Method for promoting decomposition of litters of coast paulownia

Abstract

The invention discloses a method for promoting decomposition of tung litters, which comprises the following steps: inoculating fungi to the tung litters, and culturing for 6-8 months; the fungus is one or more of Macrophomina sp., Coprinopsis cinerea and Microdiplodia sp., and the fungus is one or more of Coprinopsis cinerea, Microdiplodia sp., Coprinopsis cinerea, Microdiplodia sp., Coprinopsis cinerea and Microdiplodia sp. The method provided by the invention can significantly promote the decomposition of coast tung litters, and promote the nutrient circulation and energy flow of an ecological system.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant science. Specifically, the present invention relates to a method for promoting the decomposition of litter of Guettarda speciosa. Background Art

[0002] The decomposition of plant litter is a key process in nutrient cycling and energy flow in ecosystems, affecting ecosystem functions. The litter of the representative coral reef vegetation Guettarda speciosa contains relatively high levels of lignin and cellulose, and it also contains relatively high levels of salt, which is not conducive to the survival of decomposers, and its carbon-nitrogen ratio is usually relatively high. Therefore, the litter of Guettarda speciosa is relatively difficult to decompose. If its litter covers the forest floor for a long time, it is not conducive to the nutrient cycling of the ecosystem. In addition, due to its flammable characteristics, it is easy to cause forest fires, resulting in damage to the ecosystem and economic losses.

[0003] Phyllosphere fungi play a crucial role in the decomposition of plant litter. However, there is currently no research on how to use phyllosphere fungi of Guettarda speciosa litter to promote the decomposition of Guettarda speciosa litter, and more in-depth exploration is needed. Summary of the Invention

[0004] Based on this, the purpose of the present invention is to provide a method for enabling the litter of Guettarda speciosa to be decomposed rapidly.

[0005] The specific technical solutions for achieving the above invention purposes are as follows.

[0006] A method for promoting the decomposition of Guettarda speciosa litter, comprising the following steps: inoculating the Guettarda speciosa litter with fungi and culturing for 6 to 8 months; the fungi are one or more of Macrophomina sp., Coprinopsis cinerea, and Microdiplodia sp.

[0007] The present invention inoculated 9 pure strains screened from the surface of Guettarda speciosa litter onto the Guettarda speciosa litter at an appropriate inoculation amount, controlled the temperature and humidity within a specific range, and after culturing for a period of time, it was found that inoculating 4 of these fungi (Macrophomina sp., Coprinopsis cinerea, Microdiplodia sp., Microdiplodia sp.) onto the Guettarda speciosa litter could significantly increase the decomposition rate of the Guettarda speciosa litter, indicating that inoculating these fungi onto the Guettarda speciosa litter and culturing under certain conditions can significantly promote the decomposition of the Guettarda speciosa litter and promote the nutrient cycling and energy flow of the ecosystem.

[0008] The fungi that promote the decomposition of Guettarda speciosa litter in the present invention come from the leaf surfaces of the Guettarda speciosa plants themselves, which is beneficial to the attachment and growth of litter-decomposing strains. Description of the Drawings

[0009] Figure 1 It is the decomposition rate of Guettarda speciosa litter after inoculating different fungal strains in Example 2 of the present invention; wherein, Control: control, without inoculating strains; F1: Neoscytalidium sp.; F4: Microdiplodia sp.; F6: Deniquelata sp.; F7: Coprinopsis cinerea; F10: Macrophomina sp.; F11: Pseudopithomyces sp.; F12: Deniquelata sp.; F19: Deniquelata sp.; F20: Microdiplodia sp.; *: P<0.05, **: P<0.01. Detailed Embodiments

[0010] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosed content of the present invention more thorough and comprehensive.

[0011] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the description of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0012] Unless otherwise specified, the embodiments are all carried out under conventional experimental conditions, such as those in the Molecular Cloning: A Laboratory Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: A Laboratory Manual, 2013), or according to the conditions recommended by the manufacturer's instructions.

[0013] The inventors of the present invention isolated and screened 30 pure fungal strains from the leaf surface of the litter of Excoecaria agallocha. The screened fungal strains were identified by ITS sequence, and combined with their cultured colony morphology. According to experience, the inventors predicted that 9 of these fungi might have the effect of promoting the decomposition of Excoecaria agallocha litter. These 9 fungi were inoculated on the Excoecaria agallocha litter, and an optimized culture condition was adopted to conduct a 7-month decomposition culture experiment of Excoecaria agallocha litter. Finally, it was determined that Macrophomina sp., Coprinopsis cinerea, and Microdiplodia sp. could significantly promote the decomposition of Excoecaria agallocha litter. Especially after inoculating Microdiplodia sp. with the ITS sequence shown in SEQ ID NO:9, the decomposition rate of Excoecaria agallocha litter was the highest.

[0014] In some embodiments of the present invention, a method for promoting the decomposition of Excoecaria agallocha litter is disclosed, including the following steps: inoculating the Excoecaria agallocha litter with fungi and culturing for 6 to 8 months; the fungi are one or more of Macrophomina sp., Coprinopsis cinerea, and Microdiplodia sp.

[0015] In some embodiments, the ITS sequence of Microdiplodia sp. is as shown in SEQ ID NO:9 or SEQ ID NO:2, the ITS sequence of Coprinopsis cinerea is as shown in SEQ ID NO:4, and the ITS sequence of Macrophomina sp. is as shown in SEQ ID NO:5.

[0016] In some embodiments, the ITS sequence of Microdiplodia sp. is as shown in SEQ ID NO:9.

[0017] In some embodiments, 0.02 mg to 0.06 mg of the fungal mycelium is inoculated per gram of Excoecaria agallocha litter (dry weight).

[0018] In some embodiments, 0.03 mg to 0.05 mg of the fungal mycelium is inoculated per gram of Excoecaria agallocha litter (dry weight).

[0019] In some embodiments, 0.04 mg of the fungal mycelium is inoculated per gram of Excoecaria agallocha litter (dry weight).

[0020] In some embodiments, the culturing time is 6.5 to 7.5 months.

[0021] In some embodiments, the humidity during culturing is maintained at 15% to 25%.

[0022] In some of these embodiments, the humidity of the cultivation is maintained at 18% - 22%.

[0023] In some of these embodiments, the temperature of the cultivation is maintained at 23°C - 27°C.

[0024] In some of these embodiments, the temperature of the cultivation is maintained at 24°C - 26°C.

[0025] In some of these embodiments, a method for promoting the decomposition of Guettarda speciosa litter includes the following steps: inoculating Guettarda speciosa litter with Microdiplodia sp. having an ITS sequence as shown in SEQ ID NO: 9, maintaining a temperature of 24°C - 26°C and a humidity of 18% - 22%, and culturing for 6.5 to 7.5 months.

[0026] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0027] Example 1 Isolation and Identification of Fungi on the Surface of Guettarda speciosa Fallen Leaves

[0028] It includes the following steps:

[0029] 1. Rinse the Guettarda speciosa litter leaves with tap water and place them in a laminar flow hood to air dry.

[0030] 2. Randomly cut 0.5 x 0.5 mm 2 tissue pieces from the intact litter leaves, and perform surface disinfection and sterilization: soak them in 2% disinfectant solution for 15 s, soak them in 70% alcohol for 15 s, and rinse them 3 times with sterile water. Then, remove the tissue pieces and place them on sterilized filter paper to absorb the moisture.

[0031] 3. Transfer the dried tissue pieces to a PDA medium and place them in an incubator at 25°C (with a 12 / 12 hour light / dark cycle) for 5 - 7 days.

[0032] 4. When hyphae grow on the tissue pieces and form colonies, use sterile forceps to pick hyphal pieces from the edge of the colony and transfer them to a new PDA petri dish for purification culture, and a total of 30 fungal strains are obtained.

[0033] 5. DNA Extraction and Preliminary Identification

[0034] (1). Use a DNA extraction kit (SteadyPure Plant Genomic DNA Extraction Kit, Hunan Aikery Biotechnology Co., Ltd.) to extract and purify the genomic DNA of the fungal strains as the template for PCR amplification.

[0035] (2) The PCR reaction system uses a 2-step PCR system (Hunan Aikery Biotechnology Co., Ltd.). The PCR reaction procedure is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; and finally extension at 72°C for 10 min. Among them, the primer pair in the PCR reaction system is a specific primer pair for fungi, ITS5 (5’-GGAAGTAAAAGTCGTAACAAG G-3’, SEQ ID NO:10) / ITS4 (5’-TCCTCCGCTTATTGATATGC-3’, SEQ ID NO:11), to amplify a partial sequence of the fungal ribosomal transcription spacer for the preliminary identification of fungi.

[0036] (3) The obtained PCR product is sent to Sangon Biotech for sequencing, and the obtained sequence is submitted to the NCBI database for alignment and preliminary identification.

[0037] Through the identification of the fungal ITS sequence, 9 fungi that may promote the decomposition of Guettarda speciosa litter were obtained, namely F1 (Neoscytalidium sp., its ITS sequence is as shown in SEQ ID NO:1, the colony color is gray-brown, round), F4 (Microdiplodia sp., its ITS sequence is as shown in SEQ ID NO:2, the colony color is black, round), F6 (Deniquelata sp., its ITS sequence is as shown in SEQ ID NO:3, the colony color is yellow, oval), F7 (Coprinopsis cinerea, its ITS sequence is as shown in SEQ ID NO:4, the colony color is white, irregular), F10 (Macrophomina sp., its ITS sequence is as shown in SEQ ID NO:5, the colony color is yellow, round), F11 (Pseudopithomyces sp., its ITS sequence is as shown in SEQ ID NO:6, the colony color is yellow, irregular), F12 (Deniquelata sp., its ITS sequence is as shown in SEQ ID NO:7, the colony color is white, irregular), F19 (Deniquelata sp., its ITS sequence is as shown in SEQ ID NO:8, the colony color is white, round), F20 (Microdiplodia sp., its ITS sequence is as shown in SEQ ID NO:9, the colony color is gray-green, round).

[0038] F1 (Neoscytalidium sp., SEQ ID NO:1)

[0039] TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCG

[0040] AGGTCAACCTTGAGAAAGTTCAAAAGGTTCGTCCGGCGGGCGGCGCCGT

[0041] GCGCTCCAAAGCGAGGTGTTTTCTACTACGCTCGAGGCAAGACGCCACCG

[0042] CCGAGGTCTTCGAGGCGCGCCCGCGGAAGGGCGGTGCCCAACACCAAGC

[0043] AGAGCTTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATAC

[0044] CGAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAA

[0045] TTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAG

[0046] AGATCCGTTGTTGAAAGTTTTAGTTTATTGATTGTTTTTCAGACGGCAACGT

[0047] TCACTGACCGGAGTTTGATGGTCCTCTGGCGGGCGCTGGCCACCCCCCGG

[0048] ACGGAGGGCGGCCGCG

[0049] F4 (Microdiplodia sp., SEQ ID NO:2):

[0050] TTGGAAGTAAAAGTCGAACAAGTTCCTCCGCTTATTGATATGCTTAAGTTC

[0051] AGCGGGTATCCCTACCTGATCCGAGGTCAAAGACGGTGGTCATCTTGGGG

[0052] GTGGGTCGCGATCCCGGGAGCCGCTCCCTCGTCATGCGCATTCGTGCTGCG

[0053] CGAGAGGGGGGCGAGGGGACGCTGCCAATGGATTTGGGGCGAGTCCGCG

[0054] CGCGGAGGCGGGGACAGACGCCCAACACCAAGCAGAGCTTGAGGGTGTA

[0055] GATGACGCTCGAACAGGCATGCCCCATGGAATACCAAGGGGCGCAATGTG

[0056] CGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTATCGC

[0057] ATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCATTGTTGAAA

[0058] GTTGTAACGATTGTGTTTTGTATCGGAACGGGTGGTATGCTAGATGCAAAA

[0059] GGGGGTTTGTTGGTTCCGACG

[0060] F6 (Deniquelata sp., SEQ ID NO:3):

[0061] TTCCTCCGGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCC

[0062] GAGGTCAAAGACGGTGTGACGGTTGCTTGCTGGACGCGGTCCGCCGCGCC

[0063] TCGAGAAGCGCAATGTGCTGCGCGAGAGGGAGGCAAGGGCCGCCGCCAA

[0064] TGGATTTGGGGCGAGTCCGCGCGCGAAGGAGGCGGGACAGACGCCCAAC

[0065] ACCAAGCAGAGCTTGAGGGTGTAGATGACGCTCGAACAGGCATGCCCCAC

[0066] GGAATACCGAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAAT

[0067] TCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAG

[0068] AGCCAAGAGATCCATTGTTGAAAGTTGTAACGATTGTGGGTATCGGAACAG

[0069] GTAATGCTAGATGCAAAGAAGGGTTCGTTTTGCGGTTCCCACGGCAGGTC

[0070] GCCCCGCCGAGGGAGAACGAGAGGTACGAGTAGAGTAAGGATTCAGTCAT

[0071] GTGCGCGTGAAAGGGCTCCACGAGGAGCCCTACACCTCCCGGAGCTGGTT

[0072] CCCGTGCCGGCTGACCACTGTCGAGCCGGTCCGGGGCCTCGAGGGCCGCA

[0073] ACACACCCGCTAAAGCATAACGATTCGGGGAGCC

[0074] F7(Coprinopsis cinerea,SEQ ID NO:4):

[0075] TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTTGCCTGATTTG

[0076] AGGTCAAAATTGTCAAAAGTTGTCCAAGGGACGGTTAGAAGCAGGTCTTC

[0077] AAGTAACCAACCCAATCCACGGCGTAGATAATTATCACACCAATAGATTAG

[0078] GGGCACAACCCACTAATACATTTCAGAGGAGCAGACCACGAGAGTGGACC

[0079] TGCAACCCCCACATCCAAGCCTGCACACAACAAAGTTGGTGAGGTTGAGA

[0080] ATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAA

[0081] GGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTA

[0082] TCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCT

[0083] GAAAGTTGTATAGGTTTATAGGCACAAGGCCTTGAGATGACATTCCATAAC

[0084] ATTCAGTTTGGGGTGTGTAAGAAATCATAGACCTGGAAATTCATGGCAAGC

[0085] CGGCCTTCTTTCGAAAGCGACAGCAAGCCACGCATCCGCCTTGCGACGAG

[0086] AGGTATCCAGGCCTACAGTGTGTGC

[0087] F10(Macrophomina sp., SEQ ID NO:5):

[0088] TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCG

[0089] AGGTCAAAGACGGTGTGACGGTTGCTTGCTGGACGCGGTCCGCCGCGCCT

[0090] CGAGAAGCGCAATGTGCTGCGCGAGAGGGAGGCAAGGGCCGCCTTATTGA

[0091] TATGCTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTG

[0092] ATCCGAGGTCAACCTTGAGAAAAGTTCAGAAGGTTCGTCCGGCGGGCGAC

[0093] GCCTTACGCTCCGAAGCGAGGTGTATTTTACTACGCTTGAGGCAAGACGCC

[0094] ACCGCCGAGGTTTTTGAGGCGCGCCCGCAAAGGACGGTGCCCAATACCAA

[0095] GCAGAGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCCCCGGAAT

[0096] ACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGC

[0097] AATTCACATTACTTATCGCATTTCGGTGCGTTTTTCATCGATGCCAGAACCA

[0098] AGAGATCCGTTGTTGAAAGTTTTAGTTTATTTAATATTTTTTTCAGACTGCA

[0099] ACGTTTACTGACTGGAGTTTGATAGTCCTCTGGCGGGCACTAGCCACCCCC

[0100] CAAAATCGGGGGGCGGCCGGGG

[0101] F11(Pseudopithomyces sp., SEQ ID NO:6):

[0102] GGTGAATAGCCTCTGGTTGGTATGGGGTTCGCCCCTTCACGCTCACGCGTC

[0103] TGCCATCCTTACTTTACGAGCACCTTCTGTTCTCCCTCGGCAAGGGCCTCG

[0104] CCCTGCCGTTGGAACTACAAAACTCTTTTTTGCATCTAGCATTACCTGTTCC

[0105] GACAAAAACAATCGTTTACAACTTTCAACAATGGATCTCTTGGCTCTGGCA

[0106] TCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTC

[0107] AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGG

[0108] GGCATGCCTGTTCGAGCGTCATCTACACCCTCAAGCTCTGCTTGGTGTTGG

[0109] GCGTCTGTCCCGCCTCCGCGCGTGGACTCGCCCCAAATACATTGGCAGCG

[0110] GTCTTTGCCTCCTCTCGCGCAGCACATTGCGCTTCTCGAGGTGTCGCGGAC

[0111] ACGCGTCCAGTAAGCAACATTTACCGTCTTTGACCTCGG

[0112] F12(Deniquelata sp., SEQ ID NO:7):

[0113] TTCCTCCCGGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATC

[0114] CGAGGTCAAAGACGGTGTGACGGTTGCTTGCTGGACGCGGTCCGCCGCGC

[0115] CTCGAGAAGCGCAATGTGCTGCGCGAGAGGGAGGCAAGGGCCGCCGCCA

[0116] ATGGATTTGGGGCGAGTCCGCGCGCGAAGGAGGCGGGACAGACGCCCAA

[0117] CACCAAGCAGAGCTTGAGGGTGTAGATGACGCTCGAACAGGCATGCCCCA

[0118] CGGAATACCGAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAA

[0119] TTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCA

[0120] GAGCCAAGAGATCCATTGTTGAAAGTTGTAACGATTGTGGGTATCGGAACA

[0121] GGTAATGCTAGATGCAAAGAAGGGTTCGTTTTGCGGTTCCCACGGCAGGT

[0122] CGCCCCGCCGAGGGAGAACGAGAGGTACGAGTAGAGTAAGGATTCAGTCA

[0123] TGTGCGCGTGAAAGGGCTCCACGAGGAGCCCTACACCTCCCGGAGCTGGT

[0124] TCCCGTGCCGGCTGACCACTGTCGAGCCGGTCCGGGGCCTCGAGGGCCGC

[0125] AACACACCCGCTAAAGCATAACG

[0126] F19(Deniquelata sp., SEQ ID NO:8):

[0127] TTTCTCCGGCTTTTTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCC

[0128] GAGGTCAAAGACGGTGTGACGGTTGCTTGCTGGACGCGGTCCGCCGCGCC

[0129] TCGAGAAGCGCAATGTGCTGCGCGAGAGGGAGGCAAGGGCCGCCGCCAA

[0130] TGGATTTGGGGCGAGTCCGCGCGCGAAGGAGGCGGGACAGACGCCCAAC

[0131] ACCAAGCAGAGCTTGAGGGTGTAGATGACGCTCGAACAGGCATGCCCCAC

[0132] GGAATACCGAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAAT

[0133] TCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAG

[0134] AGCCAAGAGATCCATTGTTGAAAGTTGTAACGATTGTGGGTATCGGAACAG

[0135] GTAATGCTAGATGCAAAGAAGGGTTCGTTTTGCGGTTCCCACGGCAGGTC

[0136] GCCCCGCCGAGGGAGAACGAGAGGTACGAGTAGAGTAAGGATTCAGTCAT

[0137] GTGCGCGTGAAAGGGCTCCACGAGGAGCCCTACACCTCCCGGAGCTGGTT

[0138] CCCGTGCCGGCTGACCACTGTCGAGCCGGTCCGGGGCCTCGAGGGCCGCA

[0139] ACACACCCGCTAAAGCATAACGATTCG

[0140] F20(Microdiplodia sp., SEQ ID NO:9):

[0141] TTTCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCG

[0142] AGGTCAAAGACGGTGGTCATCTTGGGGGTGGGTCGCGATCCCGGGAGCCG

[0143] CTCCCTCGTCATGCGCATTCGTGCTGCGCGAGAGGGGGGCGAGGGGACGC

[0144] TGCCAATGGATTTGGGGCGAGTCCGCGCGCGGAGGCGGGGACAGACGCC

[0145] CAACACCAAGCAGAGCTTGAGGGTGTAGATGACGCTCGAACAGGCATGCC

[0146] CCATGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACT

[0147] GAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATG

[0148] CCAGAGCCAAGAGATCCATTGTTGAAAGTTGTAACGATTGTGTTTTGTATC

[0149] GGAACGGGTGGTATGCTAGATGCAAAAGGGGGTTTG

[0150] Example 2 Effects of Nine Different Phyllosphere Fungi on the Decomposition Rate of Guettarda speciosa L. Litter

[0151] In this example, after inoculating the Guettarda speciosa L. litter with 9 strains of fungi, a decomposition culture experiment was carried out. By controlling factors such as the inoculation amount, culture temperature, humidity, and time, fungi that could effectively promote the decomposition of Guettarda speciosa L. litter were screened. The specific method is as follows:

[0152] 1. Weigh 45 g of sand and 5 g of soil (sterilized, taken from the original place of Guettarda speciosa L. vegetation), put them into a wide-mouth culture bottle, and put 0.5 g of Guettarda speciosa L. litter that has been sterilized (121 °C, 20 min) into a litter bag and place it in the wide-mouth culture bottle (above the sand and soil);

[0153] 2. Inoculate 0.02 mg of the fungal mycelium isolated in Example 1 into the Guettarda speciosa L. litter respectively (n = 5), add sterile water to keep the water content at 20%, seal with plastic wrap, make holes, and then put it into an incubator for culturing in the dark at 25 °C; during the culturing process, regularly supplement sterile water to maintain a water content of 20%.

[0154] 3. After 7 months, weigh the litter bags, and perform statistical analyses such as one-way ANOVA using the software IBM SPSS 23, and plot the graph using the software SigmaPlot 14. The results are as Figure 1 shown.

[0155] From Figure 1It can be seen that inoculating the litter of Guettarda speciosa with F4 (Microdiplodia sp.), F7 (Coprinopsis cinerea), F10 (Macrophomina sp.), and F20 (Microdiplodia sp.) can significantly promote the decomposition of the litter of Guettarda speciosa. Among them, after inoculating with F20 (Microdiplodia sp.), the decomposition rate of the litter of Guettarda speciosa is the highest (P<0.01).

[0156] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of concise description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0157] The above-described embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it cannot be understood as a limitation to the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent should be subject to the appended claims.

Claims

1. A method for promoting the decomposition of Guettarda speciosa litter, characterized in that, It includes the following steps: Inoculate the litter of Guettarda speciosa with fungi and culture for 6 to 8 months; the fungi are one or more of Macrophomina sp., Coprinopsis cinerea, and Microdiplodia sp.

2. The method for promoting the decomposition of Guettarda speciosa litter according to claim 1, characterized in that, The ITS sequence of the said Microdiplodia sp. is as shown in SEQ ID NO:9 or SEQ ID NO:2, the ITS sequence of the said Coprinopsis cinerea is as shown in SEQ ID NO:4, and the ITS sequence of Macrophomina sp. is as shown in SEQ ID NO:

5.

3. The method for promoting the decomposition of Guettarda speciosa litter according to claim 1, wherein Inoculate 0.02 mg to 0.06 mg of fungal mycelium per g of the litter of Guettarda speciosa.

4. The method for promoting the decomposition of Guettarda speciosa litter according to claim 3, characterized in that, Inoculate 0.03 mg to 0.05 mg of fungal mycelium per g of the litter of Guettarda speciosa.

5. The method for promoting the decomposition of Guettarda speciosa litter according to claim 1, characterized in that, The culture time is 6.5 to 7.5 months.

6. The method for promoting the decomposition of Guettarda speciosa litter according to claim 5, wherein The humidity during the culture is maintained at 15% to 25%.

7. The method for promoting the decomposition of Guettarda speciosa litter according to claim 6, wherein The humidity during the culture is maintained at 18% to 22%.

8. The method for promoting the decomposition of Guettarda speciosa litter according to claim 1, wherein The temperature during the culture is maintained at 23°C to 27°C.

9. The method for promoting the decomposition of Guettarda speciosa litter according to claim 8, characterized in that, The temperature during the culture is maintained at 24°C to 26°C.

10. The method for promoting the decomposition of Guettarda speciosa litter according to claim 1, wherein It includes the following steps: Inoculate the litter of Guettarda speciosa with Microdiplodia sp. whose ITS sequence is as shown in SEQ ID NO:9, maintain the temperature at 24°C to 26°C and the humidity at 18% to 22%, and culture for 6.5 to 7.5 months.

Images