Bacillus subtilis for producing dextrin debranching enzyme and fermentation production method thereof

Abstract

The invention discloses bacillus subtilis for producing dextrin debranching enzyme and a fermentation production method thereof, and belongs to the technical field of fermentation engineering. According to the invention, the dextrin debranching enzyme is heterologously expressed in the bacillus subtilis by adopting a pP43nmk carrier, so that the high-efficiency expression of the dextrin debranching enzyme in the bacillus subtilis is realized. Furthermore, the fermentation method is optimized, and the enzyme production activity of the recombinant bacillus subtilis reaches 6026U / mL to the maximum extent.

Description

Technical Field

[0001] The present invention relates to a Bacillus subtilis producing dextrin debranching enzyme and a fermentation production method thereof, belonging to the technical field of fermentation engineering. Background Art

[0002] Starch debranching enzyme (SDBE) is an important enzyme for starch processing, which can specifically hydrolyze α-1,6 glycosidic bonds in starch and its related polysaccharides, removing the branched structure in the substrate. At present, starch debranching enzymes are mainly divided into two categories: pullulanase and isoamylase. Although pullulanase can efficiently hydrolyze α-1,6 glycosidic bonds in pullulan polysaccharide and limit dextrin, its debranching efficiency for macromolecular starch is low, and it has almost no hydrolysis effect on glycogen with very dense branches; isoamylase tends to hydrolyze macromolecular amylopectin, but its debranching efficiency for small molecule substrates such as maltodextrin is low. Both enzymes have limitations in substrate specificity and action range, and it is difficult to effectively improve the conversion rate of starch in the production of special starch sugars. Therefore, selecting a suitable SDBE for the production of starch sugar is the key to improving the conversion rate of starch raw materials and the product yield.

[0003] Dextrin debranching enzyme (Saccharolobus solfataricus STB09 glycogen debranching enzyme, SsGDE) is a novel amylase derived from the thermophilic archaeon Saccharolobus solfataricus STB09, with high debranching efficiency and strong substrate specificity, and is especially suitable for the production of starch sugars such as functional oligosaccharides and cyclodextrin. In addition, the excellent thermal stability of SsGDE is more suitable for the production of starch sugar under high temperature conditions. The inventors previously carried out molecular modification on the dextrin debranching enzyme derived from thermophilic archaea as the parental enzyme, obtained a series of mutants with improved enzyme activity, and optimized and improved the debranching efficiency and substrate specificity of the wild-type dextrin debranching enzyme, creating better application conditions for the enzyme in practical applications.

[0004] However, the expression of dextrin debranching enzyme is still limited to Escherichia coli at present, which restricts its wide application in food. When the dextrin debranching enzyme mutant is expressed in Bacillus subtilis, its enzyme activity and expression level are low, resulting in the failure to fully explore its functional value and industrial potential, and seriously restricting its industrial production and application. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a method for fermenting Bacillus subtilis to produce dextrin debranching enzyme. A genetically engineered bacterium B. subtilis WB600 (Ssgde / pP43nmk) expressing SsGDE was constructed, and a 2L shake flask fermentation medium was used as the fermentation vessel to optimize the fermentation conditions of the recombinant Bacillus subtilis, significantly improving the enzyme activity level of the recombinant Bacillus subtilis producing recombinant dextrin debranching enzyme. The steps include activating the recombinant Bacillus subtilis to obtain a seed culture solution; inoculating the seed culture solution into the fermentation medium for fermentation culture. By controlling the feeding dose and time, the colony density is controlled to increase the yield and activity of the enzyme expressed by the strain. Compared with the existing fermentation technology, this method effectively reduces manpower, financial resources and material resources, and at the same time can well conduct multi-parallel and multi-group control experiments, thus providing technical support for the industrial production of dextrin debranching enzyme. The present invention is achieved through the following technical solutions:

[0006] The first object of the present invention is to provide a Bacillus subtilis producing dextrin debranching enzyme, wherein the Bacillus subtilis uses pP43nmk as a vector and heterologously expresses dextrin debranching enzyme.

[0007] In one embodiment of the present invention, the dextrin debranching enzyme is a dextrin debranching enzyme with an amino acid sequence as shown in SEQ ID NO.2, or a dextrin debranching enzyme with dextrin debranching enzyme activity having more than 90% homology thereto. In a preferred embodiment, one or more amino acids of the dextrin debranching enzyme with an amino acid sequence as shown in SEQ ID NO.2 are substituted, inserted and / or deleted.

[0008] In one embodiment of the present invention, the coding nucleic acid sequence of the dextrin debranching enzyme is as shown in SEQ ID NO.1.

[0009] In one embodiment of the present invention, the Bacillus subtilis uses Bacillus subtilis WB600, Bacillus subtilis WB800 or Bacillus subtilis 168 as the host cell.

[0010] In one embodiment of the present invention, the nucleotide sequence of pP43nmk is as shown in SEQ ID NO.3.

[0011] The second object of the present invention is to provide a method for constructing the Bacillus subtilis producing dextrin debranching enzyme, comprising the following steps: connecting the coding gene of the dextrin debranching enzyme to the vector pP43nmk to obtain an expression vector; introducing the expression vector into the Bacillus subtilis host cell to obtain a Bacillus subtilis heterologously expressing dextrin debranching enzyme.

[0012] The third object of the present invention is to provide a method for fermentatively producing dextrin debranching enzyme, comprising the following steps: fermenting and culturing the Bacillus subtilis producing dextrin debranching enzyme in a fermentation medium to express dextrin debranching enzyme; and during the fermentation culture process, starting carbon source feeding at 45 h to 50 h of fermentation and stopping carbon source feeding at 70 h to 75 h of fermentation.

[0013] In one embodiment of the present invention, the method further comprises starting nitrogen source feeding at 80 h to 86 h of fermentation and stopping nitrogen source feeding at 92 h to 100 h of fermentation.

[0014] In one embodiment of the present invention, the carbon source feeding is to add glucose to the fermentation broth to a glucose concentration of 1 to 3 g / L when the residual sugar concentration in the fermentation broth is lower than 0.3 to 0.4 g / L.

[0015] In one embodiment of the present invention, the feeding medium for carbon source feeding is 400 to 600 g / L glucose.

[0016] In one embodiment of the present invention, the nitrogen source feeding is to add a nitrogen source medium at a flow rate of 0.05 to 0.15 g / L / h of yeast powder.

[0017] In one embodiment of the present invention, the nitrogen source medium comprises 100 to 140 g / L of soy peptone and 220 to 260 g / L of yeast powder.

[0018] In one embodiment of the present invention, the fermentation medium comprises 10 to 15 g / L of soy peptone, 20 to 30 g / L of yeast powder, 1 to 10 g / L of glucose, 2 to 3 g / L of KH2PO4, and 10 to 20 g / L of K2HPO4·3H2O.

[0019] In one embodiment of the present invention, the method specifically comprises the following steps:

[0020] S1. Activating the Bacillus subtilis producing dextrin debranching enzyme on an LB plate, and culturing it in an LB seed medium to obtain a seed culture solution; wherein, the conditions for seed culture are shaking flask culture at 35 to 38 °C and 150 to 250 rpm for 5 to 12 h;

[0021] S2. Inoculating the seed culture solution into the fermentation medium at a volume percentage of 2% to 6%, performing shaking flask fermentation at 28 to 32 °C and 150 to 250 rpm, and during the fermentation culture process, starting carbon source feeding at 45 h to 50 h of fermentation and stopping carbon source feeding at 70 h to 75 h of fermentation; starting nitrogen source feeding at 80 h to 86 h of fermentation and stopping nitrogen source feeding at 92 h to 100 h of fermentation.

[0022] The fourth object of the present invention is to provide the application of the Bacillus subtilis producing the dextrin debranching enzyme in starch processing.

[0023] In one embodiment of the present invention, the application at least includes one of the following features:

[0024] (1) The application includes hydrolyzing α-1,6 glycosidic bonds or hydrolyzing substances containing α-1,6 glycosidic bonds or starch branches;

[0025] (2) The application includes hydrolyzing starch or dextrin.

[0026] In one embodiment of the present invention, the starch includes at least one of corn starch, wheat starch, rice starch, potato starch, and cassava starch.

[0027] In one embodiment of the present invention, the dextrin includes maltodextrin with a DE value of 2-25.

[0028] The fifth object of the present invention is to provide the application of the method for fermentatively producing dextrin debranching enzyme in starch processing, and the application is to perform starch processing with the dextrin debranching enzyme produced by the method.

[0029] In one embodiment of the present invention, the application at least includes one of the following features:

[0030] (1) The application includes hydrolyzing α-1,6 glycosidic bonds or hydrolyzing substances containing α-1,6 glycosidic bonds or starch branches;

[0031] (2) The application includes hydrolyzing starch or dextrin.

[0032] In one embodiment of the present invention, the starch includes at least one of corn starch, wheat starch, rice starch, potato starch, and cassava starch.

[0033] In one embodiment of the present invention, the dextrin includes maltodextrin with a DE value of 2-25.

[0034] In the present invention, from the perspective of the fermentation process, in the initial stage of fermentation (0-48 h), the cell density is relatively low, and the hydrolysis activity of SsGDE is also relatively low. When the fermentation time reaches 48 h, the cell density reaches the highest value, and at this time, the hydrolysis activity of SsGDE begins to increase significantly, and the protein secretion amount is relatively stable; when the fermentation time reaches 96 h, the enzyme activity and expression level can basically reach the highest level. After the fermentation time exceeds 96 h, the expression level of SsGDE decreases, and the enzyme activity also decreases, which may be because the strain enters the stable or declining stage of growth, resulting in a slowdown in metabolic activities.

[0035] In terms of protein expression mode, in the first stage (0 - 48 h), intracellular substances gradually accumulate as the cells grow until the cell membrane activity is triggered. At this time, the cell membrane permeability suddenly increases, resulting in a large amount of substances inside the cell, including mature enzymes, being excreted. This is related to the defense mechanism for maintaining cell homeostasis. In the second stage (48 - 96 h), due to apoptosis and necrosis of the cells, real damage occurs to the cell membrane, leading to further secretion of the enzymes inside the cell. These two stages jointly promote the non-classical extracellular secretion of pullulan debranching enzyme.

[0036] Therefore, in the present invention, to increase the protein expression level, the cell density can be increased in the early stage of fermentation, and then a certain nutritional condition can be maintained to keep the cell permeability in a relatively strong state. Therefore, in the present invention, carbon source feeding is selected to be carried out within 48 - 72 h of fermentation, and nitrogen source feeding is selected to be carried out within 84 - 96 h of fermentation.

[0037] The above technical solution of the present invention has the following advantages compared with the prior art:

[0038] In the present invention, pullulan debranching enzyme is heterologously expressed in Bacillus subtilis by using the pP43nmk vector, realizing the high-efficient expression of pullulan debranching enzyme in Bacillus subtilis. Further, in the present invention, by optimizing the fermentation method, carbon source feeding starts at 48 hours of fermentation culture, and a carbon source starvation stage is introduced at 72 - 96 hours. The feeding of carbon source is stopped during this stage, realizing a substantial increase in the activity of pullulan debranching enzyme. Combined with nitrogen source feeding, the enzyme production activity of recombinant Bacillus subtilis in a 2 L shake flask medium in this fermentation system reaches up to 6026 U / mL at most. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is the SDS-PAGE diagram of the fermentation supernatant of recombinant Bacillus subtilis in a 250 mL shake flask in Example 2 of the present invention. Among them, lane M is the standard protein, lane 1 is the fermentation supernatant, and lane 2 is the purified enzyme solution;

[0040] Figure 2 It is the measurement curve of the optimal reaction temperature and thermal stability of SsGDE enzyme in Example 3 of the present invention. Among them, A reflects the change of SsGDE enzyme activity with the reaction temperature, and B reflects the thermal stability of SsGDE enzyme;

[0041] Figure 3 It is the measurement curve of the optimal pH and pH stability of SsGDE enzyme in Example 4 of the present invention. Among them, A reflects the change of SsGDE enzyme activity with the reaction pH, and B reflects the pH stability of SsGDE enzyme;

[0042] Figure 4This is the growth and enzyme production curves of the recombinant Bacillus subtilis in Example 5 of the present invention at different fermentation temperatures. Among them, A reflects the change of the cell density of the recombinant bacteria with the fermentation time, and B reflects the change of the activity of the SsGDE enzyme;

[0043] Figure 5 This is the SDS-PAGE diagram of the enzyme production of the recombinant Bacillus subtilis in Example 5 of the present invention at different fermentation temperatures. Among them, the lane M is the standard protein, and 12 - 108 represents the fermentation time;

[0044] Figure 6 This is the enzyme production of the growth and enzyme production curves of the recombinant Bacillus subtilis in Example 6 of the present invention at different carbon source feeding times. Among them, A reflects the change of the cell density of the recombinant bacteria with the fermentation time, and B reflects the change of the activity of the SsGDE enzyme; Among them, the icon is represented by "feeding start time - feeding end time", for example, "24 - 72" represents starting the feeding process from 24 h of fermentation and stopping feeding after 72 h of fermentation;

[0045] Figure 7 This is the enzyme production of the growth and enzyme production curves of the recombinant Bacillus subtilis in Example 7 of the present invention at different nitrogen source feeding times. Among them, A reflects the change of the cell density of the recombinant bacteria with the fermentation time, and B reflects the change of the activity of the SsGDE enzyme; Among them, the icon is represented by "ST feeding start time", for example, "ST48" represents starting the feeding process from 48 h of fermentation. Detailed implementation manners

[0046] The present invention discloses a method for fermenting Bacillus subtilis to produce dextrin debranching enzyme, and those skilled in the art can appropriately improve and implement it by referring to the content of this article. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The method and application of the present invention have been described through preferred embodiments, and those related can obviously make changes or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0047] Terms:

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs. The terms used in the specification of this application herein are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0049] In the present application, the term "dextrin debranching enzyme" refers to a protein having starch debranching enzyme activity. Specifically, in the present application, it refers to a wild-type dextrin debranching enzyme derived from the thermophilic archaeon Saccharolobus solfataricus STB09, or a mutant obtained by substitution, insertion, and / or deletion of one or more amino acids. Specifically, it may be a dextrin debranching enzyme having an amino acid sequence as shown in SEQ ID NO.2.

[0050] In the present application, the term "mutant" means a protein having dextrin debranching enzyme activity and containing substitution, insertion, and / or deletion of one or more amino acids at one or more positions. Substitution means replacing the amino acid occupying a certain position with a different amino acid; insertion means adding 1-5 amino acids adjacent to and immediately following the amino acid occupying a position; deletion means removing the amino acid occupying a certain position.

[0051] In the present application, the term "wild-type" means that the amino acid sequence or nucleic acid sequence is a natural or naturally occurring sequence.

[0052] In the present application, the term "host cell" refers to an organism into which an expression vector, phage, virus, or other DNA construct, including a polynucleotide encoding a protein of interest, is introduced. In the present application, the host cell is a Bacillus subtilis cell capable of expressing the protein of interest, dextrin debranching enzyme.

[0053] In the present application, the term "expression vector" refers to a linear or circular DNA construct containing a DNA sequence encoding a protein, the coding sequence being operably linked to appropriate control sequences capable of affecting the expression of the DNA in a suitable host. Such control sequences may include promoters that affect transcription, optional operator sequences that control transcription, sequences encoding appropriate ribosome binding sites on the mRNA, enhancers, and sequences that control the termination of transcription and translation. In the present application, the expression vector is based on the vector pP43nmk.

[0054] In the present application, the term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding proteins. The nucleic acid may be single-stranded or double-stranded and may be chemically modified. Since the genetic code is degenerate, more than one codon may be used to encode a particular amino acid. Unless otherwise specified, nucleic acid sequences are presented in the 5' to 3' orientation.

[0055] In the present application, "heterologous expression" means that for a host cell, the protein or nucleic acid is not naturally present in the host cell.

[0056] In the present application, the term "recombinant" refers to the manipulation (e.g., cutting and rejoining) of nucleic acid sequences to form a sequence group different from the sequence groups found in nature.

[0057] In the present application, the term "recombinant Bacillus subtilis" refers to Bacillus subtilis into which an expression vector, phage, virus or other DNA construct, including a polynucleotide encoding a target protein, has been introduced. In the present application, it refers to Bacillus subtilis WB600 into which the pP43nmk expression vector ligated with the gene encoding pullulanase has been introduced.

[0058] In the present application, the term "purification" refers to a nucleic acid or protein that is substantially free of other components, such as obtained by separating the protein or nucleic acid by techniques familiar in the art, such as electrophoresis gels, chromatographic eluates, and / or density gradient centrifugation. The purified nucleic acid or protein is at least about 50% pure, usually at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8% or more pure. In the present application, it refers to the purification of pullulanase using an anion exchange chromatography column and a hydrophobic interaction chromatography column.

[0059] The materials and methods involved in the following examples are as follows:

[0060] (1) Sequences:

[0061] The nucleotide sequence of SsGDE is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO.2; the nucleotide sequence of the vector pP43nmk is shown as SEQ ID NO.3.

[0062] Among them, the nucleotide sequence shown as SEQ ID NO.1 and the amino acid sequence shown as SEQ ID NO.2 are specifically as follows:

[0063] SEQ ID NO.1:

[0064]

[0065] SEQ ID NO.2:

[0066] MALFFRTRDRPLRPGDPYPLGSNWIEDDDGVNFSLFSENAEKVELLLYSLTNQKYPKEIIEVKNKTGDIWHVFVPGLRPGQLYAYRVYGPYKPELGLRFNPNKVLIDPYAKAINGSVIWNDAVFGYKIGDQNQDLTYDERDSGEYVPKSVVINPYFEWDDEDFIKGKKVPLKDTVIYEVHVKGFTKLRLDLPENIRGTYEGLASEQMISYLKDLGITTVELMPVFHFIDQRFLTDKGLTNYWGYDPINFFSPECRYSSTGCLGGQVLSFKKMVNELHNAGIEVIIDVVYNHTAEGNHLGPTLSFRGIDNTAYDMLQPDNKRYYLDFTGTGNTLNLSHPRVIQMVLDSLRYWVTEMHVDGFRFDLAAALARELYSVNMLNTFFIALQQDPILSQVKLIAEPWDVGQGGYQVGNFPYEWAEWNGKYRDSIRRFWRGEALPYSEIANRLLGSPDIYLGNNKTPFASINYVTSHDGFTLEDLVSYNQKHNEANGFNNQDGMNENYSWNCGAEGPTNDQNVVICREKQKRNFMITLLVSQGTPMILGGDELSRTQRGNNNAFCQDNEITWFDWNLDERKSKFLEFVKKMIQFYRAHPAFRRERYFQGKKLFGMPLKDVTFYTLEGREVDEKTWSSPTQLVIFVLEGSVMDEINMYGERIADDSFLIILNANPNNVKVKFPKGKWELVISSYLREIKPEERIIEGEKELEIEGRTALVYRRIEL

[0067] (2) Materials and Reagents

[0068] The restriction endonucleases, PCR reagents, etc. used were all purchased from Takara Bio Inc.; the primers were purchased from An Shengda Biotechnology Co., Ltd.; the plasmid extraction kit, genomic extraction kit, agarose purification kit, and B. subtilis WB600 strain were all purchased from Sangon Biotech (Shanghai) Co., Ltd.; other reagents were all analytical pure reagents purchased domestically or abroad.

[0069] (3) Culture medium

[0070] All culture media are prepared with dd H2O and sterilized at 115 °C for 15 - 20 min after preparation.

[0071] LB liquid medium: Yeast extract 5.0 g / L, Tryptone 10.0 g / L, NaCl 10.0 g / L.

[0072] LB solid medium: Yeast extract 5.0 g / L, Tryptone 10.0 g / L, NaCl 10.0 g / L, Agar powder 15 g / L.

[0073] TB liquid medium: Soybean peptone 12 g / L, Yeast extract 24 g / L, Glucose 5 g / L, KH2PO4 2.31 g / L, K2HPO4·3H2O 16.43 g / L.

[0074] Carbon source feeding medium: Glucose 500 g / L.

[0075] Nitrogen source feeding medium: Soybean peptone 120 g / L, Yeast extract 240 g / L.

[0076] (4) Purification buffer

[0077] Solution A: 20 mM CH3COONa, pH 6.0;

[0078] Solution B: 400 mM NaCl, 20 mM CH3COONa, pH 6.0;

[0079] Solution C: 20% saturation (NH4)2SO4, 20 mM Tris, pH 7.0;

[0080] Solution D: 20 mM Tris, pH 7.0.

[0081] (5) Method for detecting the enzyme activity of dextrin debranching enzyme

[0082] Enzyme activity assay conditions: The reaction system includes 150 μL of purified fermentation broth or supernatant, 700 μL of 1% (w / v) DE 4 maltodextrin, and 150 μL of 500 mM sodium acetate buffer (pH 5.0). The reaction is carried out at 70 °C for 15 min, terminated by boiling water bath for 15 min. After cooling, 100 μL of the reaction solution is taken and left to stand for color development with 100 μL of 0.01 M I2 - 0.1 M KI for 15 min. After dilution by a certain multiple, the absorbance value is measured at 610 nm.

[0083] Definition of enzyme activity: Under the above reaction conditions, using the crude enzyme solution inactivated at high temperature as the blank control, at A 610At an nm absorbance value, an increase of 0.1 per hour with 1% DE4 maltodextrin as the substrate is defined as 1 enzyme activity unit (U).

[0084] Among them, the enzyme activity calculation formula for dextrin debranching enzyme is as follows:

[0085]

[0086] Calculate the specific enzyme activity. Among them, the specific enzyme activity calculation formula for dextrin debranching enzyme is as follows

[0087]

[0088] Embodiment:

[0089] This application provides a Bacillus subtilis producing dextrin debranching enzyme. In one example, the Bacillus subtilis heterologously expresses dextrin debranching enzyme using pP43nmk as the vector.

[0090] In one example, the dextrin debranching enzyme is a dextrin debranching enzyme with the amino acid sequence shown in SEQ ID NO.2.

[0091] In one example, the dextrin debranching enzyme has more than 90% homology with the dextrin debranching enzyme with the amino acid sequence shown in SEQ ID NO.2 and has dextrin debranching enzyme activity.

[0092] In one example, one or more amino acid substitutions, insertions, and / or deletions are made to the dextrin debranching enzyme with the amino acid sequence shown in SEQ ID NO.2.

[0093] In one example, the coding nucleic acid sequence of the dextrin debranching enzyme is shown in SEQ ID NO.1, encoding a dextrin debranching enzyme with the amino acid sequence shown in SEQ ID NO.2.

[0094] In one example, the Bacillus subtilis uses Bacillus subtilis WB600, Bacillus subtilis WB800, or Bacillus subtilis 168 as the host cell.

[0095] In one example, the Bacillus subtilis is preferably Bacillus subtilis WB600.

[0096] In one example, the nucleotide sequence of pP43nmk is shown in SEQ ID NO.3. Those skilled in the art can modify the vector according to actual application requirements.

[0097] The present invention also provides a method for constructing Bacillus subtilis producing dextrin debranching enzyme, which comprises the following steps: connecting the coding gene of dextrin debranching enzyme to the vector pP43nmk to obtain an expression vector; introducing the expression vector into a Bacillus subtilis host cell to obtain Bacillus subtilis heterologously expressing dextrin debranching enzyme.

[0098] In one example, the dextrin debranching enzyme is a dextrin debranching enzyme having an amino acid sequence as shown in SEQ ID NO.2.

[0099] In one example, the dextrin debranching enzyme is a dextrin debranching enzyme having more than 90% homology with the dextrin debranching enzyme having an amino acid sequence as shown in SEQ ID NO.2 and having dextrin debranching enzyme activity.

[0100] In one example, one or more amino acids of the dextrin debranching enzyme having an amino acid sequence as shown in SEQ ID NO.2 are substituted, inserted and / or deleted.

[0101] In one example, the coding nucleic acid sequence of the dextrin debranching enzyme is as shown in SEQ ID NO.1, encoding a dextrin debranching enzyme having an amino acid sequence as shown in SEQ ID NO.2.

[0102] In one example, the Bacillus subtilis uses Bacillus subtilis WB600, Bacillus subtilis WB800 or Bacillus subtilis 168 as the host cell.

[0103] In one example, the Bacillus subtilis is preferably Bacillus subtilis WB600.

[0104] In one example, the nucleotide sequence of pP43nmk is as shown in SEQ ID NO.3. Those skilled in the art can modify the vector according to actual application requirements.

[0105] The present invention also provides a method for fermentatively producing dextrin debranching enzyme, which comprises the following steps: fermenting and culturing the Bacillus subtilis producing dextrin debranching enzyme with a fermentation medium to express dextrin debranching enzyme; and during the fermentation culture process, starting carbon source feeding at 45 h to 50 h of fermentation and stopping carbon source feeding at 70 h to 75 h of fermentation.

[0106] In one example, the process of carbon source feeding is further optimized as: starting carbon source feeding at 48 h of fermentation and stopping carbon source feeding at 72 h of fermentation.

[0107] Through the optimization of carbon source feeding, the present application starts carbon source feeding at 48 hours of fermentation culture and introduces a carbon source starvation stage from the 72nd to 96th hours, during which the feeding of carbon source is stopped, achieving a substantial increase in the activity of dextrin debranching enzyme.

[0108] In one example, the activity of pullulanase is further increased by nitrogen source feeding. Specifically, nitrogen source feeding starts at 80 h to 86 h of fermentation and stops at 92 h to 100 h of fermentation.

[0109] In one example, the process of nitrogen source feeding is further optimized as follows: nitrogen source feeding starts at 84 h of fermentation and stops at 96 h of fermentation.

[0110] In one example, the carbon source feeding is to add glucose to the fermentation broth until the glucose concentration in the fermentation broth reaches 1 - 3 g / L when the residual sugar concentration in the fermentation broth is lower than 0.3 - 0.4 g / L.

[0111] In one example, the feeding medium for carbon source feeding is 400 - 600 g / L glucose.

[0112] In one example, the feeding medium for carbon source feeding is 450 - 550 g / L glucose.

[0113] In one example, the nitrogen source feeding is to add the nitrogen source medium at a flow rate of 0.05 - 0.15 g / L / h of yeast powder.

[0114] In one example, the nitrogen source feeding is to add the nitrogen source medium at a flow rate of 0.08 - 0.12 g / L / h of yeast powder.

[0115] In one example, the medium for nitrogen source feeding includes 100 - 140 g / L of soy peptone and 220 - 260 g / L of yeast powder.

[0116] In one example, the medium for nitrogen source feeding includes 110 - 130 g / L of soy peptone and 230 - 250 g / L of yeast powder.

[0117] In one example, the fermentation medium includes 10 - 15 g / L of soy peptone, 20 - 30 g / L of yeast powder, 1 - 10 g / L of glucose, 2 - 3 g / L of KH2PO4, and 10 - 20 g / L of K2HPO4·3H2O.

[0118] In one example, the fermentation medium is further optimized as: 11 - 13 g / L of soy peptone, 24 - 26 g / L of yeast powder, 4 - 6 g / L of glucose, 2 - 3 g / L of KH2PO4, and 10 - 20 g / L of K2HPO4·3H2O.

[0119] In one example, the method specifically includes the following steps:

[0120] S1. Activate the Bacillus subtilis producing dextrin debranching enzyme on an LB plate, and after activation, culture it in an LB seed medium to obtain a seed culture solution. Among them, the conditions for seed culture are shaking flask culture at 35 - 38 °C and 150 - 250 rpm for 5 - 12 h;

[0121] S2. Inoculate the seed culture solution into the fermentation medium at a volume percentage of 2% - 6%, and perform shaking flask fermentation at 28 - 32 °C and 150 - 250 rpm. During the fermentation culture process, at 45 h - 50 h of fermentation, start carbon source feeding, and stop carbon source feeding at 70 h - 75 h of fermentation; at 80 h - 86 h of fermentation, start nitrogen source feeding, and stop nitrogen source feeding at 92 h - 100 h of fermentation.

[0122] The present invention also provides the application of the Bacillus subtilis producing dextrin debranching enzyme in starch processing.

[0123] In one example, the application at least includes one of the following features:

[0124] (1) The application includes hydrolyzing α - 1,6 glycosidic bonds or hydrolyzing substances containing α - 1,6 glycosidic bonds or starch branches;

[0125] (2) The application includes hydrolyzing starch or dextrin.

[0126] In one example, the starch includes at least one of corn starch, wheat starch, rice starch, potato starch, and cassava starch.

[0127] In one example, the dextrin includes maltodextrin with a DE value of 2 - 25.

[0128] The present invention also provides the application of the method for fermentatively producing dextrin debranching enzyme in starch processing, and the application is to perform starch processing with the dextrin debranching enzyme produced by the method.

[0129] In one example, the application at least includes one of the following features:

[0130] (1) The application includes hydrolyzing α - 1,6 glycosidic bonds or hydrolyzing substances containing α - 1,6 glycosidic bonds or starch branches;

[0131] (2) The application includes hydrolyzing starch or dextrin.

[0132] In one example, the starch includes at least one of corn starch, wheat starch, rice starch, potato starch, and cassava starch.

[0133] In one example, the dextrin includes maltodextrin with a DE value of 2 - 25.

[0134] The implementation of the present application will be described in detail below in conjunction with embodiments. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specific conditions in the following embodiments, the guidance given in the present application is preferably referred to, and it can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturer, or referring to the experimental methods known in the art.

[0135] In the following specific embodiments, for the measurement parameters of raw material components, if not otherwise specified, there may be slight deviations within the weighing accuracy range. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0136] Example 1: Construction of recombinant B. subtilis WB600 for producing SsGDE enzyme

[0137] Design primer pairs F1 (SEQ ID NO.4) and R1 (SEQ ID NO.5) for amplifying the target gene SsGDE fragment (SEQ ID NO.1):

[0138] F1: ATGGCATTATTCTTCAGAACTAGAGATAG

[0139] R1: CTATAATTCTATCCTCCTATAAACTAATGCCG

[0140] Using the Ssgde / pET20b(+) gene sequence as a template, perform PCR amplification on it with primer pair F1 / R1, and purify and recover the PCR product to obtain the target gene SsGDE fragment.

[0141] Design primer pairs F2 (SEQ ID NO.6) and R2 (SEQ ID NO.7) for amplifying the vector pP43nmk fragment (SEQ ID NO.3):

[0142] F2: AGGATAGAATTATAGAAGCTTGGCGTAATCATGGTCATA

[0143] R2: GAAGAATAATGCCATGTGTACATTCCTCTCTTACCTATAATGGTA

[0144] Using the gene sequence of the pP43nmk empty plasmid as a template, perform PCR amplification on it with primer pair F2 / R2, and purify and recover the PCR product to obtain the vector fragment.

[0145] The construction process mainly uses the method of homologous recombination. Among them, the composition of the PCR reaction solution and the PCR amplification program in the first-step PCR amplification are carried out according to the method provided in the Takara Ex Taq DNA Polymerase instruction manual. The reaction system of PCR is as follows: 25 μL of 2×Phanta Max Master Mix (Dye Plus), 4 μL each of the forward primer and the reverse primer, 1 μL of template DNA, and finally 16 μL of double-distilled water is added. The amplification conditions of the PCR reaction are: pre-denaturation at 95 °C for 3 min; then denaturation at 95 °C for 15 s, annealing at 58 °C for 15 s, extension at 72 °C for 7 min / 2.5 min, for 30 cycles; finally, incubation at 72 °C for 10 min. After DNA gel recovery, the final product of PCR is obtained. The second step is homologous recombination: using the final product of the first step as the substrate, referring to the C112 II One Step Cloning Kit instruction manual of Novoprotein Scientific Inc., after mixing the PCR final product with each reagent, incubate it in a 37 °C water bath for 30 min to complete the homologous recombination reaction, and then transform it into E. coli JM109 competent cells. Send the transformed transformants to Genewiz (Suzhou) Inc. for sequencing. The plasmid E. coli JM109 (pP43nmk / Ssgde) with successful construction is the one with correct verification. Transform the expression vector Ssgde / pP43nmk containing the correct sequence into the host cell B. subtilis WB600, thus completing the construction of the genetically engineered bacterium B. subtilis WB600 (pP43nmk / Ssgde).

[0146] Meanwhile, the inventor adopted a similar method to construct the genetically engineered bacterium B. subtilis WB600 (pST / Ssgde) using pST as the vector respectively.

[0147] The corresponding primer pairs F3 (SEQ ID NO.8) and R3 (SEQ ID NO.9) for amplifying the vector fragment:

[0148] F3: AGGATAGAATTATAGCTACATTCATCGGGAAAGGCGA

[0149] R3: GAAGAATAATGCCATCCGCCTATCCCTCACGCC.

[0150] Example 2: Expression and purification of SsGDE enzyme

[0151] The genetically engineered bacteria B. subtilis WB600(pP43nmk / Ssgde) and B. subtilis WB600(pST / Ssgde) preserved in glycerol tubes were streaked onto LB plates containing 10 μg / mL kanamycin respectively, and cultured at 37 °C for about 12 h for strain activation. A single colony was picked from the plate using an inoculation loop and transferred into a 250 mL conical flask containing 50 mL of LB liquid medium, and kanamycin with a final concentration of 10 μg / mL was added. The culture was shaken at 37 °C and 200 rpm for 8 - 12 h to obtain a seed culture solution; 2 mL of the activated seed culture solution was aspirated and transferred into a 250 mL conical flask containing 50 mL of TB liquid medium, and kanamycin with a final concentration of 10 μg / mL was added. The culture was shaken at 30 °C and 200 rpm for 96 h for flask fermentation.

[0152] After centrifugation, the supernatant was collected as the crude enzyme solution. The enzyme activities of the crude enzyme solutions of B. subtilis WB600(pP43nmk / Ssgde) and B. subtilis WB600(pST / Ssgde) were 2263 U / mL and 1213 U / mL respectively. SsGDE was purified using an anion exchange chromatography column and a hydrophobic interaction chromatography column to obtain pure SsGDE, and the enzyme activities were approximately 21800 U / mg and 13400 U / mg respectively. The purification result of SsGDE from B. subtilis WB600(pP43nmk / Ssgde) is as Figure 1 shown, and the protein band after purification is relatively single.

[0153] Example 3: Determination of the optimum reaction temperature and thermal stability of SsGDE

[0154] Using 1% (w / v) DE4 maltodextrin as the substrate, the debranching activity of the pure recombinant SsGDE produced by B. subtilis WB600(pP43nmk / Ssgde) was measured at different temperatures (30 °C - 95 °C) respectively, and the temperature at which the enzyme activity was the highest was taken as the optimum reaction temperature of the enzyme.

[0155] The determination of the thermal stability of the pure recombinant SsGDE was carried out according to the following steps: The pure enzyme solution was incubated at 50 °C, 60 °C, 70 °C and 80 °C for a certain period of time and then cooled in an ice bath, and the enzyme activity was measured at the optimum reaction temperature. The enzyme activity without heat treatment was defined as 100%.

[0156] The optimum reaction temperature and thermal stability are important indicators for evaluating the application performance of enzymes. In the production process of starch sugar, a higher working temperature can increase the use concentration of starch raw materials and prevent microbial contamination during the production process. The optimum reaction temperature and thermal stability of the recombinant SsGDE were measured.

[0157] The effect of temperature on enzyme activity is shown in Figure 2 Figure A. The optimal reaction temperature of recombinant SsGDE is 70 °C, and recombinant SsGDE retains more than 80% of its enzyme activity in the range of 40 °C to 80 °C. When the temperature is lower than 40 °C or higher than 80 °C, the hydrolysis activity of recombinant SsGDE decreases significantly. The relatively high optimal reaction temperature indicates that SsGDE belongs to thermophilic enzymes and is suitable for catalytic reactions at high temperatures. The temperature stability of recombinant SsGDE at 70 °C was determined (as shown in Figure 2 Figure B). The results showed that the catalytic activity of recombinant SsGDE increased significantly during incubation at 70 °C. After incubation at the optimal reaction temperature of 70 °C for 210 min, the enzyme activity could be increased to 157.6% of the initial enzyme activity.

[0158] Example 4: Determination of the Optimal pH and pH Stability of SsGDE Enzyme Produced by B. subtilis WB600(pP43nmk / Ssgde)

[0159] Using 1% (w / v) DE4 maltodextrin as the substrate, the debranching activity of recombinant SsGDE at different pH values was determined by adding acetate-sodium acetate buffer (pH 3.5 - 5.0, 500 mM), disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 5.0 - 7.0, 500 mM), Tris-HCl buffer (pH 7.0 - 8.0, 500 mM) and glycine-sodium hydroxide buffer (pH 8.0 - 10.0, 500 mM).

[0160] The pH stability of recombinant SsGDE was carried out as follows: Purified recombinant SsGDE was diluted with buffers of different pH values and incubated at 4 °C for 1 hour. After incubation, the enzyme activity was measured at the optimal reaction temperature; the activity of recombinant SsGDE before incubation was defined as 100%, and the residual activity of recombinant SsGDE stored in different pH buffers was calculated.

[0161] SsGDE can remove the branched structure in the substrate, promote the reaction process of glucoamylase, and improve the conversion rate of starch raw materials. The optimal reaction pH of glucoamylases from different sources varies greatly, and debranching enzymes with a wider pH adaptability have greater application potential. The hydrolysis activity of recombinant SsGDE was measured in different pH ranges (3.0 - 10.0), and the results are shown in Figure 3 Figure A. The optimal pH of recombinant SsGDE is 5.0. Recombinant SsGDE was diluted with different pH buffers and incubated at 4 °C for 1 h, and its residual activity was measured at the optimal pH. The activity before incubation was defined as 100%, and the results are shown in Figure 3 Figure B. When recombinant SsGDE was stored at pH < 4.0 or pH > 6, the residual activity decreased significantly.

[0162] Example 5: Determination of the Optimal Fermentation Temperature of SsGDE Produced by B. subtilis WB600(pP43nmk / Ssgde)

[0163] Seed culture: Dip a loop of recombinant Bacillus subtilis from the glycerol tube stored at -80°C and streak it on the LB solid medium plate containing 10 μg / mL kanamycin resistance. Incubate at 37°C for 12 h, pick a single colony into 50 mL of LB liquid medium (containing 10 μg / mL kanamycin), and culture at 37°C and 200 r / min for 7 h to obtain the seed culture solution.

[0164] 2-L shake flask fermentation culture: When the seed culture solution grows to an OD 600 of 0.6 - 1.2, inoculate it into the fermentation medium in a 2-L shake flask at an inoculation amount of 4% (v / v), control the shaker speed at 200 rpm, and set the fermentation temperatures at 25°C, 30°C, and 37°C respectively. The growth and enzyme production of the recombinant bacteria at different fermentation temperatures are as shown in Figure 4 、 5 shown.

[0165] As can be seen from Figure 4 , at low temperature (25°C), the cells show the highest growth rate, but the product synthesis rate is relatively low. This phenomenon may be due to the fact that low temperature is closer to the optimal growth temperature of the microorganism, thus promoting the enhancement of cell metabolic activities; on the contrary, at high temperature (37°C), although the cell growth rate is fast, the increase in cell mortality leads to an unsatisfactory final product yield. Under medium temperature conditions, although the cell growth rate decreases, the enzyme activity is the highest, which implies that under medium temperature conditions, cell growth and protein expression are in balance. Fermented to 84 h under this condition, the highest enzyme activity of SsGDE is 3386.58 U / mL, which is 1.49 times that of the shake flask fermentation level in Example 2.

[0166] In addition, by observing Figure 5 , it can be further found that the higher the fermentation temperature, the more protein is expressed at 12 - 24 h, indicating that the protein expression rate is accelerated. At the same time, the higher the fermentation temperature, the less the content of miscellaneous proteins in the later stage of fermentation. Combining with the trend of enzyme activity change, the preferred fermentation temperature is 30°C.

[0167] Example 6: Effect of Carbon Source Feeding Time on the Growth and Enzyme Production of Recombinant Bacillus subtilis

[0168] Seed culture: Dip a loop of recombinant Bacillus subtilis from the glycerol tube stored at -80°C and streak it on the LB solid medium plate containing 10 μg / mL kanamycin resistance. Incubate at 37°C for 12 h, pick a single colony into 50 mL of LB liquid medium (containing 10 μg / mL kanamycin), and culture at 37°C and 200 r / min for 7 h to obtain the seed culture solution.

[0169] 2L shake flask fermentation culture: When the seed culture medium grows to OD 600 of 0.6 - 1.2, inoculate it into the fermentation medium in a 2L shake flask at an inoculation amount of 4% (v / v). Control the shaking speed of the shaker at 200 rpm, set the fermentation temperature at 30 °C, adjust the carbon source feeding time to start feeding from 24 h and 48 h, and stop feeding at 60 h, 72 h, 96 h, and 120 h. The feeding method is intermittent feeding. When the residual sugar concentration in the fermentation broth is lower than 0.3 - 0.4 g / L, add glucose to the fermentation broth until the glucose concentration is 2 g / L. The test results are as Figure 6 shown.

[0170] By measuring the cell density of different feeding strategies, as Figure 6 shown in A, it is found that feeding starting from 24 h will significantly increase the cell density in the middle stage of fermentation (36 h - 84 h), while feeding starting from 48 h does not greatly improve the cell density in the middle stage of fermentation, but has a more obvious improvement on the cell density in the later stage of fermentation.

[0171] As Figure 6 shown in B, during the measurement of enzyme activity, it is found that starting from 48 h, the enzyme activity is significantly enhanced by intermittently supplementing the carbon source. When the fermentation process continues to 72 h, the enzyme activity reaches the peak value of 5973 U / mL, which is 2.64 times the shake flask fermentation level in Example 2. Finally, the preferred carbon source feeding time is 48 - 72 h.

[0172] Example 7: Effect of nitrogen source feeding timing on the growth and enzyme production of recombinant Bacillus subtilis

[0173] Seed culture: Dip a loop of recombinant Bacillus subtilis from the glycerol tube stored at -80 °C, streak it on the LB solid medium plate containing 10 μg / mL kanamycin resistance, culture it at 37 °C for 12 h, pick a single colony into 50 mL of LB liquid medium (containing 10 μg / mL kanamycin), and culture it at 37 °C, 200 r / min for 7 h to obtain the seed culture medium.

[0174] 2L shake flask fermentation culture: When the seed culture medium grows to OD 600 of 0.6 - 1.2, inoculate it into the fermentation medium in a 2L shake flask at an inoculation amount of 4% (v / v). Control the shaking speed of the shaker at 200 rpm, set the fermentation temperature at 30 °C, and perform intermittent carbon source feeding medium supplementation during the fermentation period of 48 - 72 h. When the residual sugar concentration in the fermentation broth is lower than 0.3 - 0.4 g / L, add glucose to the fermentation broth until the glucose concentration is 2 g / L, and start nitrogen source feeding at 48 h, 60 h, 72 h, 84 h, and 96 h respectively. The feeding method is 0.1 g / L / h of yeast powder and 0.05 g / L / h of soy peptone. The test results are asFigure 7 as shown

[0175] The results showed that adding nitrogen source starting from 48 h, 60 h, 72 h, 84 h and 96 h could all increase the cell density. Among them, when the fermentation time reached 96 h, the increase in cell density was particularly significant, and then the cell density gradually decreased. The earlier the feeding time was, the higher the cell density was.

[0176] Further analyzing from the perspective of enzyme activity, it was found that adding nitrogen source starting from 84 h could significantly improve the enzyme activity, and the highest enzyme activity reached 6026 U / mL, which was 2.66 times that of the shake flask fermentation level in Example 2. Finally, the preferred nitrogen source feeding time was to start feeding at 84 h and stop feeding at 96 h.

[0177] The embodiments provided above are not intended to limit the scope covered by the present invention, nor are the described steps intended to limit the order of their execution. Obvious improvements made by those skilled in the art to the present invention in combination with the existing well-known common sense also fall within the protection scope defined by the claims of the present invention.

Claims

1. A Bacillus subtilis producing dextrin debranching enzyme, characterized in that, The Bacillus subtilis uses pP43nmk as a vector to heterologously express pullulanase.

2. The Bacillus subtilis according to claim 1, characterized in that, The pullulanase is a pullulanase with an amino acid sequence as shown in SEQ ID NO.2, or a pullulanase with pullulanase activity having more than 90% homology thereto.

3. The Bacillus subtilis according to claim 2, characterized in that, The coding nucleic acid sequence of the pullulanase is as shown in SEQ ID NO.

1.

4. The Bacillus subtilis according to any one of claims 1 to 3, characterized in that, The Bacillus subtilis uses Bacillus subtilis WB600, Bacillus subtilis WB800 or Bacillus subtilis 168 as the host cell.

5. The Bacillus subtilis according to any one of claims 1 to 3, characterized in that, The nucleotide sequence of pP43nmk is as shown in SEQ ID NO.

3.

6. A method for constructing Bacillus subtilis producing pullulan debranching enzyme according to any one of claims 1 to 5, characterized in that, It includes the following steps: ligating the coding gene of pullulanase to the vector pP43nmk to obtain an expression vector; introducing the expression vector into the Bacillus subtilis host cell to obtain a Bacillus subtilis that heterologously expresses pullulanase.

7. A method for fermentatively producing dextrin debranching enzyme, characterized in that, It includes the following steps: fermenting and culturing the Bacillus subtilis producing pullulanase according to any one of claims 1 to 5 using a fermentation medium to express pullulanase; and during the fermentation culture process, starting carbon source feeding at 45 h to 50 h of fermentation and stopping carbon source feeding at 70 h to 75 h of fermentation.

8. The method according to claim 7, wherein The method further includes starting nitrogen source feeding at 80 h to 86 h of fermentation and stopping nitrogen source feeding at 92 h to 100 h of fermentation.

9. The method according to claim 7, wherein The carbon source feeding is to add glucose to the fermentation broth to a glucose concentration of 1 to 3 g / L when the residual sugar concentration in the fermentation broth is lower than 0.3 to 0.4 g / L.

10. The method according to claim 9, wherein The feeding medium for the carbon source feeding is 400 to 600 g / L glucose.

11. The method according to claim 8, wherein The nitrogen source feeding is to add a nitrogen source medium at a flow rate of 0.05 to 0.15 g / L / h of yeast powder.

12. The method according to claim 11, wherein The nitrogen source medium includes 100 to 140 g / L of soybean peptone and 220 to 260 g / L of yeast powder.

13. The method according to claim 7, characterized in that, The fermentation medium includes 10 to 15 g / L of soybean peptone, 20 to 30 g / L of yeast powder, 1 to 10 g / L of glucose, 2 to 3 g / L of KH2PO4, and 10 to 20 g / L of K2HPO4·3H2O.

14. The method according to any one of claims 7 to 13, characterized in that The method specifically includes the following steps: S1. Activating the Bacillus subtilis producing pullulanase on an LB plate, and culturing it in an LB seed medium after activation to obtain a seed culture solution; wherein, the conditions for seed culture are shaking flask culture at 35 to 38 °C and 150 to 250 rpm for 5 to 12 h. S2. Inoculating the seed culture solution into the fermentation medium at a volume percentage of 2% to 6%, performing shaking flask fermentation at 28 to 32 °C and 150 to 250 rpm, and during the fermentation culture process, starting carbon source feeding at 45 h to 50 h of fermentation and stopping carbon source feeding at 70 h to 75 h of fermentation; starting nitrogen source feeding at 80 h to 86 h of fermentation and stopping nitrogen source feeding at 92 h to 100 h of fermentation.

15. Use of the Bacillus subtilis producing pullulanase according to any one of claims 1 to 5 in starch processing.

16. The application according to claim 15, wherein The use includes at least one of the following features: (1) The application includes hydrolyzing α-1,6 glycosidic bonds or hydrolyzing substances containing α-1,6 glycosidic bonds or starch branches; (2) The application includes hydrolyzing starch or dextrin.

17. The application according to claim 16, wherein The starch includes at least one of corn starch, wheat starch, rice starch, potato starch, and cassava starch.

18. The application according to claim 16, characterized in that, The dextrin includes maltodextrin with a DE value of 2-25.

19. Use of the method for fermentatively producing debranching enzyme according to any one of claims 7 to 14 in starch processing, characterized in that, The application is to process starch with the dextrin debranching enzyme produced by the method.

20. The application according to claim 19, characterized in that, The application includes at least one of the following features: (1) The application includes hydrolyzing α-1,6 glycosidic bonds or hydrolyzing substances containing α-1,6 glycosidic bonds or starch branches; (2) The application includes hydrolyzing starch or dextrin.

21. The application according to claim 20, wherein, The starch includes at least one of corn starch, wheat starch, rice starch, potato starch, and cassava starch.

22. The application according to claim 20, characterized in that, The dextrin includes maltodextrin with a DE value of 2-25.

Images