotides and / or a gene encoding a target protein operably linked to the polynucleotide. In addition, the microorganism may contain a vector that contains a polynucleotide or a gene encoding a gene expression regulatory sequence and a target protein, but is not limited thereto. Additionally, the polynucleotide, the gene encoding the target protein, and the vector may be introduced into the microorganism by transformation, but are not limited thereto. Furthermore, as long as the microorganism can express the gene, it does not matter whether the polynucleotide and the gene encoding the target protein are located on the chromosome or outside the chromosome.

[0053] A microorganism containing a polynucleotide and a gene encoding a target protein may have an improved amino acid production ability, and specifically, it may have an improved L-alanine production ability.

[0054] For example, the microorganism may have an enhanced aminotransferase.

[0055] In the present invention, any microorganism that can act as a promoter when a polynucleotide having promoter activity of the present invention is introduced is included without limitation.

[0056] As an example, the microorganism is a cell or microorganism expressing the polynucleotide of the present application, which is transformed with a vector containing the polynucleotide of the present application, and for the purposes of the present application, the microorganism of the present application may include all microorganisms containing the mutation of the present application and capable of producing alanine. For example, the microorganism of the present application may be a recombinant strain having an improved L-alanine production ability because the polynucleotide of the present application is introduced into a natural wild-type microorganism or a microorganism producing L-alanine, and thereby the aminotransferase is enhanced. The recombinant strain having an improved L-alanine production ability may be a microorganism having an improved L-alanine production ability compared to a natural wild-type microorganism or a microorganism unmodified in the promoter region of the gene encoding alaT (i.e., a microorganism expressing the promoter of the wild-type alaT-encoding gene), but is not limited thereto. As an example, a microorganism unmodified in the promoter region of the gene encoding alaT (a target strain for comparing the increase in L-alanine production ability) may be a wild-type Corynebacterium glutamicum strain, and in a specific embodiment, it may be the Corynebacterium glutamicum ATCC13869 strain, but is not limited thereto.

[0057] In one embodiment, compared to the parental strain before mutation or an unmodified microorganism, a microorganism with improved L-alanine production ability can increase the L-alanine productivity (or production ability) to about 1% or higher, about 2.5% or higher, about 5% or higher, about 10% or higher, about 15% or higher, about 20% or higher, about 25% or higher, about 30% or higher, about 35% or higher, about 36% or higher, about 37% or higher, about 38% or higher, about 39% or higher, about 40% or higher, about 41% or higher or about 42% or higher (the upper limit is not particularly limited, and for example, it can be about 200% or lower, about 150% or lower, about 100% or lower, about 50% or lower).

[0058] In another embodiment, compared to the parental strain before mutation or an unmodified microorganism, a microorganism with improved L-alanine production ability can increase the L-alanine productivity (or production ability) to about 1.1-fold or more, about 1.12-fold or more, about 1.13-fold or more, 1.15-fold or more, 1.16-fold or more, 1.17-fold or more, 1.18-fold or more, 1.19-fold or more, about 1.2-fold or more, 1.25-fold or more, about 1.3-fold or more, about 1.35-fold or more, about 1.40-fold or more, about 1.41-fold or more or about 1.42-fold (the upper limit is not particularly limited, and for example, it can be about 10-fold or less, about 5-fold or less, about 3-fold or less or about 2-fold or less), but is not limited thereto. The term "about" includes all ranges of ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values within the same or similar range as the value that appears after the term "about", but is not limited thereto.

[0059] In the present application, an "unmodified microorganism" does not exclude a strain containing mutations that may naturally exist in the microorganism, and can refer to the wild-type strain or the natural strain itself, or the strain before the change in traits due to gene mutations caused by natural or artificial factors. For example, an unmodified microorganism can refer to a strain before the introduction of a polynucleotide with a mutated promoter region of the gene encoding alaT disclosed in this specification or before the introduction of such a polynucleotide. "Unmodified microorganism" can be used interchangeably with "strain before modification", "microorganism before modification", "unmutated strain", "unmodified strain", "unmutated microorganism" or "reference microorganism".

[0060] Specifically, the microorganism can be a Corynebacterium microorganism, and more specifically, it can include Corynebacterium stationis, Corynebacterium thermoaminogenes, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, and strains prepared therefrom, but is not limited thereto. Specifically, it can be a Corynebacterium stationis or Corynebacterium glutamicum strain.

[0061] In addition, the present invention provides a method for producing an amino acid, which includes culturing a host cell containing a polynucleotide in a culture medium, in which, based on the nucleotide sequence represented by SEQ ID NO:2, the nucleotides corresponding to positions 88 and 90 are respectively substituted with T, and the nucleotide corresponding to position 91 is substituted with A.

[0062] The polynucleotide and the host cell are as described above.

[0063] The method may further include recovering the amino acid from the cultured microorganism, the culture product, or both after the culturing.

[0064] The amino acid can be L-alanine, but is not limited thereto.

[0065] In the present specification, the term "culturing" refers to growing a microorganism under appropriately artificially adjusted environmental conditions. The method for culturing the microorganism of the present invention can be carried out using the culturing methods of Corynebacterium glutamicum widely known in the art. Specifically, examples of the culturing method include batch culturing, continuous culturing, and fed-batch culturing, but are not limited thereto. These various methods are disclosed in, for example, "Biochemical Engineering" (James M. Lee, Prentice-Hall International Editions, pages 138-176, 1991), etc.

[0066] In the present specification, the term "culture product" refers to a substance containing a culture medium in which a microorganism grows or has grown under appropriately artificially adjusted environmental conditions. In a narrow sense, the grown microorganism is not included in the culture product, but it can be included in a broad sense. The "culture product" contains various substances secreted by the microorganism during the growth of the microorganism together with the components of the culture medium for culturing the microorganism, and specifically, contains the target substance L-alanine.

[0067] The culture medium for cultivation should meet the requirements of specific strains in an appropriate manner. Culture media for Corynebacterium strains are known. For example, the microorganisms of the present application can be cultured under aerobic conditions in a general medium containing suitable carbon sources, nitrogen sources, vitamins, etc., while adjusting the temperature, pH, etc. At this time, the carbon sources include carbohydrates such as glucose, fructose, and sucrose; amino acids such as glutamic acid, cysteine, etc. Specifically, natural organic nutrients such as starch hydrolysis products and molasses can be used, and preferably, the natural organic nutrients are carbohydrates such as glucose, fructose, sterilized pretreated molasses (i.e., molasses converted into reducing sugars), etc., and appropriate amounts of other carbon sources can be used in various ways without limitation, but are not limited thereto. As the nitrogen source, inorganic nitrogen sources such as ammonia can be used; and organic nitrogen sources such as amino acids such as glutamic acid and cysteine; and peptone, meat extract, yeast extract, etc. These nitrogen sources can be used alone or in combination, but are not limited thereto. In the culture medium, as the phosphorus source, phosphoric acid, potassium dihydrogen phosphate, or dipotassium hydrogen phosphate or the corresponding sodium salts can be used, but are not limited thereto. As inorganic compounds, magnesium sulfate, ferric sulfate, manganese sulfate, calcium chloride, etc. can be used, and in addition, amino acids, vitamins, and appropriate precursors, etc. can be included. These media or precursors can be added to the culture product by batch or continuous methods, but are not limited thereto.

[0068] During cultivation, the pH of the culture product can be adjusted by adding compounds such as potassium hydroxide, ammonia, and phosphoric acid to the culture product in an appropriate manner. In addition, during cultivation, antifoaming agents such as fatty acid polyethylene glycol esters can be used to inhibit foam generation. Furthermore, in order to maintain the aerobic state of the culture product, oxygen or oxygen-containing gas can be injected into the culture product. The temperature of the culture product can be 27 °C to 37 °C, specifically, 30 °C to 33 °C. The cultivation period can continue until the yield of the desired useful substance is obtained, and specifically, it is 20 to 120 hours.

[0069] The recovered amino acid can be collected from the culture medium, culture solution, or microorganism according to the cultivation method using appropriate methods known in the art. For example, the recovery can be carried out by at least one method selected from the following: centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc., but is not limited thereto. The method for producing amino acids may additionally include a purification step before, during, or after the recovery.

[0070] [Advantageous Effects]

[0071] The present invention relates to new polynucleotides and a method for producing L-alanine using the polynucleotides, and microorganisms into which new polynucleotides are introduced at specific positions in the promoter region of the gene encoding alaT of the present invention have a significantly increased L-alanine production ability. Therefore, the new polynucleotides can be effectively used for the production of L-alanine. Detailed Embodiments

[0072] In the following, the present invention will be described in more detail by way of the following examples. However, these examples are only intended to illustrate the present invention, but the scope of the present invention is not limited by these examples.

[0073] Example 1. Construction of a strain with mutations introduced into the promoter region of the alaT gene

[0074] Construct a mutant strain in which the 88th nucleotide C is replaced by T, the 90th nucleotide A is replaced by T, and the 91st nucleotide C is replaced by A in the promoter sequence of the alaT gene.

[0075] Specifically, in order to introduce mutations into wild-type Corynebacterium glutamicum (ATCC13869) (in the promoter region represented by SEQ ID NO: 2, replacing the 88th nucleotide C with T, the 90th nucleotide A with T, and the 91st nucleotide C with A), gene fragments containing the corresponding mutations were obtained by PCR using each primer pair of SEQ ID NO: 3 and SEQ ID NO: 4 and SEQ ID NO: 5 and SEQ ID NO: 6. The PCR conditions were carried out by denaturing at 95°C for 5 minutes, and then repeating the following 30 times: denaturing at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerizing at 72°C for 30 seconds, and then polymerizing at 72°C for 5 minutes. More specifically, a 500-bp polynucleotide amplified by the primers of SEQ ID NO: 3 and SEQ ID NO: 4 and a 500-bp polynucleotide amplified by the primers of SEQ ID NO: 5 and SEQ ID NO: 6 were obtained. The two gene fragments obtained were ligated to pDCM2 digested with restriction enzymes BamHI and SalI (Korean Patent Publication No. 10-2020-0136813) using infusion enzyme to construct a gene replacement vector containing the alaT promoter mutation, and this was named pDCM2-Pm_alaT. Information on the primer sequences for constructing the vector is shown in Table 1 below.

[0076] [Table 1]

[0077] SEQ ID NO: Primer name Sequence (5'->3') 3 alaT_AF CTCGGTACCCGGGGATCCACAGCCTGGTCGCAGTCC 4 alaT_AR GTCTGTAGTCATCCGCTCAATTTTGCCACTTTGTGT 5 alaT_BF ACACAAAGTGGCAAAATTGAGCGGATGACTACAGACA 6 alaT_BR GCATGCCTGCAGGTCGACGTTGGCGATCATGTCACG

[0078] The vector was transformed into Corynebacterium glutamicum ATCC13869 by electroporation (Appl. Microbiol. Biotechnol., 1999), and it was subsequently spread on a complex plate medium containing 25 mg / L kanamycin to immobilize colonies. Thereafter, through a conventional secondary hybridization process, the final strain containing the corresponding mutation and free of the introduced vector was obtained. Using the primer pair of SEQ ID NO:7 (5'-ACGTCAAAGCCTGTGCATC-3') and SEQ ID NO:8 (5'-CAGCACGTCCTTCATCTTCTC-3'), the strain into which the corresponding mutation was introduced was finally confirmed by gene sequence analysis. The strain into which the target mutation was introduced was named CJ0021.

[0079] Example 2. Confirmation of L-alanine production by the strain into which a new promoter mutant gene was introduced

[0080] To compare the L-alanine production ability of the mutant strain CJ0021 constructed in Example 1 with that of the wild-type Corynebacterium glutamicum ATCC13869 strain, it was cultured by the following method.

[0081] Specifically, after inoculating the parental strain Corynebacterium glutamicum ATCC 13869 strain and the mutant strain CJ0021 strain into 250 mm angled baffled flasks containing 25 ml of production medium, they were cultured at 30 °C at 200 rpm for 46 hours.

[0082] After the cultivation was completed, the L-alanine concentration in each medium was measured using high-performance liquid chromatography, and the L-alanine concentration in the culture solution for each test strain is shown in Table 2 below.

[0083] [Table 2]

[0084] Comparison of L-alanine production ability between Corynebacterium glutamicum ATCC13869 strain and Corynebacterium glutamicum CJ0021 strain

[0085]

[0086] As a result, as shown in Table 2, it was confirmed that the Corynebacterium glutamicum CJ0021 strain into which the mutation was introduced produced L-alanine at a concentration of 8.4 g / L, and had an L-alanine production ability of approximately 142% compared to the parental strain.

[0087] The above results indicate that mutations in the sequence of the promoter region represented by SEQ ID NO:2, namely, the substitution of nucleotide C at position 88 with T, the substitution of nucleotide A at position 90 with T, and the substitution of nucleotide C at position 91 with A, significantly improve the L-alanine production ability of the microorganism, and in the sequence of the promoter region represented by SEQ ID NO:2, the promoter with nucleotide C at position 88 substituted with T, nucleotide A at position 90 substituted with T, and nucleotide C at position 91 substituted with A can be effectively used in the method for producing L-alanine.

[0088] The composition of the medium used in Example 2 is as follows.

[0089] <Activation medium>

[0090] Beef extract 5 g / L, polypeptone 10 g / L, yeast extract 5 g / L, urea 2 g / L, sodium chloride (NaCl) 2.5 g / L, agar 20 g / L, glucose 10 g / L, 10N sodium hydroxide (NaOH)

[0091] <Seed medium>

[0092] Glucose (anhydrous glucose) 20 g / L, polypeptone 10 g / L, yeast extract 10 g / L, ammonium sulfate [(NH4)2SO4] 10 g / L, urea 1.5 g / L, potassium dihydrogen phosphate (KH2PO4) 5.2 g / L, dipotassium hydrogen phosphate (K2HPO4) 10.7 g / L, d-biotin 1.8 mg / L, thiamine hydrochloride 9 mg / L, CAPA 9 mg / L, NCA 60 mg / L, magnesium sulfate (MgSO4) 0.5 g / L

[0093] <Production medium>

[0094] Calcium carbonate (CaCO3) 30 g / L, sucrose 57 g / L, BM 6 g / L, magnesium sulfate (MgSO4) 0.5 g / L, (NH4)2SO4 50 g / L, KH2PO4 1 g / L, yeast extract 2 g / L, ammonium acetate 6.28 g / L, d-biotin 0.05 mg / L, thiamine hydrochloride 0.1 mg / L, MnSO4 6.7 mg / L, FeSO4 10 mg / L.

Claims

1. A polynucleotide, wherein based on the nucleotide sequence represented by SEQ ID NO:2, the nucleotides corresponding to positions 88 and 90 are respectively substituted with T, and the nucleotide corresponding to position 91 is substituted with A.

2. The polynucleotide according to claim 1, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO:

1.

3. The polynucleotide according to claim 1 or 2, wherein the polynucleotide has promoter activity.

4. A recombinant vector, which comprises the polynucleotide according to claim 3; and a gene encoding a target protein operably linked to the polynucleotide.

5. The recombinant vector according to claim 4, wherein the target protein is an aminotransferase.

6. A Corynebacterium microorganism, which comprises the polynucleotide according to claim 3; and a gene encoding a target protein operably linked to the polynucleotide.

7. The Corynebacterium microorganism according to claim 6, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO:

1.

8. The Corynebacterium microorganism according to claim 6, wherein the target protein is an aminotransferase.

9. The Corynebacterium microorganism according to any one of claims 6 to 8, wherein the Corynebacterium microorganism is Corynebacterium glutamicum.

10. A method for producing an amino acid, which comprises culturing the Corynebacterium microorganism according to any one of claims 6 to 8 in a culture medium.

11. The method for producing an amino acid according to claim 10, wherein the amino acid is L-alanine.

12. A composition for producing an amino acid, which comprises the Corynebacterium microorganism according to any one of claims 6 to 8.

13. The composition for producing an amino acid according to claim 12, wherein the amino acid is L-alanine.

Images