Salt-tolerant enterococcus faecium capable of degrading tyrosine and application of enterococcus faecium

Abstract

The invention relates to a salt-tolerant enterococcus faecium capable of degrading tyrosine and application thereof, and belongs to the technical field of food microorganisms, the enterococcus faecium is preserved in Guangdong Microbial Culture Collection Center on March 10, 2025, the preservation number is GDMCC No: 65991, and the preservation unit address is No.59 building, No.100 Courtyard, Xianlie Middle Road, Guangzhou City, Guangdong Province. The strain disclosed by the invention can survive in high-salt fermented food, has the capability of efficiently decomposing tyrosine, can effectively reduce the risk of producing white spots (tyrosine crystals) in a fermented product, and has a relatively good application prospect in the high-salt fermented food industry.

Description

Technical Field

[0001] The present invention relates to the technical field of food microbiology, and specifically refers to a strain of Enterococcus faecium that is salt-tolerant and capable of degrading tyrosine and its application. Background Art

[0002] During the food fermentation production process, the addition amount of table salt is usually increased to inhibit the growth of miscellaneous bacteria, thereby preventing food spoilage. However, the high-salt environment limits the number of strains that can survive and play a role. In addition, some high-protein foods, especially ingredients with a high tyrosine content, will gradually hydrolyze during the fermentation process, and the proteins therein are decomposed by some strains to produce tyrosine. Due to the low solubility of tyrosine (only 450 mg / L in water at room temperature), during the long-term fermentation process, tyrosine will gradually accumulate and crystallize out, and finally form white spots of different sizes and shapes on the surface of fermented foods such as doubanjiang, soybean paste, and fermented bean curd. This phenomenon not only affects the appearance quality of the food, but may also have an adverse impact on its sensory quality. The products with white spots will be terminated from being listed and sold due to poor appearance quality, which brings no small losses to enterprises.

[0003] According to past research, there are methods of using microorganisms to inhibit the generation of white spots during the production of fermented foods. For example, the invention patent with the authorized publication number of CN111423988B discloses a method for brewing soybean paste by adding salt-tolerant bacteria to reduce the content of free tyrosine in the fermented mash. The isolated salt-tolerant bacteria (Pichia farinosa) can be used in the soybean paste brewing process to consume tyrosine and reduce the risk of white spots in soybean paste. The invention patent with the authorized publication number of CN116814446A discloses a strain of Aspergillus oryzae that can utilize tyrosine and does not produce tyramine and its application. Previous inventions related to the decomposition of tyrosine mentioned fungi such as the genus Saccharomyces and the genus Aspergillus, but the research on bacteria was not mentioned.

[0004] Current research on Enterococcus faecium shows that this strain can produce lactic acid, belongs to the lactic acid bacteria category, and is also a normal flora existing in the human and animal bodies. It can metabolize and produce substances such as organic acids, hydrogen peroxide, and bacteriocins. These substances have the effects of inhibiting pathogenic bacteria and spoilage bacteria, regulating the microecological environment of the host intestinal flora, regulating immune responses, promoting the digestion and absorption of nutrients, and improving immunity. The lactic acid produced by it can reduce the intestinal pH and inhibit the growth of pathogenic bacteria.

[0005] Therefore, it is of great significance to develop salt-tolerant bacteria with high probiotic characteristics such as high acid tolerance and high bile salt tolerance. Summary of the Invention

[0006] The present invention aims to solve the above technical problems and provides a strain of Enterococcus faecium that has the function of efficiently decomposing tyrosine in a high-salt food matrix and has high probiotic characteristics such as high acid tolerance and high bile salt tolerance.

[0007] To solve the above technical problems, the technical solution provided by the present invention is as follows:

[0008] A strain of Enterococcus faecium that is salt-tolerant and can degrade tyrosine. The Enterococcus faecium was deposited at the Guangdong Provincial Culture Collection Center of Microorganisms on March 10, 2025, with the deposit number: GDMCC No: 65991, the taxonomic name Enterococcus faecium, and the address of the deposit unit is Building 59, No. 100, Xianlie Middle Road, Guangzhou, Guangdong Province.

[0009] Application of a strain of Enterococcus faecium that is salt-tolerant and can degrade tyrosine in the preparation of fermented foods.

[0010] Preferably, the fermented foods include broad bean paste, chili sauce, and preserved beancurd.

[0011] The beneficial effects of the present invention at least include:

[0012] The strain of the present invention can effectively decompose tyrosine, thereby effectively reducing the risk of white spots in fermented products, and can survive in an environment with a high salt content, has beneficial characteristics such as high salt tolerance, and has good application prospects in the high-salt fermented food industry.

[0013] The above summary is only for the purpose of the specification and is not intended to be limiting in any way. In addition to the above-described illustrative aspects, embodiments, and features, further aspects, embodiments, and features of the present invention will be readily apparent by reference to the drawings and the following detailed description. Brief Description of the Drawings

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present application. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0015] Figure 1 It is the colony morphology of Enterococcus faecium KUST4312 screened and isolated by the present invention;

[0016] Figure 2 It is the Gram staining microscopic examination result of Enterococcus faecium KUST4312 of the present invention (100× / 1.25μm, oil immersion lens);

[0017] Figure 3 It is the chromatogram of the tyrosine standard detected by liquid phase;

[0018] Figure 4It is a chromatogram of detecting the tyrosine content in the sample fermented by Enterococcus faecium KUST4312 of the present invention through liquid phase detection;

[0019] Figure 5 It is a standard curve of detecting tyrosine by liquid phase;

[0020] Figure 6 It is a summary chart of the tyrosine content in each fermentation group when detecting the tyrosine degradation performance of each strain;

[0021] Figure 7 It is a summary chart of the tyrosine content in each fermentation group when verifying the tyrosine degradation by Enterococcus faecium KUST4312 of the present invention;

[0022] Figure 8 It is a result chart of the hemolytic experiment. Detailed Embodiments

[0023] Now, the specific embodiments of the present invention will be described in detail. Although the present invention is described in connection with these specific embodiments, it should be understood that it is not intended to limit the present invention to these specific embodiments. On the contrary, these embodiments are intended to cover alternatives, modifications, or equivalent embodiments that may be included within the spirit and scope of the invention defined by the claims. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. The present invention may be practiced without some or all of these specific details. In other instances, well-known process operations have not been described in detail in order not to unnecessarily obscure the present invention.

[0024] When used in conjunction with the terms "comprising", "the method comprises", or similar language in this specification and the appended claims, the singular forms "a", "an", "the" include plural references unless the context clearly indicates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which the present invention belongs.

[0025] The present invention will be further described in detail below in conjunction with the full text.

[0026] Combined with the attached Figures 1-8 , the present invention provides a strain of Enterococcus faecium KUST4312 that is salt-tolerant and can decompose tyrosine. It is preserved in the Guangdong Provincial Microbial Culture Collection Center (abbreviated as GDMCC), with the preservation number: GDMCC No: 65991. The address of the preservation unit is Building 59, No. 100, Xianlie Middle Road, Guangzhou, Guangdong Province, and the preservation date is March 10, 2025.

[0027] Strain source: Doubanjiang sold on the market.

[0028] Screening media: MRS solid medium, MRS solid medium supplemented with 10% sodium chloride, MRS liquid medium with C and N sources reduced and supplemented with 10% sodium chloride and 450 mg / L tyrosine, MRS liquid medium with a tyrosine content of 450 mg / L;

[0029] Cultivation conditions: The liquid medium is cultured on a shaker at 37 °C and 200 rpm / min, and the solid medium is cultured in a constant temperature incubator at 37 °C;

[0030] Screening of strains: The doubanjiang sample is fully dissolved in water to prepare a sample solution. Two methods are used for screening bacteria. One method is gradient dilution of the sample solution. 200 μL of the sample solution at an appropriate concentration is spread on the salt-added MRS solid medium and cultured for 48 h. Then, single colonies with different morphologies are picked and streaked and purified on the solid medium. After three generations of purification, they are sent to a testing company for sequencing to identify the strains. At the same time, the tested strains are dispensed into different cryopreservation tubes and stored frozen; The other method is to add 200 μL of the sample solution to the MRS liquid medium containing salt and tyrosine but with C and N reduced and enrich for 72 h. Then, 200 μL of the enriched culture solution is spread on the solid medium, and the subsequent experimental steps are carried out according to the first method;

[0031] Screening of tyrosine-decomposing strains: Multiple strains including Enterococcus faecium KUST4312 screened out are inoculated into the medium containing tyrosine, and the tyrosine content in the fermentation broth is detected after culturing for 72 h;

[0032] Detection of tyrosine content: The tyrosine content in the fermentation groups of different strains is detected by high-performance liquid chromatography (HPLC). Tyrosine was not detected in the fermentation group of Enterococcus faecium KUST4312;

[0033] The strains involved in the present invention can be used in fermented foods prone to tyrosine white spots such as doubanjiang, soybean paste, and fermented bean curd.

[0034] Example 1:

[0035] I. Isolation and identification of strains.

[0036] 1. Isolation of strains:

[0037] Take two fermented samples of doubanjiang and chili sauce, add sterile water and vortex to fully wash out the bacteria on the surface of the samples. The sample solutions are sequentially diluted to 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7Concentration: Take 200 μL of the sample solution with an appropriate concentration and spread it on the solid MRS medium with added salt. The culture temperature is 37 °C, the culture time is 48 h, and aerobic culture is carried out to obtain salt-tolerant strains. Then, pick the bacteria with different colony morphologies on each plate and streak them on a new medium for isolation. After three generations of purification, pick single colonies and inoculate them into the MRS liquid medium for enlarged culture. After 12 h of culture, preserve the bacterial solution in a glycerol cryopreservation tube and simultaneously conduct PCR identification. The formula of the solid MRS medium with added salt used is: sodium chloride 100 g / L, peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, Tween-80 1 g / L, dipotassium hydrogen phosphate 2.0 g / L, sodium acetate anhydrous 5.0 g / L, sodium citrate 2 g / L, magnesium sulfate heptahydrate 0.2 g / L, manganese sulfate pentahydrate 0.054 g / L, agar powder 15 g / L.

[0038] In addition, add 200 μL of the sample solution in the above step to the medium with added salt and tyrosine for enrichment culture for 72 h. Then, sequentially dilute the enriched culture solution to 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 concentrations. Take 200 μL of the sample solution with an appropriate concentration and spread it on the MRS solid medium. The subsequent steps are carried out according to the above steps. The formula of the tyrosine enrichment medium used is the MRS medium minus C and N sources plus tyrosine: tyrosine 450.0 mg / L, sodium chloride 100 g / L, peptone 1.0 g / L, beef extract 1.0 g / L, yeast extract 1.0 g / L, glucose 1.0 g / L, Tween-80 1 g / L, dipotassium hydrogen phosphate 2.0 g / L, sodium acetate anhydrous 5.0 g / L, sodium citrate 2 g / L, magnesium sulfate heptahydrate 0.2 g / L, manganese sulfate pentahydrate 0.054 g / L.

[0039] Observe the grown colonies. The Enterococcus faecium KUST4312 strain of the present invention is shown in Figure 1 . The colonies are round, of moderate size, milky white in color, and smooth on the surface.

[0040] Drop a drop of sterile water on a clean slide, pick a small amount of bacteria with a sterile inoculation loop and spread it in the sterile water. Pass it through the flame of an alcohol lamp, dry it, and then conduct Gram staining and microscopic examination. The strain KUST4312 of the present invention is a Gram-positive bacterium, and the results are shown in Figure 2 .

[0041] 2. Identification of strains

[0042] Table 1 Primer information

[0043] Primer Name Sequence 5′-3′ 27F AGAGTTTGATCCTGGCTCAG 1492R GGTTACCTTGTTACGACTT

[0044] PCR amplification: Using the strain DNA as a template, the 16S rRNA universal primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′) were selected. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and PCR amplification was performed on the synthesized primers.

[0045] PCR amplification system: 2 μL of DNA template, 25 μL of 2×Taq PCR Master Mix, 2 μL of primer 27F, 2 μL of primer 1492R, and 19 μL of sterile water. PCR amplification conditions: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min; annealing at 58°C for 1 min; extension at 72°C for 2 min, for 29 cycles; and then extension at 72°C for 10 min. The sequencing results were compared and analyzed in the NCBI database, and the results showed that the strain KUST4312 was Enterococcus faecium.

[0046] II. Detection of the tyrosine-decomposing performance of the strain

[0047] The strains screened from doubanjiang and chili sauce in the early stage were inoculated into MRS and LB liquid media with a tyrosine content of 450 mg / L (the LB medium was used to culture Bacillus, and the formula was: peptone 10 g / L, yeast extract powder 5 g / L, sodium chloride 10 g / L). There were three parallels for each strain, and the medium with tyrosine added but without inoculation was used as a blank control. After culturing for 3 days, the fermentation broth was taken for detection using HPLC.

[0048] 1. HPLC detection

[0049] According to the method in (XU S. Construction of a heat-inducible Escherichia coli strain for efficient de novo biosynthesis of l-tyrosine [J / OL]. Process Biochemistry, 2020, 92: 85-92.), liquid-phase detection was performed on the fermentation broth.

[0050] Sample pretreatment: Dilute the fermentation broth and 4 mol / L HCl in a ratio of 1:1, and oscillate at 37 °C and 200 rpm / min on a shaker for 1 h to ensure complete dissolution of tyrosine. Centrifuge at 3000 g / min for 5 min to remove insoluble bacteria, and collect the supernatant. Take a certain volume of the supernatant and further dilute it with 0.1 mol / L HCl to a concentration within the calibration standard range, vortex mix, and centrifuge at 12000 rpm / min for 10 min to remove insoluble impurities. After centrifugation, take the supernatant and filter it through a 0.22 μm aqueous filter membrane into a liquid phase vial for testing.

[0051] Standard curve concentration preparation: Prepare a 200 mg / L tyrosine solution, and then dilute its concentration to 10, 50, 100, 150 mg / L, a total of five concentration gradients.

[0052] HPLC conditions: Use an Agilent C18 chromatographic column (250 mm × 4.6 mm, 5 μm), mobile phase A is 0.1 mol / L sodium acetate, adjust the pH to 4.0 ± 0.05 with glacial acetic acid, mobile phase B is methanol, the ratio of A and B phases is 90:10, the flow rate is 1.0 mL / min, the detection wavelength on the ultraviolet detector is 280 nm, the column temperature is 30 °C, the injection volume is 10 μL, and the detection time is 10 min.

[0053] 2. HPLC detection results

[0054] After liquid phase detection, the chromatographic peaks of the standard product are shown in Figure 3 ; the chromatographic peaks of the fermentation sample are shown in Figure 4 ; the tyrosine standard curve is shown in Figure 5 ; use the data analysis method built into the liquid chromatography to automatically obtain the results. After summarization, the tyrosine content in each fermentation group is shown in Figure 6 .

[0055] By analyzing the tyrosine content in each fermentation group, it can be seen that the content in the Enterococcus faecium fermentation group is significantly lower than that in other groups. It is preliminarily determined that Enterococcus faecium has the property of decomposing tyrosine.

[0056] III. Verification of the performance of strain KUST4312 in decomposing tyrosine:

[0057] Use the Weissella fermentation tyrosine group as a control, and add a blank group of MRS medium without added tyrosine. The remaining conditions remain unchanged according to the above steps.

[0058] After summarization, the tyrosine content in each fermentation group in this verification experiment is shown in Figure 7 . In the Enterococcus faecium fermentation group, no tyrosine component was detected in all three parallels, indicating that this strain can indeed degrade tyrosine.

[0059] IV. Verification of the hemolytic property of strain KUST4312:

[0060] The hemolytic property of the strain KUST4312 of the present invention was verified using a blood agar plate containing defibrinated sheep blood.

[0061] A single colony of strain KUST4312 on a common MRS medium was picked and streaked on the blood agar plate. After culturing for 48 h, the hemolysis situation was observed. The results are shown in Figure 8 .

[0062] After observing the experimental results, there was neither a greenish zone nor a clear zone around the single colony of strain KUST4312, that is, this strain is not hemolytic.

[0063] In summary, the strain of the present invention can degrade tyrosine white spots in fermented foods, effectively decompose tyrosine, thereby effectively reducing the risk of white spots in fermented products. It can survive in an environment with a high salt content and has probiotic characteristics such as high salt tolerance, and has good application prospects in the high-salt fermented food industry.

[0064] The above describes the present invention and its implementation manners. Such a description is not restrictive. What is shown throughout the text is only one of the implementation manners of the present invention, and the actual structure is not limited thereto. Generally speaking, if those of ordinary skill in the art are inspired by it and design, without creative efforts, a structural manner and an embodiment similar to the technical solution without departing from the gist of the present invention, they shall fall within the protection scope of the present invention.

Claims

1. An Enterococcus faecium strain that is salt-tolerant and can degrade tyrosine, characterized in that, The Enterococcus faecium described above was deposited at the Guangdong Microbial Culture Collection Center on March 10, 2025, with the deposit number: GDMCC No: 65991.

2. Use of a strain of Enterococcus faecium that is salt-tolerant and can degrade tyrosine as described in claim 1 in the preparation of fermented foods.

3. The application according to claim 2, wherein: The fermented foods described above include broad bean paste, chili sauce, and fermented bean curd.

Images