In-situ microbial remediation method for heavy metal polluted site of in-production enterprise

Abstract

The invention relates to the technical field of contaminated site remediation, and particularly discloses an in-situ microbial remediation method for heavy metal contaminated sites of in-production enterprises, which comprises the following steps: step 1, screening and separating target microorganisms; 2, screening the obtained target strains; 3, carrying out characteristic research and laboratory scale simulation experiment on the dominant strains; step 4, carrying out microorganism amplification culture and optimization; and step 5, implementing an actual site repair project. According to the method, in-situ remediation can be achieved, interference on normal production is effectively avoided, the method has the advantages of being high in adaptability and specificity, specific strains can be screened out for specific pollutants for rapid remediation, and the whole method is safe, environmentally friendly, economical and efficient.

Description

Technical Field

[0001] The present invention relates to the technical field of contaminated site remediation, and particularly to an in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production. Background Art

[0002] Due to the continuous production activities of enterprises in production, problems such as leakage and emission of heavy metal pollutants often occur during the production process, resulting in the pollution of site soil and groundwater. Heavy metal pollutants such as mercury, lead, cadmium, arsenic, chromium, etc., have characteristics such as strong biological toxicity and difficulty in removing from the environment. They can not only damage the soil ecological system, but also spread through groundwater, threatening the surrounding environment and human health. When traditional remediation technologies, such as physical remediation and chemical remediation, are applied in the environment of enterprises in production, they often have problems such as high cost, easy impact on the normal production of enterprises, and possible secondary pollution. Microbial remediation technology has become a research hotspot for the remediation of contaminated sites of enterprises in production due to its advantages such as environmental friendliness and relatively low cost. However, the existing microbial remediation methods still face challenges such as weak targeting of microbial screening, low remediation efficiency, and difficulty in adapting to the interference of enterprise production activities when dealing with the complex contaminated environment of enterprises in production.

[0003] Chinese Patent Application CN 111054740 B, "Device and Method for In-Situ Remediation of Cadmium and Lead Contaminated Farmland Soil Driven by Microbial Electrochemistry", its technical feature is to construct a double-chamber reactor, use hydrogen gas generated by electrolyzing water with electrodes as an electron donor, and drive sulfate-reducing bacteria to reduce sulfate to S 2- The generated aqueous passivator can convert heavy metals into poorly soluble sulfides. However, multiple types of reaction wells (such as heating wells, injection wells, etc.) need to be arranged, which may conflict with the enterprise's underground pipelines, and continuous power supply is required to maintain a constant cathodic current (15 - 30 mA). In addition, there is a risk that the sulfur-containing passivator may seep into the production area and corrode equipment, limiting its applicability in industrial sites. Chinese Patent Application CN 114170036 B, "A Phytoremediation Model of Hyperaccumulator Plants and Low-Accumulation Crops for Heavy Metal-Contaminated Soil and Its Construction Method", its technical feature is to establish a mathematical model to optimize the intercropping ratio of hyperaccumulator plants (such as Pteris vittata) and low-accumulation crops (such as corn), and achieve simultaneous production and remediation through phytoextraction. However, the remediation cycle for some heavy metals is as long as hundreds of years (such as cadmium pollution requires hundreds of years), and hyperaccumulator plants (such as Pteris vittata) have strict requirements for soil temperature and humidity, making it difficult to promote in arid or extreme pH environments. In addition, phytoremediation may introduce heavy metals into the food chain, and the safety of crops needs to be strictly supervised. Chinese Patent Application CN 119842408 A, "A Soil Remediation Agent for Heavy Metal-Contaminated Mine Wastelands and Its Preparation Method", its technical feature is to use industrial waste residues such as fly ash (20 - 40%) and red mud (20 - 40%) as the main raw materials, combined with activators and stabilizers, and made into a remediation agent through a ball milling process, which can solidify heavy metals and adjust the soil pH. Although the solidifying agent can reduce the leaching toxicity of heavy metals, a large amount of industrial waste residues (such as red mud) may cause a significant increase in soil pH and damage the microbial community. Chinese Patent Application CN 117778022 A, "An In-Situ Solidifying Agent for Heavy Metal-Contaminated Soil and Its Preparation Method", its technical feature is to use polyhydroxyaluminum-modified diatomite (7 - 14 parts) in combination with components such as ferrous sulfate and hydroxyapatite, and achieve in-situ solidification of heavy metals through high-pressure rotary jet grouting injection. However, the use of high-pressure rotary jet grouting injection equipment (pressure ≥ 20 MPa) improves the construction specialization, and the large-scale production cost of polyhydroxyaluminum-modified diatomite (7 - 14 parts) is relatively high. Chinese Patent Application CN 119842025 A, "A Humic Acid Composite Remediation Material for Coal Chemical Pollution Sites and Its Preparation Method", its technical feature is to extract humic acid from lignite, polymerize it with butyl acrylate after alkali dissolution and acid precipitation to make a composite material with a porous structure and rich functional groups, which can simultaneously adsorb heavy metals and organic pollutants. However, an excessive amount of humic acid composite material will reduce the stability of soil aggregates and instead increase the risk of heavy metal migration.

[0004] Therefore, to solve such problems, we propose an in-situ microbial remediation method for heavy metal-contaminated sites of operating enterprises. Summary of the Invention

[0005] The purpose of the present invention is to solve the deficiencies existing in the prior art, and propose an in-situ microbial remediation method for heavy metal-contaminated sites of operating enterprises.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] An in-situ microbial remediation method for heavy metal contaminated sites of in-production enterprises, comprising the following steps:

[0008] Step 1: Screening and isolation of target microorganisms: Select a contaminated site of an in-production enterprise for soil sample collection, and conduct microbial screening and cultivation to obtain multiple candidate strains;

[0009] Step 2: Target strains obtained by screening: Select dominant strains from multiple candidate strains;

[0010] Step 3: Conduct characteristic research and laboratory-scale simulation experiments on the dominant strains;

[0011] Step 4: Microbial scale-up cultivation and optimization: Expand the cultivation of the dominant strains in a fermenter. After fermentation, through centrifugation and concentration processes, prepare a microbial inoculant and add a protective agent;

[0012] Step 5: Implementation of the actual site remediation project: In the contaminated site of the in-production enterprise, carry out the remediation implementation application until the concentration of heavy metal pollutants in the contaminated site reaches the remediation target.

[0013] Preferably, the soil sample of the contaminated site of the in-production enterprise in Step 1 is Cr-contaminated soil. The microbial screening and cultivation further include mixing the collected soil samples evenly, taking the evenly mixed soil samples and placing them in a liquid medium to obtain a Cr liquid medium, using NaOH and HCl with a concentration of 1 mol / L to adjust the pH value of the Cr liquid medium to 7.4, and culturing it in a shaker. Then, inoculate the culture solution onto a solid medium by the streak plate method, culture it at the same temperature, pick single colonies with different morphologies, and conduct multiple purification cultures to obtain multiple candidate strains.

[0014] Preferably, the liquid medium is LB medium, and the LB medium includes 10 g / L of peptone, 5 g / L of yeast extract, 10 g / L of sodium chloride, and pH 7.4.

[0015] Preferably, in Step 2, multiple candidate strains are respectively inoculated into multiple liquid media containing specific heavy metal pollutants. After culturing for a certain time under suitable conditions, use ultraviolet-visible spectrophotometry to detect the remaining concentration of heavy metal pollutants in the multiple liquid media, judge the degradation rate, and select the strains with a high degradation rate, that is, the dominant strains.

[0016] Preferably, step four further includes inoculating a seed solution into the fermenter, with an inoculation amount of 5-10% (v / v), controlling the fermentation temperature, pH value, and dissolved oxygen, and stirring for fermentation. The fermentation medium in the fermenter is peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, glucose 20 g / L, MgSO4·7H2O 3 g / L, potassium dihydrogen phosphate 4 g / L, dipotassium hydrogen phosphate 0.75 g / L, and pH 7.4.

[0017] Preferably, the concentration of the microbial inoculant in step four is 10 10 -10 11 CFU / mL.

[0018] Preferably, the protectant in step four is one or both of glycerol and trehalose.

[0019] Preferably, the restoration implementation in step five includes reasonably arranging injection wells and monitoring wells according to the site topography, pollution distribution, and enterprise production layout. The injection wells use PVC pipes. Dilute the expanded microbial inoculant with sterile water and inject the inoculant into the contaminated soil through a high-pressure injection device. The injection volume is determined according to the soil pollution degree and porosity, and inject the inoculant solution per cubic meter of soil.

[0020] Preferably, step five further includes regularly collecting soil and groundwater samples through the monitoring wells, detecting heavy metal pollutant concentrations, microbial quantities, pH, and temperature environmental indicators, and adjusting the inoculant injection frequency and nutrient supplement amount according to the detection results.

[0021] A soil remediation reagent, the reagent includes Bacillus cereus GS strain.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] 1: The present invention can achieve in-situ remediation, effectively avoid interfering with normal production, only need to arrange small injection wells, without excavation or production stoppage, avoid damaging underground pipelines or production facilities, and significantly improve the construction convenience.

[0024] 2: The present invention has the characteristics of strong self-adaptability and specificity. By screening indigenous strains, it can adapt to the existing pollution environment of the enterprise (such as pH, temperature, pollutant type), and can screen out specific strains for specific pollutants for rapid remediation.

[0025] 3: The present invention is overall safe and environmentally friendly, with the characteristics of no high temperature and chemical agents, meeting the environmental protection compliance requirements of in-production enterprises.

[0026] 4: The present invention is economical and efficient. The inoculant can be produced on a large scale and does not require subsequent treatment, effectively avoiding the possible risk of secondary pollution. Description of the Drawings

[0027] Figure 1 Colony morphology of Bacillus cereus GS strain on LB medium.

[0028] Figure 2 Effect of different initial Cr(VI) concentrations on the growth of Bacillus cereus GS strain and the reduction rate of Cr(VI) content in Example 3.

[0029] Figure 3 Effect of different temperatures (16°C, 20°C, 25°C, 30°C, 37°C) and 160 rpm oscillation on the bacterial concentration and Cr(VI) concentration after 20 h of detection in Example 3.

[0030] Figure 4 Effect of different pH values (4, 6, 7, 8, 10) on the reduction rate of Cr(VI) content in Example 3.

[0031] Figure 5 Effect of the bacterial solution on the reduction rate of Cr(VI) content at different concentrations in Example 4. Detailed implementation manners

[0032] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments.

[0033] Example 1

[0034] Target microorganism screening and isolation: In the polluted sites of operating enterprises, multiple representative sampling points are selected according to the pollutant distribution. The soil samples from the polluted sites of operating enterprises are chromium (Cr)-polluted soils, mainly Cr(VI)-polluted soils. Cr(VI) is the chemical symbol for hexavalent chromium, referring to the form of chromium element (Cr) in the +6 oxidation state. Soil samples are collected at a depth range of 0 - 50 cm, and 1 - 2 kg of soil is collected at each sampling point. After mixing the collected soil samples evenly, 5 - 10 g is taken and placed in a sterilized 100 ml liquid medium to obtain a Cr(VI) liquid medium. The liquid medium is LB medium, which contains 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride; the pH of the Cr(VI) liquid medium is adjusted to about 7.4 using 1 mol / L NaOH and HCl, and it is oscillated and cultured in a shaker under aerobic conditions at a set temperature and rotation speed. The conditions of the aerobic environment are 30 - 32 °C, pH 7.2 - 7.4, incubated at a constant temperature for 20 hours, the oscillation rate is 180 - 200 rpm, and the pH is preferably 7.4. Then, the culture solution is inoculated onto the solid medium by the streak plate method and cultured at the same temperature for 3 - 5 days. Single colonies with different morphologies are picked and subjected to multiple purification cultures to obtain multiple candidate strains.

[0035] Example 2

[0036] Screened target strains: Multiple candidate strains are respectively inoculated into multiple liquid media containing specific heavy metal pollutants, namely Cr(VI) liquid media. After culturing for a certain period of time under suitable conditions, the remaining concentration of heavy metal pollutants in the multiple Cr(VI) liquid media, that is, the remaining concentration of Cr(VI), is detected by ultraviolet-visible spectrophotometry to judge the degradation rate. The lower the remaining concentration, the higher the degradation rate. Strains with high degradation rates are selected, that is, dominant strains.

[0037] Identification of dominant strains:

[0038] Take 200 μL of the overnight cultured bacterial solution, centrifuge at 12000 rpm for 5 min, discard the supernatant, add 200 μL of sterilized ultrapure water to the precipitate, mix well, and place it in a 100 °C water bath for 5 min for lysis. The lysate is used as a template for PCR reaction. The PCR primers are universal primers 27F and 1492R (sequences are shown in SEQ ID NO: 2 - 3).

[0039] 27F: AGAGTTTGATCCTGGCTCAG

[0040] 1492R: TACGGCTACCTTGTTACGACTT

[0041] The PCR reaction system was as follows: 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, 72°C for 1 min 30 s, for 25 cycles; 72°C for 10 min. The PCR reaction conditions were: 2 μL of 10× Ex Taq Buffer, 0.2 μL of 5 U / μL Ex Taq, 1.6 μL of 2.5 mM dNTP Mix, 1 μL each of 27F and 1492R, 0.5 μL of template, 13.7 μL of ddH2O, for a total volume of 20 μL. After the PCR products were detected by 1.2% agarose gel electrophoresis, they were sent to Shanghai Majorbio Bio-Pharm Technology Co., Ltd. for sequencing. The raw sequences at both ends obtained by Sanger sequencing were respectively subjected to quality control to remove low-quality bases. After obtaining the clean sequences, they were assembled to obtain the assembled sequence. The species information of the top 10 species with the highest similarity to the NT database was obtained by blast, and the species with the highest similarity was selected as the identification result.

[0042] Comparative analysis found that those with similarity above 99% were all Bacillus sp. Among them, the similarity between GS strain and KC510288.1 Bacillus cereus strain Fd 16S ribosomal RNA gene was 99.5%. The 16S rDNA sequence of the strain was as shown in SEQ ID NO: 1.

[0043] The dominant strain was Bacillus cereus GS strain. As Figure 1 shown, the colonies of Bacillus cereus GS strain were round, yellowish-white, with a diameter of about 5 - 7 mm, and the surface was relatively rough, resembling frosted glass or melted wax.

[0044] Example 3

[0045] Characteristic studies were carried out on the dominant strain, that is, the study on the Cr(VI) reduction characteristics of Bacillus cereus GS strain:

[0046] 1. The seed liquid of Bacillus cereus GS strain was cultured to the logarithmic phase with an OD 600 of 1.0 and inoculated into LB medium with different initial Cr(VI) concentrations (0 mg / L, 10 mg / L, 20 mg / L, 50 mg / L, 70 mg / L, 100 mg / L, 150 mg / L) at pH 7.4 according to an inoculation amount of 5%. The mixture was shaken at a constant temperature of 30°C at 180 rpm. After 20 hours, the bacterial concentration and the Cr(VI) removal rate were detected, and 3 parallels were set for each group.

[0047] The results were as Figure 2As shown in the figure, when the Cr(VI) concentration was 10 mg / L and 20 mg / L, the growth of the strain was not inhibited, and the Cr(VI) removal rate was about 100%. This may be because the low concentration of Cr(VI) had no effect on the growth and metabolism of the strain itself, so a removal rate of nearly 100% could be achieved. When the concentration was 50 mg / L, the growth of the strain was significantly inhibited, and the removal rate was about 50%. The toxicity of Cr(VI) began to have a significant impact on the growth of the strain, possibly interfering with the normal physiological functions of the cells, such as affecting the permeability of the cell membrane and the activity of enzymes, resulting in a significant inhibition of the strain growth. However, at this time, the strain still had a certain tolerance and reduction ability, so a removal rate of about 50% could still be achieved. When the concentration was 70 - 100 mg / L, the growth of the strain was completely inhibited, and the removal rate was about 10%. At this time, the Cr(VI) concentration was too toxic to the GS strain, probably having seriously damaged the structure and function of the cells, resulting in the inability of the cells to grow and reproduce normally, and the metabolic activities were basically stagnant.

[0048] 2. The seed liquid of Bacillus cereus GS strain cultured to the logarithmic phase, with an OD 600 of 1.0, was inoculated into the LB medium with an initial Cr(VI) concentration of 20 mg / L and a pH of 7.4 at an inoculation amount of 5%. It was oscillated at different temperatures (16 °C, 20 °C, 25 °C, 30 °C, 37 °C) at 180 - 200 rpm. After 20 hours, the bacterial concentration and Cr(VI) concentration were detected, and 3 parallels were set for each group.

[0049] The results are as Figure 3 shown. The Cr(VI) removal rate of the GS strain was about 95% at 16 °C to 37 °C, and the growth of the strain was not inhibited. This indicates that the GS strain has a wide temperature adaptation range. Between 16 °C and 37 °C, the enzyme system, metabolic pathways, etc. in the strain cells can remain relatively stable and active. It may be that the cell membrane composition, protein structure, etc. of the GS strain have a certain flexibility and stability, and can maintain normal physiological functions at different temperatures, thus ensuring the high-efficiency removal ability of Cr(VI), and a removal rate of about 95% can be achieved in each case, indicating that the reduction and metabolism mechanism of the strain to Cr(VI) is relatively stable within this temperature range.

[0050] 3. The seed liquid of Bacillus cereus GS strain cultured to the logarithmic phase, with an OD 600 of 1.0, was inoculated into the LB medium with different pH values (4, 6, 7, 8, 10) and an initial Cr(VI) concentration of 10 mg / L. It was oscillated at a constant temperature (30 °C, 180 rpm). After 20 hours, the bacterial concentration and Cr(VI) concentration were detected, and 3 parallels were set for each group.

[0051] The results are as Figure 4As shown, the removal rate of Cr(VI) by the GS strain is approximately 75% under the conditions of pH 4 - 10. The GS strain can maintain a certain Cr(VI) removal ability within the range of pH 4 - 10, indicating that the strain has a certain acid-base adaptability. It may be that the strain cells have an acid-base regulation mechanism, which can maintain the relative stability of the intracellular environment under different pH environments and ensure the activity of related enzymes and metabolic pathways. However, the removal rate is approximately 75% in all cases, and it does not reach a higher removal rate under certain specific conditions. This may be because the change in pH still has a certain impact on some physiological processes of the strain. Although it does not completely inhibit growth, it will affect the activity or efficiency of the enzymes related to Cr(VI) reduction, resulting in the removal rate being stable at around 75%.

[0052] Example 3

[0053] Laboratory-scale simulation experiment: This experiment included 8 treatments, with three replicates for each treatment to monitor the removal of soil Cr(VI) (as shown in Table 1). The treatments included the treatment with the addition of GS bacterial solution and the control treatment without GS, and the Cr(VI) concentration treatments of 100, 200, 500, and 1000 mg / kg were set respectively. The soil was artificially contaminated with Cr(VI), and the Cr(VI) solution was added to the aliquot of the soil. After setting different concentrations of Cr(VI) and contaminating for 7 days, the Cr(VI) concentration in the soil was measured.

[0054] For each treatment, 100 g of contaminated soil was placed in a 250 mL beaker. In the control treatment, 30 mL of deionized water was added, and in the GS treatment, 10 mL of GS bacterial solution with a concentration of 10 8 -10 9 cfu / mL was added, and the water content was maintained at 30% water holding capacity (WHC). After 7 days, destructive sampling was carried out, and the Cr(VI) concentration in the aged soil was measured using the method described in HJ687-2014 (Determination of Cr(VI) in solid waste - Alkaline digestion flame atomic absorption spectrophotometry).

[0055] After culturing for 7 days under different concentrations of soil Cr(VI) pollution, compared with the control, GS significantly increased the reduction of Cr(VI) (p < 0.05, analysis of variance, as Figure 5)。When the initial concentration of Cr(VI) was 100 mg / kg, the reduction rate of Cr(VI) in the GS treatment was approximately 100%; when the initial concentration of Cr(VI) was 200 mg / kg, the reduction rate of Cr(VI) in the GS treatment was approximately 77%; when the initial concentration of Cr(VI) was 500 mg / kg, the reduction rate of Cr(VI) in the GS treatment was approximately 66%; when the initial concentration of Cr(VI) was 1000 mg / kg, the GS treatment could reduce 70% of Cr(VI). In contrast, in the control group, the reduction rate of Cr(VI) was only 11.3% to 23.6%.

[0056] Table 1 Soil Remediation Experiment

[0057]

[0058] Example 4

[0059] Microbial Enrichment Culture and Optimization: The dominant strain was enriched in a fermenter. The fermentation medium in the fermenter was also selected as LB medium, and the formula of LB medium was rich in carbon source, nitrogen source and various nutrients. The formula of various nutrients was glucose, yeast powder, peptone, KH2PO4, K2HPO4, MgSO4 and sodium chloride. The seed liquid was inoculated into the fermenter, and the inoculation amount was 5-10% (v / v). The fermentation temperature was controlled at 28-30 °C, the pH value was 7-8, the dissolved oxygen was 3-5 mg / L, the stirring speed was 150-200 r / min, and the fermentation time was 3-5 days. After fermentation, through centrifugation, concentration and other processes, the bacterial liquid concentration was increased to 10 10 -10 11 CFU / mL to prepare a microbial agent, and an appropriate amount of protective agents such as glycerol and trehalose were added to improve the survival rate of microorganisms during storage and application.

[0060] Example 5

[0061] Implementation of the Actual Site Remediation Project: At the polluted site of the in-production enterprise, injection wells and monitoring wells were reasonably arranged according to the site topography, pollution distribution and enterprise production layout. The injection wells used PVC pipes with a diameter of 5-8 cm, the well depth was determined according to the pollution depth, generally 1-3 m, and the well spacing was 3-5 m. The microbial agent obtained by enrichment culture was diluted with sterile water to 10 9 -10 10CFU / mL. The bacterial agent is injected into the contaminated soil through a high-pressure injection device. The injection volume is determined according to the soil pollution degree and porosity, generally 1-2 L of the bacterial agent solution is injected per cubic meter of soil. While injecting the bacterial agent, an appropriate amount of nutrients such as nitrogen source (urea or ammonium nitrate), phosphorus source (potassium dihydrogen phosphate), and trace elements (iron, zinc, manganese, etc.) are supplemented into the soil through the irrigation system to promote the growth and metabolism of microorganisms. Soil and groundwater samples are regularly collected through monitoring wells to detect the concentrations of heavy metal pollutants, the number of microorganisms, and related environmental indicators. According to the detection results, the injection frequency of the bacterial agent and the supplement amount of nutrients are adjusted, and continuous remediation is carried out for 3-6 months until the concentration of heavy metal pollutants in the contaminated site reaches the remediation target.

[0062] In summary, the Bacillus cereus GS strain of the present invention has demonstrated excellent performance in the remediation of Cr(VI) pollution:

[0063] (1) In the Cr(VI) liquid medium, the removal rate of 20 mg / L Cr(VI) within 20 hours is >95%, far exceeding the removal rates of existing strains, and the time required for removal is shorter (for example, FNXJ1-2-3 disclosed in CN114573115A requires 28-32 hours).

[0064] (2) It works stably in the range of pH 4-10 and temperature 16-37°C, breaking through the acid-base dependence and temperature limitations of existing strains (such as FZUY-01 disclosed in CN114164139A which needs to be used under the condition of pH 10).

[0065] (3) In the remediation of soil chromium pollution, the removal rate of Cr(VI) in contaminated soil with a concentration of 100-1000 mg / kg reaches 70%-100% within 7 days; it can treat contaminated soil with a Cr(VI) concentration of up to 1000 mg / kg and can maintain its activity at a Cr(VI) concentration of 50 mg / L, while the activity of existing strains (such as FNXJ1-2-3 is only applicable to ≤30 mg / L) is completely inhibited at this concentration.

[0066] (4) The bacterial liquid can be directly added without adjusting the soil pH or adding nutrient agents, reducing the remediation cost; it is cultured in a conventional LB medium, and the preparation process is simple, suitable for large-scale application.

[0067] The above is only the preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and should be covered by the protection scope of the present invention.

Claims

1. An in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production, characterized in that, It includes the following steps: Step 1: Screening and isolation of target microorganisms: Select a contaminated site of a production enterprise to collect soil samples, and conduct microbial screening and cultivation to obtain multiple candidate strains; Step 2: Obtaining the target strains through screening: Select the dominant strains from multiple candidate strains; Step 3: Conduct characteristic research and laboratory-scale simulation experiments on the dominant strains; Step 4: Large-scale cultivation and optimization of microorganisms: Conduct large-scale cultivation of the dominant strains in a fermenter. After fermentation, through centrifugation and concentration processes, prepare microbial inoculants and add protectants; Step 5: Implementing the actual site remediation project: At the contaminated site of the production enterprise, conduct remediation implementation and application until the concentration of heavy metal pollutants in the contaminated site reaches the remediation target.

2. The in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production according to claim 1, characterized in that, The soil sample from the contaminated site of the production enterprise in Step 1 is Cr-contaminated soil. The microbial screening and cultivation also include mixing the collected soil samples evenly, taking the evenly mixed soil samples and placing them in a liquid medium to obtain a Cr liquid medium, using NaOH and HCl with a concentration of 1 mol / L to adjust the pH value of the Cr liquid medium to 7.4, culturing it in a shaker, then inoculating the culture solution onto a solid medium by the streak plate method, culturing at the same temperature, picking single colonies with different morphologies, and conducting multiple purification cultivations to obtain multiple candidate strains.

3. The in-situ microbial remediation method for heavy metal contaminated sites of operating enterprises according to claim 2, wherein, The liquid medium is LB medium, and the LB medium includes 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, and pH 7.

4.

4. An in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production according to claim 1, characterized in that, In Step 2, inoculate multiple candidate strains into multiple liquid media containing specific heavy metal pollutants respectively. After culturing for a certain time under suitable conditions, use ultraviolet-visible spectrophotometry to detect the remaining concentration of heavy metal pollutants in the multiple liquid media, judge the degradation rate, and select the strains with a high degradation rate, that is, the dominant strains.

5. An in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production according to claim 1, characterized in that, Step 4 also includes inoculating a seed solution into the fermenter, with an inoculation amount of 5-10% (v / v), controlling the fermentation temperature, pH value, and dissolved oxygen, and stirring for fermentation. The fermentation medium in the fermenter is 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L glucose, 3 g / L MgSO4·7H2O, 4 g / L potassium dihydrogen phosphate, 0.75 g / L dipotassium hydrogen phosphate, and pH 7.

4.

6. The in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production according to claim 1, characterized in that, The concentration of the microbial inoculum in Step 4 is 10 10 -10 11 CFU / mL.

7. An in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production according to claim 1, characterized in that, The protectant in Step 4 is one or two of glycerol and trehalose.

8. The in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production according to claim 1, characterized in that, The remediation implementation and application in Step 5 include reasonably arranging injection wells and monitoring wells according to the site topography, pollution distribution, and enterprise production layout. The injection wells use PVC pipes. Dilute the expanded microbial inoculants with sterile water and inject the inoculants into the contaminated soil through high-pressure injection equipment. The injection volume is determined according to the soil pollution degree and porosity, and inject the inoculant solution per cubic meter of soil.

9. The in-situ microbial remediation method for heavy metal contaminated sites of enterprises in production according to claim 8, characterized in that, Step 5 also includes regularly collecting soil and groundwater samples through the monitoring wells, detecting heavy metal pollutant concentrations, microbial numbers, pH, and temperature environmental indicators, and adjusting the inoculant injection frequency and nutrient supplement amount according to the detection results.

10. A soil remediation reagent, characterized in that, The reagent includes Bacillus cereus GS strain.

Images