Bio-organic fertilizer for preventing and treating root and stem diseases of horseradish and application of bio-organic fertilizer

By combining Bacillus vellis and Trichoderma Yunnan, food safety and environmental pollution problems of chemical agents in preventing and controlling wasabi rhizome diseases have been solved, and efficient and environmentally friendly disease prevention and control and ecosystem improvement have been achieved.

CN120349208AActive Publication Date: 2025-07-22金葵农业(云南)股份有限公司

Patent Information

Application Number
CN202510846787.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-24
Publication Date
2025-07-22
Estimated Expiration
2045-06-24

AI Technical Summary

Technical Problem

The existing chemical agents prevent and control wasabi rhizosphere diseases with food safety risks and environmental pollution problems, which are difficult to meet the needs of sustainable development.

Method used

Bioorganic fertilizers with Bacillus vellis and Trichoderma Yunnan as the main components are combined with soybean meal, biochar, wollastonite powder and allicin, and jointly prevent and control wasabi rhizome diseases by promoting plant growth and improving the soil microbial environment.

Benefits of technology

It significantly improves the disease resistance and growth hormone content of wasabi, reduces the occurrence of diseases, builds a stable ecological barrier, reduces the use of chemical pesticides, and promotes the sustainable development of agricultural ecosystems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120349208A_ABST
    Figure CN120349208A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms and bio-organic fertilizers, and particularly discloses a bio-organic fertilizer for preventing and treating rhizome diseases of horseradish and application of the bio-organic fertilizer, the bio-organic fertilizer comprises the following components: component A: a bacillus velezensis microbial inoculum with the preservation number of CCTCC NO: M 2022923 and a trichoderma yunnanense microbial inoculum with the preservation number of CCTCC NO: M 2025645; the component B is prepared from soybean meal, vinegar residues, charcoal, wollastonite powder and allicin. The biological organic fertilizer disclosed by the invention can be used for increasing the content of growth hormones such as salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) and phytoalexin as well as the activity of chitinase and beta-1, 3-glucanase of a wasabi root system, and has a relatively good prevention and treatment effect on a black heart disease caused by infection of phoma wabi Yokog and a soft rot disease caused by infection of pectobacterium carotovorum subsp. Carotovorum (Pcc). The biological organic fertilizer disclosed by the invention has a relatively good prevention and treatment effect on the soft rot disease caused by infection of the phoma wabi Yokog and a relatively good prevention and treatment effect on the soft rot disease caused by infection of the phoma wabi subsp. Carotovorum (Pcc).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and organic fertilizers, and in particular relates to a biological organic fertilizer for preventing and treating wasabi root and stem diseases and application thereof. Background Art

[0002] Wasabi Wasabia japonica ) is a global high-end spice crop and a core raw material for Japanese cuisine, seasonings and functional foods. Its unique spicy flavor comes from the natural active ingredient isothiocyanate, which has antibacterial, anti-inflammatory, antioxidant and other physiological effects. Its economic value far exceeds that of ordinary vegetable crops.

[0003] During the wasabi planting cycle, rhizome diseases have become the main bottleneck restricting the development of the industry. Black heart disease ( Phoma wasabiae ) and soft rot ( Pectobacterium carotovorum ) and other rhizome diseases are getting worse year by year. The incidence rate in continuous cropping plots can reach 40%-60%. In severe cases, it leads to crop failure, which seriously affects the yield and quality of wasabi and causes huge economic losses to wasabi growers. At present, the common method for preventing and controlling wasabi rhizome diseases is to use chemical agents. Although they can have a certain inhibitory effect on the disease in the short term, long-term use will bring many disadvantages. On the one hand, the residue of chemical agents will affect the quality and safety of wasabi products and may pose a potential threat to the health of consumers; on the other hand, the large-scale use of chemical agents will also pollute the soil environment, water environment, etc., destroy the ecological balance, and pose a serious threat to environmental safety. These defects make it difficult for chemical control technology to meet the needs of sustainable development of the wasabi planting industry.

[0004] In view of the limitations of chemical control technology, it is particularly urgent to develop microbial agents based on the functional application of microorganisms and their application technology. As a green, environmentally friendly and sustainable biological control method, microbial agents have the advantages of being environmentally friendly, not easy to produce resistance, and promoting crop growth. By screening microbial strains with functions such as antagonizing pathogens and improving soil microecological environment, composite microbial agents are developed, which can not only effectively prevent and control rhizomes of wasabi, reduce the use of chemical agents, and ensure product quality and environmental safety, but also provide a sustainable disease control solution for the wasabi planting industry and promote the healthy development of the wasabi industry. Therefore, conducting research on microbial agents based on the functional application of microorganisms and their application technology is of great practical significance for solving the problem of rhizomes in the wasabi planting process and promoting the sustainable development of the wasabi planting industry. Summary of the invention

[0005] The object of the present invention is to address the problems existing in the prior art for preventing and controlling diseases of wasabi rhizomes (black heart disease and wasabi soft rot disease), such as the poor effectiveness of chemical pesticides during crop planting, high environmental protection risks, and the inability to meet consumers' demands for food safety. The present invention provides a biological organic fertilizer for preventing and controlling wasabi rhizome diseases and its application. The biological organic fertilizer provided by the present invention can effectively promote the disease resistance of wasabi and has a good disease control effect.

[0006] To achieve the above object, in the first aspect of the present invention, a biological organic fertilizer for preventing and controlling wasabi rhizome diseases (black heart disease and wasabi soft rot disease) is provided. The microbial inoculum comprises the following components: Component A: Bacillus velezensis with the preservation number of CCTCC NO: M 2022923 and Trichoderma yunnanense with the preservation number of CCTCC NO: M 2025645; Component B: soybean meal, biochar, wollastonite powder, vinegar residue, and allicin.

[0007] Further, in Component A, the effective viable count in the Bacillus velezensis microbial inoculum is not less than 5×10 10 CFU / g, and the effective viable count in the Trichoderma yunnanense microbial inoculum is not less than 5×10 9 CFU / g.

[0008] Further, the dosages of both the Bacillus velezensis microbial inoculum and the Trichoderma yunnanense microbial inoculum are 1 - 2% by weight of Component B.

[0009] Further, in Component B, the weight ratio of soybean meal, biochar, wollastonite powder, vinegar residue, and allicin is 20 - 30:20 - 30:20 - 30:0.4 - 1:109 - 139.6.

[0010] Further, in the soybean meal, calculated on a dry matter basis, the protein content is 40 - 50% by weight, the carbohydrate content is 30 - 40% by weight, and the fat content is 2 - 4% by weight. And / or, in the wollastonite powder, calculated on a dry matter basis, the CaO content is 35 - 45% by weight and the SiO2 content is 40 - 50% by weight. And / or, in the vinegar residue, calculated on a dry matter basis, the cellulose content is 30 - 40% by weight, the protein content is 10 - 15% by weight, the fat content is 10 - 15% by weight, and the ash content is 10 - 15% by weight.

[0011] In the second aspect of the present invention, there is provided the use of the above-mentioned biological organic fertilizer in increasing the content of growth hormones and phytoalexins and the activity of defense enzymes in crop roots, and / or preventing and controlling rhizome diseases of wasabi, wherein the crop is wasabi; the growth hormone is at least one of salicylic acid (SA), jasmonic acid (JA) and ethylene (ET); the phytoalexin is Camalexin, and the defense enzyme is at least one of chitinase and β-1,3-glucanase; the rhizome diseases are selected from at least one of wasabi black heart disease and wasabi soft rot disease, wherein the pathogen causing the wasabi black heart disease is Phoma wasabiae Yokog, and the pathogen causing the wasabi soft rot disease is Pectobacterium carotovorum subsp .carotovorum, Pcc).

[0012] In the third aspect of the present invention, there is provided a method for increasing the content of growth hormones and phytoalexins and the activity of defense enzymes in crop roots and / or preventing and controlling rhizome diseases, the method comprising applying the above-mentioned biological organic fertilizer to the soil, wherein the amount of the biological organic fertilizer applied to the soil is 100 - 200 kg / mu / time, and the application frequency during the whole growth period is 1 time.

[0013] Advantages of the present invention: (1) Bacillus velezensis inhibits pathogenic bacteria by producing antibacterial substances, promotes plant growth (such as nitrogen fixation and phosphorus solubilization), induces plant systemic resistance, improves the soil microbial community, enhances the stress resistance of crops, and reduces the occurrence of diseases; Trichoderma yunnanense inhibits plant pathogenic bacteria by secreting antibiotics, enzymes and competitive effects, promotes the development of plant roots, induces systemic resistance, improves the soil microbial structure, and at the same time assists in degrading organic matter to enhance the stress resistance of crops. Bacillus velezensis relies on secreting antibacterial proteins (such as subtilin), polypeptides and volatile substances, and has a significant control effect on bacterial diseases (soft rot disease ( Pectobacterium carotovorum ). Trichoderma yunnanense destroys the cell wall of pathogenic bacteria by secreting cellulase and chitinase, and directly infects pathogenic bacteria using antibiotics (such as trichodermin) and hyperparasitism, and has an effect on fungal diseases (black heart disease ( Phoma wasabiaeThe control effect of ()) is remarkable. The compound of biocontrol Bacillus velezensis and Trichoderma yunnanense can exert a synergistic effect of "1 + 1 > 2", manifested as a broader spectrum of disease prevention and control, more significant growth promotion and stress resistance, a more stable microbial community, while reducing the dosage of single microbial agents and improving the reliability and sustainability of biological control. Specifically, Bacillus velezensis inhibits bacterial and some fungal diseases by secreting antibacterial proteins (such as subtilin) and volatile substances, while Trichoderma yunnanense efficiently controls fungal diseases through chitinase production and hyperparasitism mechanism. After the two are compounded, they form a dual chemical and physical defense line, covering various pathogens such as bacteria and fungi, and significantly reducing the risk of mixed infections. In terms of growth promotion, the nitrogen fixation, phosphorus solubilization and ACC deaminase activities of Bacillus velezensis can relieve plant stress, and the mycelial network of Trichoderma yunnanense improves soil structure and activates the jasmonic acid signaling pathway, synergistically enhancing plant biomass and stress resistance. In addition, the spore structure of Bacillus velezensis and the mycelial expansion ability of Trichoderma yunnanense are complementary, enhancing the adaptability in arid or high-humidity environments, reducing the dosage of single microbial agents while extending the long-lasting period. The compound microbial agent can also optimize the rhizosphere microbial community, form a stable ecological barrier by competing with and excluding pathogens and promoting the amplification of beneficial bacteria (such as actinomycetes). This synergistic effect not only improves the efficiency of disease prevention and control, reduces the dependence on chemical pesticides, but also promotes the sustainable development of agricultural ecosystems by improving soil health and microbial diversity, providing an efficient and environmentally friendly solution for green plant protection.

[0014] (2) This soybean meal is rich in proteins, etc., which can be decomposed to provide nitrogen, phosphorus, potassium, iron, zinc and other nutrient elements for plants. The high-porosity structure of biochar can improve soil aeration and water retention, regulate acidity and alkalinity, reduce nutrient loss and improve fertilizer efficiency. Wollastonite powder contains mineral nutrients such as silicon and calcium. Silicon can strengthen plant cell walls and enhance the disease resistance of crops. Vinegar residue is rich in organic matter, small amounts of nitrogen, phosphorus, potassium and amino acids, etc., and after decomposition provides slow-release nutrients for plants. As a sulfur-containing active ingredient in garlic, allicin can effectively prevent and control various fungal and bacterial diseases by directly inhibiting the cell metabolism and reproduction of pathogens, inducing plants to produce systemic resistance and antioxidant effects, and is an important functional component of natural plant-derived fungicides. The above composition realizes the synergy of structural improvement, nutrient regulation and pollution remediation at the soil level through the functional coupling of multiple components, and achieves the unity of pathogen inhibition, resistance induction and healthy growth at the crop level, constructing a benign ecological system of "soil-plant-microorganism" interaction, providing soil health guarantee for the prevention and control of root and stem diseases.

[0015] (3)The biocontrol Bacillus velezensis and Trichoderma yunnanense colonize the rhizosphere, occupying the living space and nutrients of pathogenic bacteria. Combining with the direct antibacterial effect of allicin, a "space - nutrient - chemistry" triple pathogen barrier is formed; the microorganisms secrete lipopeptides, hydrolases, etc., which cooperate with the thiosulfinates of allicin to disrupt the cell structure of pathogenic bacteria at multiple targets, expanding the antibacterial spectrum and enhancing the bactericidal ability; the cell components and metabolites of the bacteria activate the plant defense enzyme system, combined with the physical barrier of the silicified cell wall of wollastonite powder, to build a "biochemical defense + mechanical resistance" dual protection; biochar and organic matter (soybean meal, vinegar residue) provide carriers and carbon sources for beneficial bacteria, promoting their massive reproduction, inhibiting pathogenic bacteria, and optimizing the soil microbial community structure; the microbial agent synergistically decomposes nutrients (such as the mineral elements of wollastonite powder), promotes root development and balanced nutrient absorption, enhances the disease resistance foundation of plants, and reduces the risk of disease caused by nutrient deficiency and weak seedlings; overall, through a three - dimensional network of "inhibiting pathogens - inducing resistance - optimizing microecology - strengthening plants", the control effect on diseases is significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the colony morphology diagram of the YNK - FG0001 strain in plate culture in Example 1; Figure 2 It is the phylogenetic tree constructed based on the ITS gene sequence of the YNK - FG0001 strain in Example 1.

[0017] BIOLOGICAL DEPOSIT The Bacillus velezensis used in the present invention is taxonomically named Bacillus velezensis SH - 1471, which was deposited at the China Center for Type Culture Collection on June 28, 2022. The address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit number is CCTCC NO: M 2022923. It has been disclosed in the invention patent with the application number CN202211479280.X.

[0018] The Trichoderma yunnanense used in the present invention is taxonomically named Trichoderma yunnanense YNK - FG0001, which was deposited at the China Center for Type Culture Collection on March 31, 2025. The address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit number is CCTCC NO: M 2025645. SPECIFIC EMBODIMENTS

[0019] The endpoints and any values in the ranges disclosed in this document are not limited to the exact ranges or values. These ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the values between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed in this document.

[0020] In the present invention, Bacillus velezensis SH-1471 and Bacillus velezensis CCTCC NO: M 2022923 are the same strain, and they have the same meaning, and their names (numbers) can be used interchangeably. Trichoderma yunnanense YNK-FG0001 and Trichoderma yunnanense CCTCC NO: M 2025645 are the same strain, and they have the same meaning, and their names (numbers) can be used interchangeably.

[0021] During the research process, the inventors of the present invention isolated a strain of Bacillus velezensis ( Bacillus velezensis ), named SH-1471, which was deposited at the China Center for Type Culture Collection on June 28, 2022, with the deposit number CCTCC NO: M 2022923, and a strain of Trichoderma yunnanense ( Trichoderma yunnanense ), named YNK-FG0001, which was deposited at the China Center for Type Culture Collection on March 31, 2025, with the deposit number CCTCC NO: M2025645. Through research, it was found that the strain Bacillus velezensis SH-1471 and the strain Trichoderma yunnanense YNK-FG0001 have good biological activities and have good antagonistic effects against pathogenic fungi and pathogenic bacteria causing crop diseases.

[0022] The inventors of the present invention found in the research that when a biological organic fertilizer prepared by mixing soybean meal, vinegar residue, biochar, wollastonite powder, allicin, etc. in a certain proportion is applied to the soil, the content of growth hormones and phytoalexins in the roots of wasabi, the activity of defense enzymes, and the control effect of root and stem diseases are further improved.

[0023] Based on the above findings, on the one hand, the present invention provides a biological organic fertilizer, and the biological organic fertilizer includes: Component A: a Bacillus velezensis bacterial agent with the deposit number CCTCC NO: M 2022923 and a Trichoderma yunnanense bacterial agent with the deposit number CCTCC NO: M 2025645; Component B: soybean meal, biochar, wollastonite powder, vinegar residue, and allicin.

[0024] That is, the formula of the biological organic fertilizer provided by the present invention is any one of the following: (1)Bacillus velezensis SH-1471, Trichoderma yunnanense YNK-FG0001, soybean meal, biochar, wollastonite powder, vinegar residue, and allicin; (2)Soybean meal, biochar, wollastonite powder, vinegar residue, and allicin. Among them, in Component B, the weight ratio of soybean meal, biochar, wollastonite powder, vinegar residue, and allicin is 20 - 30:20 - 30:20 - 30:0.4 - 1:109 - 139.6.

[0025] In the present invention, there are no special restrictions on the raw materials used as the above biological organic fertilizer (such as soybean meal, biochar, wollastonite powder, vinegar residue, allicin, etc.), and it can be any related products in the art that can be used to prepare biological organic fertilizer, which can be commercially available related products or related products prepared by oneself according to the existing technology.

[0026] The inventors found in the research that when specific raw materials are used, the obtained biological organic fertilizer can better improve the content of growth hormones and phytoalexins in the wasabi roots, the activity of defense enzymes, and the disease control effect. Therefore, according to the preferred embodiment of the present invention, among them, in the soybean meal, calculated on a dry matter basis, the protein content is 40 - 50% by weight, the carbohydrate content is 30 - 40% by weight, and the fat content is 2 - 4% by weight.

[0027] Preferably, in the soybean meal, calculated on a dry matter basis, the protein content is 43 - 50% by weight, the carbohydrate content is 33 - 40% by weight, and the fat content is 2.5 - 4% by weight.

[0028] More preferably, in the soybean meal, calculated on a dry matter basis, the protein content is 45 - 50% by weight, the carbohydrate content is 35 - 40% by weight, and the fat content is 3 - 4% by weight.

[0029] According to the preferred embodiment of the present invention, among them, in the wollastonite powder, calculated on a dry matter basis, the CaO content is 35 - 45% by weight, and the SiO2 content is 40 - 50% by weight.

[0030] Preferably, in the wollastonite powder, calculated on a dry matter basis, the CaO content is 37 - 45% by weight, and the SiO2 content is 43 - 50% by weight.

[0031] More preferably, in the wollastonite powder, calculated on a dry matter basis, the CaO content is 40 - 45% by weight, and the SiO2 content is 45 - 50% by weight.

[0032] According to the preferred embodiment of the present invention, among them, in the vinegar residue, calculated on a dry matter basis, the cellulose content is 30 - 40% by weight, the protein content is 10 - 15% by weight, the fat content is 10 - 15% by weight, and the ash content is 10 - 15% by weight.

[0033] Preferably, in the vinegar residue, on a dry matter basis, the cellulose content is 33-40% by weight, the protein content is 11.5-15% by weight, the fat content is 11.5-15% by weight, and the ash content is 11.5-15% by weight.

[0034] More preferably, in the vinegar residue, on a dry matter basis, the cellulose content is 35-40% by weight, the protein content is 13-15% by weight, the fat content is 13-15% by weight, and the ash content is 13-15% by weight.

[0035] According to a preferred embodiment of the present invention, based on the total weight of the biological organic fertilizer, the dosages of both the Bacillus velezensis SH-1471 and the Trichoderma yunnanense YNK-FG0001 bacterium agents are 1-2% by weight of component B.

[0036] The present invention further provides a method for preparing the above biological organic fertilizer. According to a preferred embodiment of the present invention, the method includes composting the soybean meal, biochar, wollastonite powder, vinegar residue, and allicin of the aforementioned component B to obtain a basic biological organic fertilizer, and then adding the optional Bacillus velezensis SH-1471 and Trichoderma yunnanense YNK-FG0001 (or their bacterium agents) and other raw materials in accordance with the aforementioned dosage ratios to the basic fertilizer and mixing evenly.

[0037] In the present invention, there are no particular restrictions on the specific storage and use forms of the biological organic fertilizer. Since the raw materials used in this biological organic fertilizer are basically solids and the preparation method is only to mix the components in proportion. Therefore, the biological organic fertilizer can be directly stored or used in the form of the obtained solid preparation.

[0038] The second aspect of the present invention provides the application of the above biological organic fertilizer in increasing the content of crop root growth hormones and phytoalexins and the activity of defense enzymes and / or controlling root and stem diseases.

[0039] In the present invention, crop root growth hormones refer to salicylic acid (SA), jasmonic acid (JA), ethylene (ET), etc., phytoalexins refer to Camalexin, and defense enzymes refer to chitinase and β-1,3-glucanase; controlling crop diseases refers to preventing or reducing the occurrence of crop diseases, or reducing the losses caused by diseases after the diseases occur.

[0040] According to a preferred embodiment of the present invention, the crop is wasabi, and the root and stem diseases are selected from at least one of wasabi black heart disease and wasabi soft rot disease; among them, the pathogen causing the wasabi black heart disease is Phoma wasabiae ( Phoma wasabiae Yokog) and the pathogen of wasabi soft rot disease is Pectobacterium carotovorum subsp. carotovorum ( Pectobacterium carotovorumsubsp .carotovorum, Pcc).

[0041] The third aspect of the present invention provides a method for increasing the contents of plant growth hormones and phytoalexins in crop roots, the activities of defense enzymes and / or controlling rhizome diseases, and the method includes applying the biological organic fertilizer described in the second aspect to the soil.

[0042] In the present invention, the crop is wasabi.

[0043] Preferably, the pathogen causing the wasabi rhizome disease is Phoma wasabiae ( Phoma wasabiae Yokog) and the pathogen causing the wasabi soft rot is Pectobacterium carotovorum subsp. carotovorum ( Pectobacterium carotovorum subsp .carotovorum, Pcc).

[0044] The specific characteristics of Bacillus velezensis, Trichoderma yunnanense and the biological organic fertilizer used in the method provided by the present invention are as described above and will not be elaborated herein.

[0045] In the present invention, there is no particular limitation on the specific dosages of Bacillus velezensis, Trichoderma yunnanense and the biological organic fertilizer, as long as they can play the role of increasing the activity of defense enzymes / controlling crop diseases.

[0046] The biological organic fertilizer is applied to the crop planting soil, and the dosage can be 100 - 200 kg / mu / time. For example, it can be 100 kg / mu / time, 120 kg / mu / time, 140 kg / mu / time, 160 kg / mu / time, 180 kg / mu / time, 200 kg / mu / time, or any intermediate value between any two of the above values.

[0047] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, rather than to limit the present invention.

[0048] Example 1 This example is used to illustrate the acquisition, identification and preservation of Trichoderma yunnanense CCTCC NO: M 2025645.

[0049] (I) Strain isolation and purification In August 2024, a strain of fungus was isolated from the flue-cured tobacco planting farmland soil (104°21 'E, 27°37'N) in Yiliang County, Zhaotong City, Yunnan Province, China, and it was preserved in the China General Microbiological Culture Collection Center with the preservation number CCTCC NO: M 2025645.

[0050] During the strain isolation and purification process, PDA medium was used, and the preparation method was as follows: 200 g of potatoes, 20 g of glucose, 15 - 20 g of agar, add 1000 mL of deionized water, adjust the pH to 7.0 ± 0.1, and autoclave at 121 °C for 25 min.

[0051] A strain of fungus was isolated and purified from a flue-cured tobacco planting farmland soil sample collected from Yiliang County, Zhaotong City, Yunnan Province by the dilution plating method and the tip hypha picking method, and named Trichoderma yunnanense.

[0052] (II) Strain identification 1. Identification of fungal morphological characteristics and molecular genetic classification Colony: The Trichoderma yunnanense strain YNK-FG0001 was inoculated on PDA medium and cultured at 28 °C. The following changes were observed on the PDA medium: At the beginning, the strain was white, dense, and round, and spread around; after growing for a period of time, light green spores were produced from the center of the colony, and the center turned green; finally, the whole colony turned green as Figure 1 shown. For Trichoderma yunnanense ( Trichoderma yunnanense) The strain was inoculated onto a PDA solid medium and cultured at 30 °C for 48 hours. The strain was sent to Beijing Tsingke Biotechnology Co., Ltd., Chongqing Branch for ITS sequencing of the strain. The sequence results were: TCCGTAGGGTGACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTATTTCTTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGGGGATCGGGACCCCTCACACGGGTGCCGGCCCCTAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC (SEQ ID NO.1). The sequencing results were imported into NCBI for comparison and homology comparison was performed with the standard strain sequence with a homology higher than 80%. It had a homology of up to 98.98% with Trichoderma yunnanense ( Trichodermayunnanense , NR134419) (see Figure 2 ). Therefore, it was identified as a microorganism belonging to Deuteromycotina, Hyphomycetes, Moniliales, Moniliaceae, and Trichoderma. The phylogenetic tree of the strain was constructed using MEGA7. Figure 2 Figure 6 shows the phylogenetic tree of the drawn strain.

[0053] 3. Identification results Combining the molecular detection results and the fungal morphological characteristic detection results of strain YNK-FG0001, this strain was identified as Trichoderma yunnanense ( Trichoderma yunnanense ) (III) Strain preservation The classification obtained above was named:Trichoderma yunnanense Trichoderma yunnanense YNK-FG0001 was deposited at the China Center for Type Culture Collection on March 31, 2025. The address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M 2025645.

[0054] Example 2 In this example, the soybean meal was purchased from Kunming Tengze Industry and Trade Co., Ltd., the vinegar residue was purchased from Yunnan Lufeng Dingxin Vinegar Industry Co., Ltd., the wollastonite powder was purchased from Yunnan Shijing Silicon Industry Co., Ltd., the biochar was purchased from Yunnan Yongde Kangwei Biochar Industry Co., Ltd., and the allicin was purchased from Yunnan Dadong Biopharmaceutical Co., Ltd.

[0055] Table 1 shows the detection results of the raw material components for the preparation of the basic organic fertilizer. Among them, the protein content in the soybean meal was determined by the Kjeldahl method, the carbohydrate content was determined by the enzyme hydrolysis method, and the fat content was determined by the Soxhlet extraction method; the cellulose content in the vinegar residue was determined by the enzymatic hydrolysis method, the crude protein content was determined by the Kjeldahl method, the crude fat content was determined by the Soxhlet extraction method, and the crude ash content was determined by the acid washing method; the CaO content in the wollastonite powder was determined by the acid-base titration method, and the SiO2 content was determined by the phosphomolybdic acid spectrophotometry method.

[0056] Table 1 Composition of the basic organic fertilizer materials Preparation of the Bacillus velezensis and Trichoderma yunnanense inoculant of the present invention: The inoculant is obtained by expanding the liquid culture medium of Bacillus velezensis 1471 (for the acquisition method, please refer to 202211479280.X), and the content is 5×10 10 cfu / g.

[0057] The inoculant is obtained by expanding the liquid culture medium of Trichoderma yunnanense YNK-FG0001, and the content is 5×10 9 cfu / g. It includes the following steps: (1) Solidly culturing the above-mentioned Trichoderma yunnanense in a solid medium to obtain a test tube strain; (2) Preparing a liquid seed medium, and inoculating the test tube strain therein for liquid culture to obtain a liquid seed; (3) Preparing a liquid fermentation medium, and inoculating the liquid seed therein for fermentation.

[0058] In step (1), the Trichoderma yunnanense is inoculated by the method of slant inoculation. The conditions for culturing the slant solid medium are: culturing at a temperature of 25-30°C for 120-144 h; the solid medium includes: 200 g / L of potato, 20 g / L of glucose, 15-20 g / L of agar, and pH 6.2-6.6.

[0059] In step (2), the test tube seeds are inoculated into a liquid seed medium, and the liquid culture is treated for 96 - 120 h under the conditions of a temperature of 25 - 30 °C and a rotation speed of 150 - 200 r / min; the liquid seed medium includes: 5 g / L of peptone, 2 g / L of yeast extract powder, 20 g / L of glucose, 1 g / L of dipotassium hydrogen phosphate, 0.5 g / L of magnesium sulfate, and a pH of 6.2 - 6.6.

[0060] In step (3), the liquid seeds are inoculated into a liquid fermentation medium at an inoculation amount with a volume ratio of 0.05 - 0.1:1, and are treated for 72 - 96 h under the conditions of a temperature of 25 - 30 °C and a rotation speed of 150 - 200 r / min; the liquid fermentation medium includes: 20 g / L of malt extract, 20 g / L of glucose, and a pH of 6.2 - 6.6. In this step, the liquid fermentation medium is preferably sterilized at 120 - 125 °C for 20 - 30 min, inoculated with the liquid seeds after cooling, and preferably cultured on a shaker at 28 - 30 °C with a rotation speed of 150 - 200 r / min for 72 - 96 h to obtain a fermentation broth.

[0061] Prepare the bio - organic fertilizer according to the formula in Table 2. The specific preparation method includes: weighing the raw materials according to the ratio in Table 2 and mixing them evenly to obtain the bio - organic fertilizer (solid preparation).

[0062] Table 2 Microbial inoculant formula According to the preferred embodiment of the present invention, the application frequency of the bio - organic fertilizer of Bacillus velezensis and Trichoderma yunnanense is once per crop.

[0063] According to the formula of the bio - organic fertilizer in Table 2, fertilize at an application rate of 100 - 200 kg / mu / time (100 plants are planted in each test group); measure the plant defense enzyme activity 30 days after transplanting; investigate the control effect of diseases at the harvest stage.

[0064] Determination of the content of growth hormones and phytoalexins in the roots of Wasabia japonica: The contents of salicylic acid (SA), jasmonic acid (JA), ethylene (ET), fusaric acid, and camalexin are determined by high - performance liquid chromatography (HPLC).

[0065] Method for determining the defense enzyme activity in the roots of Wasabia japonica: Chitinase and β - 1,3 - glucanase are determined using a kit purchased from Suzhou Grees Biotechnology Co., Ltd., and the usage method refers to the instruction manual.

[0066] Investigation and grading standard for black heart disease of Wasabia japonica: Grade 0: The whole plant is disease-free; Grade 1: Lesions on the stem do not exceed 1 / 3 of the stem circumference, and individual leaves wilt; Grade 3: Lesions on the stem do not exceed 1 / 2 of the stem circumference, or less than half of the leaves show mild wilting, or a few lower leaves have lesions; Grade 5: Lesions on the stem exceed 1 / 2 of the stem circumference but do not completely encircle the stem, or more than half of the leaves show mild wilting; Grade 7: Lesions on the stem encircle the stem, or more than 2 / 3 of the leaves wilt; Grade 9: All leaves of the diseased plant wilt or die.

[0067] Investigation and grading standards for soft rot of Wasabia japonica: Grade 0: Disease-free, the plant is completely healthy without any symptoms of soft rot.

[0068] Grade 1: One or a few small water-soaked lesions appear on the outer or top leaves of the plant, and the lesion area accounts for less than 10% of the total leaf area; Grade 3: There are more lesions on the outer or top leaves, and some leaves begin to show mild wilting, and the lesion area accounts for 20%-30% of the total leaf area; Grade 5: Most of the outer or top leaves wilt, the lesion area accounts for 40%-50% of the total leaf area, the lesions at the base of the stem expand, and signs of rot begin to appear but do not spread to the whole plant; Grade 7: More than 1 / 2 of the leaves of the whole plant are soft-rotted, the base of the stem is severely rotted, most of the plant collapses, but some leaves still remain green; Grade 9: The whole plant is rotten, only some remaining roots and partially unrotted tissues are left, and the field shows a state of soft rot.

[0069] The following two formulas are used to calculate the control effect: Disease index = [(Σ(number of diseased plants at each grade × representative grade)) / (total number of plants × highest representative grade value)] × 100 Control effect (%) = [(disease index of the control group - disease index of the treatment group) / disease index of the control group] × 100% From the data in Tables 3 and 4, it can be seen that when applying the bio-organic fertilizer provided by the present invention, the contents of root growth hormones, phytoalexins and the activities of defense enzymes in Wasabia japonica are significantly higher than those of the control, the control effect on the diseases of the rhizome of Wasabia japonica is further improved, and is significantly higher than that of the control.

[0070] Table 3 Test conditions and results of the control effect of the tested bio-organic fertilizer on the diseases of the rhizome of Wasabia japonica * The blank control is the blank control group without applying any bio-organic fertilizer.

[0071] Table 4 Test conditions and results of the tested bio-organic fertilizer on the contents of growth hormones, phytoalexins and the activities of defense enzymes * The blank control is the blank control group without applying any bio-organic fertilizer.

[0072] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit them. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A biological organic fertilizer for preventing and controlling diseases of wasabi rhizomes, characterized in that: The biological organic fertilizer comprises the following components: Component A: Bacillus velezensis with the preservation number of CCTCC NO: M 2022923 ( Bacillus velezensis) bacterial agent) and Trichoderma yunnanense with the preservation number of CCTCC NO: M 2025645 ( Trichoderma yunnanense ) bacterial agent; Component B: soybean meal, biochar, wollastonite powder, vinegar residue and allicin.

2. The biological organic fertilizer for preventing and controlling diseases of wasabi rhizomes according to claim 1, characterized in that: In component A, the effective viable count of the Bacillus velezensis bacterial agent is not less than 5×10 10 CFU / g, and the effective viable count of the Trichoderma yunnanense bacterial agent is not less than 5×10 9 CFU / g.

3. The biological organic fertilizer for preventing and controlling diseases of wasabi rhizomes according to claim 1, wherein: The dosages of the Bacillus velezensis bacterium agent and the Trichoderma yunnanense bacterium agent are both 1-2% by weight of Component B.

4. The bio-organic fertilizer for preventing and controlling the diseases of wasabi rhizomes according to claim 1, wherein: In Component B, the weight ratio of soybean meal, biochar, wollastonite powder, vinegar residue and allicin is 20-30:20-30:20-30:0.4-1:109-139.

6.

5. The bio-organic fertilizer for preventing and controlling the diseases of wasabi rhizome according to claim 4, characterized in that: In the soybean meal, based on dry matter, the protein content is 40-50% by weight, the carbohydrate content is 30-40% by weight, and the fat content is 2-4% by weight; and / or, in the wollastonite powder, based on dry matter, the CaO content is 35-45% by weight and the SiO2 content is 40-50% by weight; and / or, in the vinegar residue, based on dry matter, the cellulose content is 30-40% by weight, the protein content is 10-15% by weight, the fat content is 10-15% by weight, and the ash powder content is 10-15% by weight.

6. Use of the biological organic fertilizer according to any one of claims 1-5 in increasing the contents of growth hormones and phytoalexins and the activities of defense enzymes in crop roots, and / or in preventing and controlling diseases of the rhizome of wasabi, wherein the crop is wasabi; the growth hormone is at least one of salicylic acid (SA), jasmonic acid (JA), and ethylene (ET); the phytoalexin is camalexin, and the defense enzyme is at least one of chitinase and β-1,3-glucanase; the diseases of the rhizome are selected from at least one of black heart disease of wasabi and soft rot disease of wasabi, wherein, The pathogen causing the black heart disease of wasabi is Phoma wasabiae Phoma wasabiae Yokog., and the pathogen causing the soft rot disease of wasabi is Pectobacterium carotovorum Pectobacterium carotovorum subsp .carotovorum, carotovorum (Pcc).

7. A method for increasing the content of plant growth hormones and phytoalexins in crop roots, enhancing the activity of defense enzymes, and / or controlling root and stem diseases, characterized in that The method includes applying the biological organic fertilizer according to any one of claims 1-4 to the soil, and the dosage of the biological organic fertilizer applied to the soil is 100-200 kg / mu / time, and the application frequency during the whole growth period is 1 time.

Citation Information

Patent Citations

  • Bacillus amyloliquefaciens and application thereof

    CN116121103A

  • Preparation method and application of trichoderma yunnanense fermentation liquor for improving prevention and treatment effect on tea anthracnose

    CN117487668A

  • Microbial agent for preventing and treating angelica root knot nematode disease and application thereof

    CN119330786A

  • Microbial composition for preventing and treating eggplant rhizome diseases and application thereof

    CN119775079A

  • Composition including effervescent agents, biostimulant, nutrient, and pesticide

    US20220272987A1

Cited By

  • Microbial composition for preventing and treating tea tree root rot and application thereof

    CN121085710A

  • A microbial composition for preventing and controlling root rot in tea trees and its application

    CN121085710B

  • Application of camelinin in inducing plant immunity and enhancing plant disease resistance

    CN122397744A