Gene miR-202-3p related to diagnosis and treatment of rheumatoid arthritis as well as mimics and application of gene miR-202-3p
By transfecting miR-202-3p mimics in rheumatoid arthritis cells, regulating GLI1 protein expression and inhibiting the Sonic Hedgehog signaling pathway, the side effects and recurrence problems of existing RA treatment were solved, and safe and efficient RA treatment effects were achieved.
Patent Information
- Application Number
- CN202510422400.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-07-22
AI Technical Summary
There are problems such as large side effects of systemic medication, inefficacy or high recurrence rates in existing RA treatments. Find effective molecular tools to downregulate GLI1 to inhibit the over-activation of the Sonic Hedgehog signaling pathway, thereby alleviating the symptoms of rheumatoid arthritis.
By transfecting miR-202-3p mimics in rheumatoid arthritis cells, the expression or activity of miR-202-3p gene is increased, and the expression of GLI1 protein is inhibited, thereby regulating the Sonic Hedgehog signaling pathway and inhibiting the proliferation, migration and erosion of RA-FLS.
It significantly reduces the IL6 and MMP3 levels of RA-FLS, improves the apoptosis rate, reduces the symptoms of rheumatoid arthritis, and has better effect on combined medication with methotrexate, with high selectivity and low toxic side effects.
Smart Images

Figure CN120346329A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of biotechnology and therapeutic technology, and in particular to a gene miR-202-3p related to the diagnosis and treatment of rheumatoid arthritis and its mimics and applications. Background Art
[0002] The Sonic Hedgehog (SHH) signaling pathway plays an important role in organ development and cancer development. In recent years, studies have shown that abnormal activation of the SHH signaling pathway is closely related to the onset of rheumatoid arthritis (RA). Previous research results have shown that both RA synovial tissue and RA-FLS primary cells have high expression of SMO and GLI1, key molecules of the SHH signaling pathway. As one of the intranuclear transcription factors of the SHH signaling pathway, GLI1 overexpression promotes the abnormal proliferation and invasion of fibroblast-like synoviocytes (FLS) in RA patients, exacerbating the progression of arthritis. For example, by downregulating the expression of key molecules in the SHH signaling pathway, the "rheumatoid arthritis-like" biological phenotype of RA-FLS can be inhibited and the secretion of inflammatory cytokines can be reduced. Therefore, finding effective molecular tools to downregulate GLI1 can be a new direction for RA therapeutic research.
[0003] Micro RNA (miRNA) is a non-coding small molecule RNA that binds to target mRNA through base pairing, resulting in degradation or translation inhibition of target mRNA, thereby regulating gene expression in the post-transcriptional state. There are a large number of miRNAs in mammals and they are involved in complex physiological and pathological processes. miRNAs often form mutually binding regulatory chains with mRNA and LncRNA (long non-coding RNA, another type of non-coding RNA).
[0004] The current treatment of RA has limitations. Even though RA treatment has entered the era of targeted treatment, there are still many unmet clinical needs, such as systemic medications with large side effects, non-response or high relapse rates. Therefore, seeking a miRNA mimic based on targeting GLI1 to alleviate the symptoms of RA by inhibiting the over-activation of the Sonic Hedgehog signaling pathway has become a technical problem that needs to be solved in this field. Summary of the invention
[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a gene miR-202-3p related to the diagnosis and treatment of rheumatoid arthritis and its mimics and applications.
[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0007] In a first aspect, the present invention provides an application of a substance that enhances the expression of miR-202-3p gene in the preparation of a product for treating rheumatoid arthritis; or, an application of a substance that increases the content and / or activity of miR-202-3p in the preparation of a product for treating rheumatoid arthritis; or, an application of miR-202-3p mimics in the preparation of a product for treating rheumatoid arthritis.
[0008] The present invention discovers that the expression level of miR-202-3p gene is low in rheumatoid arthritis cells. By transfecting miR-202-3p mimics into rheumatoid arthritis cells to increase the expression level or activity of miR-202-3p gene in these cells, the proliferation, migration and invasion phenotypes of rheumatoid arthritis cells can be inhibited, thereby achieving the purpose of treating rheumatoid arthritis.
[0009] In a second aspect, the present invention provides an application of a substance that enhances the expression of miR-202-3p gene in the preparation of a product for inhibiting the proliferation of rheumatoid arthritis cells; or, an application of a substance that increases the content and / or activity of miR-202-3p in the preparation of a product for inhibiting the proliferation of rheumatoid arthritis cells; or, an application of miR-202-3p mimics in the preparation of a product for inhibiting the proliferation of rheumatoid arthritis cells.
[0010] The present invention discovers that the expression level of miR-202-3p gene is low in rheumatoid arthritis cells. By transfecting miR-202-3p mimics into rheumatoid arthritis cells to increase the expression level or activity of miR-202-3p gene in these cells, the proliferation, migration and invasion phenotypes of rheumatoid arthritis cells can be inhibited.
[0011] In a third aspect, the present invention provides an application of a substance that enhances the expression of miR-202-3p gene in the preparation of a product for inhibiting the Sonic Hedgehog signaling pathway; or, an application of a substance that increases the content and / or activity of miR-202-3p in the preparation of a product for inhibiting the Sonic Hedgehog signaling pathway; or, an application of miR-202-3p mimics in the preparation of a product for inhibiting the Sonic Hedgehog signaling pathway.
[0012] The present invention discovers that miR-202-3p is significantly down-regulated in RA-FLS, and miR-202-3p and GLI1 can bind and interact with each other, while GLI1 protein is a key protein regulating the Sonic Hedgehog signaling pathway. Therefore, the Sonic Hedgehog signaling pathway can be regulated by the interaction between miR-202-3p and GLI1 protein, thereby achieving the purpose of inhibiting the proliferation, migration and invasion of rheumatoid arthritis cells.
[0013] In a fourth aspect, the present invention provides the use of a substance that enhances the expression of the miR-202-3p gene in the preparation of a product for inhibiting the expression of the GLI1 protein; or, the use of a substance that increases the content and / or activity of miR-202-3p in the preparation of a product for inhibiting the expression of the GLI1 protein; or, the use of a miR-202-3p mimic in the preparation of a product for inhibiting the expression of the GLI1 protein.
[0014] The present invention discovers that the expression of miR-202-3p is significantly down-regulated in RA-FLS, and miR-202-3p and GLI1 can bind and interact with each other. The GLI1 protein is a key protein that regulates the Sonic Hedgehog signaling pathway. Therefore, by the interaction between miR-202-3p and the GLI1 protein, the expression level of the GLI1 protein can be reduced, thereby inhibiting the over-activation of the Sonic Hedgehog signaling pathway. Thus, the purpose of inhibiting the proliferation, migration, and invasion of rheumatoid arthritis cells is achieved.
[0015] As a preferred embodiment of the present invention, the miR-202-3p mimic is a miRNA that mimics the activity of miR-202-3p.
[0016] As a preferred embodiment of the present invention, the miRNA that mimics the activity of miR-202-3p is formed by annealing a sense strand and an antisense strand; the nucleotide sequence of the sense strand is as shown in SEQ ID No.1, and the nucleotide sequence of the antisense strand is as shown in SEQ ID No.2.
[0017] In a fourth aspect, the present invention provides the use of a substance for detecting the expression of the miR-202-3p gene in the preparation of a product for detecting or diagnosing whether a test sample is rheumatoid arthritis; or, the use of a substance for detecting the expression of the miR-202-3p gene in the preparation of a product for detecting or diagnosing whether a test patient has rheumatoid arthritis; or, the use of a substance for detecting the expression of the miR-202-3p gene in the preparation of a product for detecting or diagnosing whether a test cell is a rheumatoid arthritis cell.
[0018] As a preferred embodiment of the present invention, the substance for detecting the expression of the miR-202-3p gene is a probe for the miR-202-3p gene, and the nucleotide sequence of the probe is as shown in SEQ ID No.5.
[0019] Fifth aspect, the present invention provides a mimic of the gene miR-202-3p related to the diagnosis and treatment of rheumatoid arthritis, and the mimic of the gene miR-202-3p is formed by annealing a sense strand and an antisense strand; the nucleotide sequence of the sense strand is shown as SEQ ID No.1, and the nucleotide sequence of the antisense strand is shown as SEQ ID No.2.
[0020] Sixth aspect, the present invention provides the application of the combination of the mimic of the gene miR-202-3p and methotrexate in the preparation of a drug for treating rheumatoid arthritis.
[0021] The present invention discovers that the combination of the mimic of the gene miR-202-3p and methotrexate for treating rheumatoid arthritis has a better therapeutic effect than using methotrexate and the mimic of miR-202-3p separately.
[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0023] The present invention discovers that in rheumatoid arthritis cells, the expression level of miR-202-3p is low, but the expression level of GLI1 protein is high. At the same time, GLI1 protein is a key protein that regulates the activation of the Sonic Hedgehog signaling pathway. Therefore, the present invention studies the interaction relationship between GLI1 protein and miR-202-3p, and discovers that the expression level of GLI1 protein can be regulated by miR-202-3p, thereby inhibiting the activation of the Sonic Hedgehog signaling pathway, achieving the purpose of inhibiting the proliferation, migration and invasion of RA-FLS, and realizing the treatment of rheumatoid arthritis. Through experiments, it is proved that RA-FLS transfected with miR-202-3p mimic (that is, the mimic of miR-202-3p) can significantly reduce its IL6 and MMP3 levels. At the same time, miR-202-3p mimic can increase the apoptosis rate of RA-FLS cells.
[0024] The method of miR-202-3p targeting GLI1 to inhibit the Sonic Hedgehog signaling pathway proposed by the present invention can precisely control the abnormal activities of key molecules in the RA process, has the advantages of high selectivity and low toxicity and side effects, and is expected to become a safe and efficient new strategy in the field of RA treatment. Brief Description of the Drawings
[0025] Figure 1 It is a schematic diagram of the technical route of the present invention;
[0026] Figure 2Schematic diagram of FLS passage culture and identification of cell surface markers (a. Schematic diagram of primary cell culture by tissue mass culture method of FLS; b. Schematic diagram of positive CD90 (FITC) and CD55 (APC) and negative CD14 (FITC) and CD68 (APC) of FLS cell surface markers detected by flow cytometry);
[0027] Figure 3 Schematic diagram of the protein expression levels of SMO, GLI1, and CCNA2 in the RA-FLS (n = 16) group and the OA-FLS (n = 10) group (Among them, the protein expressions of GLI1 (p = 0.0195) and CCNA2 (p = 0.0264) in the RA-FLS group were significantly higher than those in the OA-FLS group; *p < 0.05);
[0028] Figure 4 Schematic diagram of miRNA screening in the RA-FLS group and the OA-FLS group and verification of the interaction with the target GLI1 (a. Schematic diagram of miRNA sequencing results of RA-FLS and OA-FLS (n = 3); b. Schematic diagram of qPCR verification of miR-202-3p expression in the NC, OA, and RA groups; c. Schematic diagram of the predicted interaction between miR-202-3p and GLI1 by the miRTarBase database; d. Schematic diagram of matching the GLI1 mRNA and miR-202-3p sequences and predicting chemical energy by the RNAhybrid database; e. Schematic diagram of ChIRP and dual luciferase reporter gene results; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001);
[0029] Figure 5 Schematic diagram showing that miR-202-3p mimic can inhibit the expression of GLI1 in 293T cells and RA-FLS (a. Schematic diagram of the downregulation of GLI1 expression after miR-202-3p mimic transfection into 293T cells; b. Schematic diagram of the inhibition of the protein expressions of GLI1 and CCNA2 after miR-202-3p mimic transfection into RA-FLS; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)
[0030] Figure 6Schematic diagram of miR-202-3p mimic affecting the phenotypes of RA-FLS and the secretion of IL6 and MMP3 (a. Schematic diagram of cell proliferation after treating RA-FLS with GANT61 (10 μM) and miR-202-3p mimic; b. Schematic diagram of the migration and invasion abilities of RA-FLS shown by Transwell results; c. Schematic diagram of cell scratching in the GANT61 (10 μM) and miR-202-3p mimic groups; d. Schematic diagram of the results of flow cytometry detecting the cell cycle of RA-FLS; e, f. Schematic diagram of flow cytometry detecting the apoptosis of RA-FLS; g. Schematic diagram of detecting the levels of IL6 and MMP3 in each group of cell culture supernatants (24 h) by ELISA; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001);
[0031] Figure 7 Schematic diagram showing that MTX+micrOn-202 combined with methotrexate treatment significantly alleviates arthritis and inflammatory factor levels in CIA mice and has bone protection (a: Schematic diagram of the time points and frequencies of CIA mouse modeling and drug administration, and the emulsification of the modeling reagent; b: Schematic diagram of mouse arthritis scores; c: Time curve of arthritis scores; d: Schematic diagram of the reconstructed images of the hind paws of mice by micro CT and the cross-sectional scan images of the calcaneus trabeculae; e: Schematic diagram of the bone density of the hind paws of mice and the data of calcaneus trabeculae; f: Schematic diagram of ELISA detection of serum IL6 and TNF-α in each group of mice; Data are expressed as mean ± standard deviation; Two-tailed t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns, no statistically significant difference);
[0032] Figure 8 Schematic diagram of the wild type (Wildtype, WT) with the sequence of the GLI1 3’UTR region as the potential binding site of miRNA. Detailed implementation manners
[0033] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0034] Table 1 Comparison of abbreviations and Chinese and English names involved in the present invention
[0035]
[0036]
[0037] Example 1
[0038] I. Experimental method:
[0039] 1. Obtain FLS cells from RA and OA patients
[0040] 1.1 The tissue block implantation method was adopted. The discarded synovial tissues from the knee joint surgeries of patients with rheumatoid arthritis (RA), osteoarthritis (OA), and traumatic arthritis (NC) were used for primary fibroblast-like synoviocyte (FLS) culture. The specific steps were carried out according to the conventional procedure of primary cell tissue block culture: The synovial tissues were soaked in pre-cooled 4°C double-antibody working solution (100× penicillin-streptomycin solution for cells, Biosharp) for 5 minutes, twice. The tissue fragments were transferred to a 25 cm 2 culture flask with sterile forceps. The cell outgrowth was checked every 3 days. After the cell confluence reached 80%, the cells were digested, the medium was changed, or subculture was performed; CD90 + CD55 + CD68 - CD14 - were used as cell surface markers of FLS, and the cell surface marker antibodies were detected by flow cytometry. If the positivity rates of CD90 and CD55 were respectively greater than 75%, it indicated successful culture purification. The purified and passaged FLS at passages 3 - 6 were used as experimental cells.
[0041] 2. Screening of miR-202-3p
[0042] 2.1 miRNAs sequencing
[0043] 2.1.1 Harvesting cells
[0044] Three samples of FLS from the above-mentioned RA and OA patients were taken respectively. After culturing to the 3rd passage, the cells were digested and the cell pellets were collected.
[0045] 2.1.2 Total RNA of the cells obtained in the above steps was extracted according to the TRIzol RNA extraction kit instructions (Thermo Fisher Invitrogen TM TRIzol reagent), and stored in a dry ice box and sent to Aike Biotechnology Company for microRNA sequencing;
[0046] 2.1.3 Grouping: The sequencing results obtained above were divided into the RA group and the OA group.
[0047] 2.2 Data processing of sequencing results and prediction of interaction sites
[0048] 2.2.1 Sequencing data processing
[0049] The sequencing data set was imported into an Excel spreadsheet, and the top five miRNAs with differential expression between the RA group and the OA group were screened out, and a volcano plot was made with Excel; their sequences were queried in mirBase.
[0050] 2.2.2 Prediction of the binding sites between miRNAs and GLI1 mRNA
[0051] Predict the interaction sequences between the miRNA and the sequence of 10 - 100 kb downstream of the CDS coding sequence of mRNA, i.e., the 3UTR’ sequence. Use databases such as StarBase v 3.0, RNAHybrid, and NCBI to find potential target miRNAs that interact and bind with mRNA and predict the binding energy between the two to determine the stability of the binding.
[0052] Verify by 3qPCR and synthesize the mimic of miR-202-3p
[0053] ① Expand the sample sizes of the RA group and the OA group, resuscitate and harvest cells, and extract total cellular RNA by the Trizol method;
[0054] ② Search for the mRNA sequence of GLI1 in the GENE column of the NCBI database. After clicking to enter the page, find the CDC (coding sequence) in FASTA. The sequence highlighted in the sequence after clicking is the coding sequence of GLI1, and copy this sequence.
[0055] ③ Predict the binding sites and binding energy between miRNAs and GLI1 by RNAHybrid
[0056] After entering the CDC sequence of GLI1 and the sequences of the screened miRNAs on the RNAHybrid (BiBiServ2 - RNAhybrid(uni - bielefeld.de)) website respectively and clicking submit, select the miRNA with the largest predicted chemical binding energy as the construction sequence of the subsequent miRNA mimic.
[0057] ④ Reverse transcription of total RNA and verification by qPCR
[0058] Reverse transcribe miRNAs with the microRNA reverse transcription kit (EZBioscience); the experimental steps are operated according to the instructions: use the primer design function on the website of Sangon Biotech (Shanghai) Co., Ltd. to design the primer sequence of miR - 202 - 3p mimic (designed according to the mature sequence of miR - 202 - 3p 5’ - AGAGGUAUAGGGCAUGGGAA - 3’). Then use the microRNA qPCR fluorescence quantitative kit (EZBioscience) to measure the sample microRNA.
[0059] 4 Verification of the interaction between miRNA and GLI1 mRNA
[0060] 4.1 Dual - luciferase reporter gene
[0061] 4.1.1 Culture and expand 293T cells
[0062] 1) Human 293T cells were purchased from Procell and identified by STR. After receiving the cells, they were cultured, passaged, and cryopreserved in liquid nitrogen according to the conditions in the attached instructions; the human 293T cells were thawed and cultured for 24 hours.
[0063] 4.1.2 Dual-luciferase reporter gene system:
[0064] Binding targets between miR-202-3p and GLI1 were found in the MiRTarBase database (https: / / awi.cuhk.edu.cn / ~miRTarBase / miRTarBase_2025 / php / index.php);
[0065] The sequence 5'-GAAAATATTACAAGATGCCCCA-3' of the 3’UTR region of GLI1 (human) was found in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and this sequence was used as the wild type (WT) of the potential miRNA binding site as Figure 8 ;
[0066] The 200 bp upstream and downstream of the above-mentioned 3’UTR region sequence of GLI1 (human) were synthesized with the psiCHECK2 plasmid to form a dual-luciferase reporter gene system (synthesized by ABM Biotechnology Co., Ltd.). This dual-luciferase reporter gene system includes a wild type (WT) and a mutant type (Mut). The wild type is the sequence of the 3’UTR region of GLI1 (human) without modification; the mutant type is the sequence of the 3’UTR region of GLI1 (human) that has been mutated so that it cannot bind to miR-202-3p.
[0067] The above-constructed dual-luciferase reporter gene system and miRNA mimics were co-transfected into 293T cells to obtain 4 types of cells (wild-type GLI1-Wt + miRNA mimics, wild-type GLI1-Wt + NC mimic, mutant-type GLI1-Mut + miRNA mimics, mutant-type GLI1-Mut + NC mimic). After culturing for 24 hours, the luminescence values of firefly luciferase and Renilla luciferase were detected, and the ratio of the two luciferases was calculated.
[0068] Compare the luciferase activity ratio between the experimental group (wild-type GLI1-Wt + miRNA mimics) and the control group (mutant GLI1-Mut + miRNA mimics); if miRNA interacts with the mRNA sequence of GLI1, the luciferase activity of the wild-type group will be significantly reduced, while there is no significant difference in the control group.
[0069] 4.2 Nucleic acid purification and chromatin isolation ChIRP (Chromatin Isolation by RNA Purification) experiment
[0070] 4.2.1 293T cell lysis
[0071] 1) Transfect miRNAs mimic (Lipofectamine TM 3000 transfection kit) into 293T cells (operate according to the transfection kit instruction manual), digest and centrifuge to collect cells.
[0072] 2) Add pre-cooled PBS, gently pipette and mix well, then divide the cells into two tubes evenly, and count about 1×10 7 cells per tube. Add 1 mL of Lysis Buffer containing protease inhibitor, phosphatase inhibitor, and PMSF to the cells, rotate and lyse at 4°C for 1 h, and centrifuge to collect the supernatant for testing.
[0073] 4.2.2 Probe preparation
[0074] Entrust Aike Biotech Company to construct an antisense oligonucleotide probe for GLI1. Synthesize biotin-labeled DNA (20 bp) probes complementary to the target RNA sequence at about one probe per 150 bp, and use a mixture of multiple probes.
[0075] 4.2.3 RNA immunoprecipitation, and the specific procedure is carried out according to the kit instruction manual. The total RNA of the immunoprecipitation product is extracted with TRIzol kit; miRNA reverse transcription and RT-qPCR are used to detect miRNA: operate according to the instruction manual; data processing calculates the relative expression level of miRNA based on the original CT value of qPCR.
[0076] 5 The effect of miRNA on the FLS phenotype
[0077] 5.1 FLS cell culture and passage
[0078] 1) When the primary cells are cultured and purified to the 3rd generation, collect FLS in the culture flask when the cell proliferation reaches a confluence of about 80 - 90%, resuspend the cells with sterile PBS, count, and then seed them in a 6-well plate for culture. After 48 hours, take them out, pour out the culture medium, gently wash with PBS, and fix each well with 2 ml of 4% paraformaldehyde for 20 min;
[0079] 2) Crystal violet staining: Pour out the fixative, gently rinse 3 times with PBS, add 1 ml of 2% crystal violet staining solution dropwise into the wells, and stain at room temperature for 15 min.
[0080] 3) After rinsing with PBS solution to remove the staining solution, observe the staining effect under an optical microscope and take pictures.
[0081] 4) Transfer the above mimics into RA-FLS respectively:
[0082] The transfected mimics include: miR-202-3p mimic and miR-NC mimic (control group).
[0083] Use Lipofectamine TM 3000 as the transfection reagent. For cell experiments, use 6-well plates or 24-well plates. When the cells are seeded in the plates for about 24 hours, the cell confluence is about 70 - 80%. The working solution concentration of miR-202-3p mimic is 5 nM.
[0084] Prepare the lipo3000 reagent working solution: 125 uL of opti-MEM + 5 uL of lipo3000 (6-well plate) or 25 uL of opti-MEM + 1 uL of lipo3000 (24-well plate);
[0085] Prepare the mimic working solution: 125 uL of opti-MEM + 2.5 uL of mimic + 5 uL of P3000 (six-well plate, since GLI1 is located in the nucleus, P3000 is added, and the dosage prepared according to the instruction manual is 2 times that of the mimic) or 25 uL of opti-MEM + 1 uL of mimic + 2 uL of P3000 (six-well plate).
[0086] Then incubate the cells with the working solution and serum-free medium (opti-MEM) according to the kit instruction manual, and change to the conventional medium after 6 hours and continue to culture for 24 hours.
[0087] 5.2 Cell scratch wound healing assay (Wound healing)
[0088] 1) Draw straight lines: Use a marker pen to draw straight lines on the bottom of the 6-well plate, draw one straight line every 1 cm, and draw 2 straight lines at the bottom of each well.
[0089] 2) Seed the cells and make scratches: After digesting and collecting 293T or FLS primary cells, inoculate them in 6-well plates so that the cell mixture reaches more than 90% during the scribing process. Culture routinely for 24 h. Use a 200 μL pipette tip to stick closely to the scale and draw a scratch longitudinally on the bottom of the well plate, with 2 scratches in each well.
[0090] 3) Photographing and result processing: Observe under 40 times magnification and use Image J Fiji-win64 software to process the unhealed area of the scratch.
[0091] 5.3 Transwell chamber migration and invasion assay
[0092] 1) Pretreat the Matrigel: Prepare the Matrigel pretreatment according to the instructions of the MCE Basement Membrane Matrix Matrigel kit and coat the inner side of the Transwell chamber (0.8 μm).
[0093] 2) Prepare the cell suspension and adjust the cell density to 1×10 6 cells / ml. Add 100 μl of the cell suspension to each chamber. Then place it back in the constant temperature cell incubator and culture for 24 h. After that, take out the chamber, gently remove the cells and gel on the inner side of the chamber, gently rinse several times, and then add 4% paraformaldehyde dropwise to the chamber to fix for 20 min, wash 3
[0094] times. Prepare 0.1% crystal violet ethanol solution, stain for 30 min, and after staining, wash and air dry.
[0095] 3) Microscopic observation and result calculation: Select 5 random fields of view in each chamber, use Image J Fiji-win64 software to calculate the stained cell area and compare the differences among groups.
[0096] 5.4 Flow cytometry detection of cell apoptosis and cell cycle
[0097] 1) Cell harvesting and pretreatment: Digest with 0.25% trypsin without EDTA, neutralize, centrifuge to collect cells, resuspend the cell pellet with pre-cooled PBS, centrifuge, and discard the supernatant.
[0098] 2) Staining: Operate according to the steps of the Elabscience Annexin V-FITC / PI fluorescence double staining apoptosis kit instructions;
[0099] 3) Turn on the flow cytometer, select the FITC and PI channels. After the instrument is debugged, start detecting and collecting data for each group of the double-stained tubes. Later, use Flowjo-8.0 software to process the images and calculate the proportion of positive cells.
[0100] 5.5 Western Blot (W-B) experiment
[0101] 1) Total protein extraction: The excised synovial tissue after clinical surgery was placed in an EP tube, added with RIPA working solution (PMSF:RIPA = 1:100), ground thoroughly on a freezing grinder, centrifuged, and the upper layer liquid was collected. After treatment with an ultrasonic disruptor for 15 min, centrifuged at 4°C and 12,000 rpm for half an hour, and the supernatant was retained and placed on ice.
[0102] 2) Determination of total protein concentration by BCA method: The protein concentration was determined according to the BCA kit instructions.
[0103] 3) Preparation of SDS-PAGE gel: Select a 10% concentration separating gel for preparation;
[0104] 4) The W-B working solution is divided into electrophoresis working solution, membrane transfer working solution and TBST washing solution, and is prepared according to the kit instructions.
[0105] 5) Electrophoresis and membrane transfer: Electrophoresis conditions: Constant voltage of 80 V for 30 min, and then constant voltage of 100 V for 70 min. Cut a PVDF membrane with a pore size of 45 nm as needed; Membrane transfer conditions with a transfer clip: Constant current of 280 mA for 90 min, and then wash the membrane with TBST working solution.
[0106] 6) Prepare a 5% skimmed milk solution with TBST working solution, soak the membrane and slowly shake and wash it for blocking at room temperature. After 1 h, rinse the membrane 3 times with TBST working solution for 5 min each.
[0107] Incubation with primary antibody: Use TBST working solution plus bovine serum albumin powder to prepare a 5% bovine serum albumin solution for diluting the primary antibody. The dilution factor of the primary antibody for GAPDH is 1:10,000, and the dilution factor of all other primary antibodies is 1:1000. Incubate the membrane with shaking at 4°C in the primary antibody working solution. After taking out the membrane the next day, wash the membrane 3 times with TBST working solution for 5 min each.
[0108] Incubation with secondary antibody: Dilute the HRP-labeled secondary antibody (1:10,000) with TBST working solution, soak the membrane for 1 hour, and rinse it 3 times with shaking on a shaker with TBST working solution for 5 min each.
[0109] Protein band development: Develop the image in a gel imager, take a photo of the result, and analyze the relative gray value of the band using the image J Fiji-win64 software. The ratio obtained by dividing the gray value (OD value) of the target band by the OD value of the GAPDH internal reference on the same membrane is the relative expression level of the target protein.
[0110] 5.6 Enzyme-linked immunosorbent assay (ELISA) experiment (all using Wuhan Huamei ELISA kit)
[0111] 1) Retain the cell culture supernatant, centrifuge to obtain the supernatant, dilute it 1-fold with PBS, and set 1 duplicate well for each sample to be tested according to the experimental instructions;
[0112] 2) Operate according to the kit instructions; after the reaction is completed, measure the absorbance at 450 nm on an enzyme-linked immunosorbent assay (ELISA) reader, and substitute the absorbance of the measurement wells into the standard curve formula to obtain the protein concentration.
[0113] II. Experimental Results
[0114] 1. FLS was successfully cultured by the tissue mass implantation method
[0115] The primary FLS obtained from synovial tissues of each group by the tissue mass culture method were OA-FLS, RA-FLS, and NC-FLS, respectively. The results showed that the proliferation rate and the migration and crawling speed on the bottle wall of RA-FLSs were significantly higher than those of the NC-FLS and OA-FLS groups ( Figure 2 a); the cell surface markers CD90 and CD55 identified by flow cytometry were highly expressed, and the staining of CD68 and CD14 was negatively expressed ( Figure 2 b), indicating that FLS was successfully obtained.
[0116] 2. The expression of key proteins in the SHH signaling pathway of RA-FLS and OA-FLS was upregulated
[0117] After extracting the total mRNA of RA-FLS and OA-FLS, the key proteins SMO and GLI1 in the SHH signaling pathway, and the cell cycle-related protein CCNA2 that affects cell proliferation were detected by Western blotting (W-B). The results showed that compared with OA-FLS (n = 10), the expressions of GLI1 (p = 0.0264) and CCNA2 (p = 0.0195) in RA-FLS (n = 16) were significantly increased ( Figure 3 ).
[0118] Aike Biotechnology Company performed miRNA sequencing and data analysis. The results showed that there were miRNAs with significant expression differences between RA-FLS and OA-FLS, including miR-202-3p ( Figure 4 a).
[0119] 3. Compared with OA-FLS, the expression of miR-202-3p in RA-FLS was significantly downregulated, and miR-202-3p and GLI1 could bind and interact
[0120] ① After expanding the sample size and verifying the expression of miR-202-3p by qPCR, the results showed that compared with the NC-FLS (n = 7) and OA-FLS (n = 4) groups, the expression of miR-202-3p in RA-FLS was significantly decreased (p < 0.05) ( Figure 4 b), and then miR-202-3p was used as the research target.
[0121] ②The mature sequence of miR-202-3p was found in the miRBase database and input into the miRTarBase database for matching with the GLI1 mRNA sequence. The results showed strong experimental evidence supporting the binding and interaction between GLI1 and miR-202-3p( Figure 4 c).
[0122] ③The mRNA sequence of GLI1 was matched with the miR-202-3p sequence in the RNAhybrid database. The results showed that the chemical binding energy between GLI1 and miR-202-3p was relatively large, indicating that the binding was stable( Figure 4 d).
[0123] ④To synthesize the mimic of miR-202-3p, we designed a double-stranded RNA, one strand of which was the mature sequence of miR-202-3p and the other was its complementary sequence. First, we searched for the mature sequence of miR-202-3p (5’-AGAGGUAUAGGGCAUGGGAA-3’) in the miRBase database (https: / / www.miRBase.org / ). The sequence of the miR-202-3p mimic (hereinafter referred to as miR-202-3p mimic) was designed as follows:
[0124] Sense strand: 5'-AGAGGUAUAGGGCAUGGGAA-3' (SEQ ID No: 1)
[0125] Antisense strand: 5'-UUCCCAUGCCCUAUGUCUCU-3' (SEQ ID No: 2)
[0126] The sequences of the mRNA primers used were as follows:
[0127] GLI1 F (sense strand): ACTGACTGCCGTTGGGATGG (SEQ ID No: 3),
[0128] GLI1 R (antisense strand): CGTGGATGTGCTCGCTGTTG (SEQ ID No: 4);
[0129] miR-202-3p F: TCTTCCTTGGTTGCGGTGTTGTC (SEQ ID No: 5).
[0130] 4. miR-202-3p mimic downregulates the expression of GLI1
[0131] Using ChIRP( Figure 4 e left) and dual-luciferase reporter gene assay( Figure 4e (right) confirmed the binding and interaction between miR-202-3p and GLI1. The results showed that miR-202-3p mimic interacted with the mRNA sequence of GLI1, and the luciferase activity in the wild-type group was significantly decreased, while there was no obvious difference in the control group.
[0132] The designed miR-202-3p mimic sequence was delivered to Aike Biotechnology Company for synthesis. After miR-202-3p mimic was transfected into 293T cells, the mRNA and protein levels of GLI1 were detected. The results showed that miR-202-3p mimic could down-regulate the expression of GLI1 ( Figure 5 a).
[0133] 5. miR-202-3p mimic inhibits the proliferation, migration and invasion phenotypes of RA-FLS
[0134] Transfection of miR-202-3p mimic into RA-FLS could also inhibit GLI1 and down-regulate the expression of cell cycle protein CCNA2 ( Figure 5 b).
[0135] We observed the proliferation of RA-FLS with an optical microscope, examined the migration and invasion abilities of RA-FLS by Transwell assay and cell scratch healing (Woundhealing), detected the cell cycle and apoptosis by flow cytometry, and examined the levels of MMP3 and IL6 in the cell culture supernatant by ELISA.
[0136] The results showed that compared with Blank (blank control) and Mock (transfection reagent control), the cell proliferation was significantly reduced after treating RA-FLS with GANT61 (GLI1 inhibitor, 10 μM) and miR-202-3p mimic transfection (RA-FLS of the 3rd - 5th passages) ( Figure 6 a); The results of the Transwell assay showed that the migration and invasion abilities of RA-FLS in the GANT61 (10 μM) and miR-202-3p mimic groups were significantly weaker than those in the Blank group and the Mock group, and the difference was statistically significant ( Figure 6 b); The results of the cell scratch healing experiment showed that at both 24 hours and 48 hours, the cell scratch area in the GANT61 (10 μM) and miR-202-3p mimic groups was significantly larger than that in the control group at the same time point ( Figure 6 c); The results of flow cytometry for detecting the cell cycle showed that both GANT61 (10 μM) and miR-202-3p mimic could inhibit the proportion of cells in the proliferative phase (S + G2 / M phase) ( Figure 6 d), but could not significantly increase the proportion of apoptotic cells in RA-FLS ( Figure 6 e).
[0137] To increase the apoptosis rate of RA-FLS cells and enhance the treatment response, we added methotrexate (MTX) combined with miR-202-3p mimic (hereinafter referred to as MTX+miR-202-3p) and a single-drug MTX treatment group (hereinafter referred to as the MTX group) in the subsequent treatment. The final concentration of MTX was set at 200 nM (the cells were dissolved in PBS). Flow cytometry results showed that 24 hours after treating RA-FLS, both the MTX+miR-202-3p group and the MTX group could significantly increase the apoptosis of RA-FLS, and the apoptosis rate of RA-FLS in the MTX+miR-202-3p group was higher than that in the MTX group ( Figure 6 f). The cell culture supernatant (24 h) was detected by ELISA. Compared with the miR-202-3p mimic group, the MTX group and the MTX+miR-202-3p group could significantly reduce the levels of IL6 and MMP3, showing a statistically significant difference ( Figure 6 g). According to the above results, it was shown that miR-202-3p mimic could effectively inhibit GLI1 and thus affect the phenotype of FLS, but had a poor effect on downregulating cytokines. However, when combined with MTX, it could significantly reduce IL6 and MMP3.
[0138] Example 2 Animal Model Experiment
[0139] I. Experimental Procedures
[0140] Operating Procedures:
[0141] 1. Experimental Grouping:
[0142] After purchasing DBA / 1 mice, they were raised in the Animal Experiment Center of the Sixth Affiliated Hospital of Sun Yat-sen University for 1 week. After completing the quarantine, 90 mice aged 7-8 weeks and weighing 18-20 g were randomly divided into 5 groups, with 10 mice in each group, 5 males and 5 females in each group. The grouping was as follows: control group (Saline group), model group (referred to as the CIA group), single-drug methotrexate group (referred to as the MTX group), single-drug micrON-202 group (referred to as the micrON-202 group), and combination treatment group (referred to as the MTX+micrON-202 group).
[0143] 2. CIA Model Establishment:
[0144] CIA models were established for the mice in the CIA group, MTX group, micrON-202 group, and MTX+micrON-202 group. The Saline group was subcutaneously injected with an equal volume of sterilized normal saline at the same time points.
[0145] (1) Emulsified modeling reagent: After taking out the type II bovine collagen solution from the refrigerator, place it in an ice box and dissolve it slowly. Take 1 mL of complete Freund's adjuvant, and slowly and evenly drip an equal amount of bovine type II collagen solution into the complete Freund's adjuvant. After dripping, quickly shake the liquid for more than 5 minutes until a milky suspension is formed.
[0146] (2) Immunization: Immunize mice by the two - immunization method. After grouping, mark the mouse cages and the immunization time. Locate the back skin about one finger width from the base of the mouse tail, disinfect the local area, quickly lift the skin with a needle, avoid injecting into blood vessels, and slowly and evenly push the needle to inject 100 μl of the emulsion. The first immunization day is Day 0, and the second immunization is carried out on Day 14.
[0147] (3) Arthritis scoring: Score each paw according to the scoring criteria. The score of each mouse is the total score of the four paws, and the score range is 0 - 16 points. If the total score of each mouse is greater than or equal to 4 points, the modeling is successful. The CIA scoring criteria are as follows.
[0148] Table 2 CIA Arthritis Scoring Table
[0149] Score Degree of paw involvement 0 No swelling or redness 1 Swelling and redness limited to joints distal to the tarsus and toes 2 Swelling and redness spreading to the dorsum of the foot, not exceeding the ankle 3 Swelling and redness reaching the ankle 4 Entire paw swollen, or ankylosed and deformed
[0150] 3. Drug treatment:
[0151] Drug treatment is carried out on Day 21, once a week ( Figure 7 a), and the drug treatment for each group is as follows:
[0152] CIA group: No drug treatment; only subcutaneous injection of sterile normal saline (250 μl) once a week;
[0153] Saline group: Inject an equal volume of normal saline (250 μl);
[0154] MTX group: Intraperitoneal injection of methotrexate alone, with a working solution concentration of 0.1 mg / Kg (250 μl);
[0155] micrON - 202 group: Local injection of micrON - 202 alone. After micrON - 202 is dissolved with 0.9% sodium chloride injection (sterile normal saline), it is configured into a 1 mM concentration working solution, and 20 μl (the total amount of micrON - 202 is 5 nmol) is injected locally into the paw through the ankle joint cavity (or subcutaneous injection around the ankle joint);
[0156] Combined treatment group (MTX + micrON - 202): Intraperitoneal injection of methotrexate combined with local injection of micrON - 202 group, with the same dosage as before.
[0157] In this step, the micrON-202 used in the micrON-202 group and the combination treatment group is a miRNA agonist micrON constructed by Guangzhou Ribobio Co., Ltd. according to the miR-202-3p mimic of the present invention. TM miRNA agomir, hereinafter referred to as micrON-202.
[0158] 4. Arthritis and body weight assessment:
[0159] Starting from the first immunization on Day 0, the limb symptoms of the mice in each group were scored for arthritis and their body weights were recorded every 7 days.
[0160] 5. Detect the blood concentration of inflammatory cytokines
[0161] Sacrifice the mice and collect samples: On the 63rd day after the first immunization, all the mice were sacrificed by nitrogen, and the bilateral hind paws were cut off and blood was collected; the levels of IL6 and TNF-α in the serum inflammatory cytokines were detected by ELISA. The operation steps were carried out according to the kit instructions.
[0162] To detect the blood concentration of inflammatory cytokines, the blood of the mice was collected by the method of eye blood collection in mice. Each mouse could obtain 500-600 μl of blood. The blood samples were placed in an ice box for 3-4 hours to separate the plasma and blood clots, and then centrifuged at a low temperature of 3,000 rpm for 20 minutes in a refrigerated centrifuge. The upper layer of serum was transferred to a new EP tube and stored in a -80°C refrigerator.
[0163] 6. Assessment of joint destruction degree and bone density:
[0164] The degree of joint destruction and bone density were evaluated by using small animal computed tomography (Micro computed tomography, Micro-CT). The operation steps are as follows:
[0165] (1) Scanning and sampling time: The mice were sacrificed on Day 63. The hind paws of the mice were scanned using a Bruker small animal CT Skyscan1278l tomographic scanner. The scanning parameters were: V = 50 kV, current = 250 μA, Camera Pixel Size (um) = 17.420, Image Rotation = 0.22000, Image Pixel Size (um) = 6.033595. The three-dimensional image of the hind paw was reconstructed using Slicer5.6.2 software, and the frontal view image was collected. The bone mineral density (BMD) and trabecular mineral density (TMD) of the ankle bone were analyzed by CTAn software.
[0166] (2) After the scan, cut off the bilateral hind paw claws, fix them in 4% paraformaldehyde, send them to Sevier Biotechnology Co., Ltd. (Wuhan) for paraffin embedding, and then send the sections back for pathological examination.
[0167] 7. Paraffin sections and staining of joint tissues
[0168] (1) Paraffin sections of joint tissues: The section thickness is 3 - 5 μm.
[0169] (2) Staining: Perform multiplex immunofluorescence staining on the paraffin sections of the hind paws. The specific steps refer to the procedure of the relevant kit instructions. The steps of double-label immunofluorescence staining refer to the instructions of Sevier Biology TSAPLus Fluorescent Double-Label Triple-Staining Kit (green light iF488 + red light iF555). After all antibodies and nuclear staining are completed, add an anti-fluorescence quenching mounting medium, dry, and scan the sections panoramically with TG (TissueGnostics FAXS Q panoramic scanning system). Fluorescent channels: 440 nm, 470 nm, and 580 nm.
[0170] II. Experimental results
[0171] 1. The CIA mouse model was successfully established, and the MTX + micrON-202 group showed the best performance in reducing the arthritis score of CIA mice among all groups.
[0172] We constructed a CIA mouse model. The time points and frequencies of immunization and drug administration, and the emulsification degree of the modeling reagent are detailed in Figure 7 a. The arthritis score is shown in Figure 7 b: 0 indicates completely normal, 1 indicates slight swelling of the toes, 2 indicates swelling of the metatarsophalangeal joint, 3 indicates swelling of the sole of the foot, and 4 indicates swelling reaching the ankle.
[0173] As shown by Figure 7 c, on Day 14 (2 weeks), except for the Saline group, the arthritis scores of the other groups began to increase, reached the peak at Day 28 (4 weeks), and at Day 42 (6 weeks), the arthritis score of the MTX + micrON-202 group was the lowest among all groups except the Saline group, while the micrON-202 group was still relatively high. At the study endpoint Day 70 (10 weeks), there were significant statistical differences between the MTX + micrON-202 group (p = 0.0344) and the MTX group (p = 0.0438) compared with the CIA group; the arthritis score of the MTX + micrON-202 group was still the lowest, and there was no statistical difference in the arthritis score between the micrON-202 group and the CIA group ( Figure 7 c).
[0174] This indicates that the treatment regimen of local single-agent use of micrON-202 targeting GLI1 has a poor effect on controlling inflammation, while the treatment response is optimal after combination with MTX.
[0175] 2. The combined treatment of MTX + micrON-202 significantly alleviated joint destruction in CIA mice and protected bone mineral density and trabecular bone density of the calcaneus
[0176] As Figure 7 shown in d, the three-dimensional imaging of the paw was reconstructed using Slicer software, showing the front view. The joint structures of each paw in the Saline group were sharp and clear, with smooth cortex and normal structure. However, varying degrees of joint structure abnormalities were present in other groups.
[0177] The degree of bone destruction in the MTX + micrON-202 group was milder than that in the CIA group, MTX group, and micrON-202 group ( Figure 7 d1). In terms of bone protection, the bone mineral density (Tb.BMD), trabecular bone density (Tb.TMD), and bone mineral content (Tb.BMC) in the micrON-202 group, MTX group, and MTX + micrON-202 group were significantly higher than those in the CIA group, indicating that all three intervention methods could reduce bone destruction, and the results were statistically significant (P < 0.05). However, the bone mineral density (1.361 ± 0.069 g / cm 3 ), trabecular bone density (1.158 ± 0.165 g / cm 3 ), and bone mineral mass (9.406 ± 0.700 mg) in the micrON-202 group were lower than those in the MTX group (1.616 ± 0.345 g / cm 3 , 1.460 ± 0.072 g / cm 3 , 14.220 ± 0.846 mg) and the MTX + micrON-202 group (1.877 ± 0.220 g / cm 3 , 1.766 ± 0.098 g / cm 3 , 17.510 ± 1.456 mg). This shows that local application of micrON-202 alone is effective for CIA, but the efficacy can be further improved after combination with MTX ( Figure 7 d2 - 3, 7e).
[0178] 3. MTX + micrON-202 reduces the levels of pro-inflammatory factors in the serum of CIA mice
[0179] Figure 7As shown in Figure f, at the end of the experiment, in terms of TNF-α, the concentration of TNF-α in the serum of CIA mice (353.41 ± 41.48 pg / ml) was the highest. The concentration in the micrON-202 group (316.8 ± 43.81 pg / ml) was lower than that in the CIA group, and there was a statistical difference between the two groups (p > 0.05). However, the MTX + micrON-202 group (176.2 ± 33.66 pg / ml) and the MTX group (198.23 ± 41.56 pg / ml) could further reduce the serum TNF-α level. In terms of IL6, the situation was similar. Compared with the CIA group (1020.09 ± 122.8 pg / ml), the IL6 levels in the MTX + micrON-202 group (309.40 ± 51.33 pg / ml), the MTX group (664.04 ± 92.56 pg / ml), and the micrON-202 group (761.7 ± 94.35 pg / ml) were all lower than that in the CIA group, and there were statistical differences. The IL6 levels in the MTX + micrON-202 group and the MTX group were lower than that in the micrON-202 group. All of these indicated that local use of micrON-202 could reduce systemic inflammation, but the effect was weaker than the intervention plan of systemic administration combined with MTX.
[0180] The above experimental results suggest that the combined treatment of MTX and micrON-202 has the best effect on downregulating the SHH pathway and reducing joint inflammation in CIA mice.
[0181] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. Use of a substance that enhances the expression of miR-202-3p gene in the preparation of a product for treating rheumatoid arthritis; Or, use of a substance that increases the content and / or activity of miR-202-3p in the preparation of a product for treating rheumatoid arthritis; Or, use of miR-202-3p mimics in the preparation of a product for treating rheumatoid arthritis.
2. Use of a substance that enhances the expression of miR-202-3p gene in the preparation of a product for inhibiting the proliferation of rheumatoid arthritis cells; Or, use of a substance that increases the content and / or activity of miR-202-3p in the preparation of a product for inhibiting the proliferation of rheumatoid arthritis cells; Or, use of miR-202-3p mimics in the preparation of a product for inhibiting the proliferation of rheumatoid arthritis cells.
3. Use of a substance that enhances the expression of miR-202-3p gene in the preparation of a product for inhibiting the Sonic Hedgehog signaling pathway; Or, use of a substance that increases the content and / or activity of miR-202-3p in the preparation of a product for inhibiting the Sonic Hedgehog signaling pathway; Or, use of miR-202-3p mimics in the preparation of a product for inhibiting the Sonic Hedgehog signaling pathway.
4. Use of a substance that enhances the expression of miR-202-3p gene in the preparation of a product for inhibiting the expression of GLI1 protein; Or, use of a substance that increases the content and / or activity of miR-202-3p in the preparation of a product for inhibiting the expression of GLI1 protein; Or, use of miR-202-3p mimics in the preparation of a product for inhibiting the expression of GLI1 protein.
5. The application according to any one of claims 1-4, characterized in that, The miR-202-3p mimics are miRNAs that mimic the activity of miR-202-3p.
6. The application according to claim 5, wherein The miRNA that mimics the activity of miR-202-3p is formed by annealing of a sense strand and an antisense strand; The nucleotide sequence of the sense strand is as shown in SEQ ID No:1, and the nucleotide sequence of the antisense strand is as shown in SEQ ID No:
2.
7. Use of a substance for detecting the expression of miR-202-3p gene in the preparation of a product for detecting or diagnosing whether a test sample is rheumatoid arthritis; Or, use of a substance for detecting the expression of miR-202-3p gene in the preparation of a product for detecting or diagnosing whether a test patient has rheumatoid arthritis; Or, use of a substance for detecting the expression of miR-202-3p gene in the preparation of a product for detecting or diagnosing whether a test cell is a rheumatoid arthritis cell.
8. The application according to claim 7, characterized in that: The substance for detecting the expression of miR-202-3p gene is a probe for detecting the miR-202-3p gene, and the nucleotide sequence of the probe is as shown in SEQ ID No:
5.
9. An analog of the gene miR-202-3p related to the diagnosis and treatment of rheumatoid arthritis, characterized in that, The mimics of the miR-202-3p gene are formed by annealing of a sense strand and an antisense strand; The nucleotide sequence of the sense strand is as shown in SEQ ID No.1, and the nucleotide sequence of the antisense strand is as shown in SEQ ID No.
2.
10. Use of the mimic of gene miR-202-3p in combination with methotrexate in the preparation of a medicament for treating rheumatoid arthritis as claimed in claim 9.