Application of egg white kinase JNK1 in resisting mycoplasma gallisepticum infection

Abstract

The invention belongs to the technical field of genetic engineering of animal molecular breeding, and particularly relates to application of egg white kinase JNK1 in resisting mycoplasma gallisepticum (MG) infection. The invention finds that the expression quantity of the JNK1 gene in chicken lung tissues and cells after MG infection is obviously reduced. Silent JNK1 can significantly inhibit replication and adhesion of MG in host cells, promote cell proliferation, inhibit release of pro-inflammatory factors and promote release of anti-inflammatory factors, which indicates that the JNK1 gene is a susceptible gene of MG, and the gene knockdown / knockout can significantly improve resistance of chicken to MG. The JNK1 gene provided by the invention can be used as a target spot for resisting replication of mycoplasma gallisepticum, can be used as a disease-resistant molecular marker, is used for carrying out auxiliary breeding on new varieties for resisting mycoplasma gallisepticum infection, and has important application value in genetic auxiliary disease-resistant breeding.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and biomedicine, and particularly relates to the application of silencing chicken protein kinase JNK1 in improving the resistance of chickens to Mycoplasma gallisepticum infection. Background Art

[0002] Mycoplasma gallisepticum (MG) can cause chronic respiratory diseases in chickens, with strong pathogenicity and a long incubation period. Its clinical symptoms mainly include coughing, respiratory rales, sneezing, and runny nose. In severe cases, it can cause dyspnea or open-mouth breathing. Once poultry is infected with MG, it spreads rapidly and is difficult to eliminate. After the chicken flock is infected with MG, the egg production of laying hens, the hatching rate of breeding eggs, and the feed utilization rate all decrease by about 20%; the weak chick rate of chickens increases by about 10%; the weight of broilers decreases by 38%, seriously affecting the economic benefits of the poultry breeding industry (Feng Yuanzhang 2008, Payam et al 2011, Wang Peng 2019). Due to problems such as virus return and drug resistance in the methods of vaccination and antibiotic treatment, there is still a lack of effective means to prevent and control the disease. Summary of the Invention

[0003] The purpose of the present invention is to provide a gene that can improve the resistance of chickens to Mycoplasma gallisepticum infection and its application, which can be used as a molecular marker for disease resistance and assist in breeding new varieties against Mycoplasma gallisepticum infection, and has important application value in genetic-assisted disease-resistant breeding.

[0004] In order to achieve the above purpose, the present invention takes the following technical measures:

[0005] The application of a preparation that inhibits the expression of chicken JNK1 gene in improving the resistance of chickens to Mycoplasma gallisepticum infection; the JNK1 gene includes the JNK1 gene with NCBI accession number NC_052536.1 in chickens or the JNK1 gene homologous to this gene in chickens.

[0006] In the above application, preferably, the inhibition methods include but are not limited to using siRNA interference technology, knockout technology, etc. targeting the chicken JNK1 gene.

[0007] The protection content of the present invention also includes: preparing a cell model for resisting Mycoplasma gallisepticum infection by silencing the chicken JNK1 gene.

[0008] Compared with the prior art, the present invention has the following advantages:

[0009] The applicant used siRNA interference technology to target and inhibit the expression of the JNK1 gene in chicken embryo fibroblast cell lines, and for the first time found that cells with inhibited JNK1 gene expression can resist Mycoplasma gallisepticum infection by affecting the replication and pathological process of Mycoplasma gallisepticum. This gene can be used as a new anti-disease target for Mycoplasma gallisepticum. The present invention provides a new target for the development of effective and safe new vaccine drugs for preventing and treating Mycoplasma gallisepticum, and also provides a new candidate gene for anti-Mycoplasma gallisepticum breeding research, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1: JNK1 was significantly downregulated in chicken lung tissues and cells after MG infection;

[0011] Among them: (A) qPCR was used to detect the mRNA expression level of the JNK1 gene in chicken embryo lung tissues of different ages after MG infection;

[0012] (B) qPCR was used to detect the mRNA expression level of the JNK1 gene in DF-1 cells at different time periods after MG infection;

[0013] Figure 2: Silencing the JNK1 gene inhibits the replication of MG;

[0014] Among them, (A) qPCR was used to detect the construction of the JNK1 gene silencing model in DF-1 cells;

[0015] (B) qPCR was used to detect that silencing the JNK1 gene reduces the MG copy number;

[0016] (C) qPCR was used to detect that silencing the JNK1 gene inhibits the expression of MG adhesion proteins;

[0017] Figure 3 : Silencing the JNK1 gene promotes the proliferation of MG-infected cells;

[0018] Among them, the CCK-8 kit was used to detect that silencing the JNK1 gene promotes the proliferation of MG-infected DF-1 cells;

[0019] Figure 4: Silencing the JNK1 gene inhibits the cell inflammatory process induced by MG infection;

[0020] Among them, (A) ELISA was used to detect the expression of pro-inflammatory factors TNF-α and IL-1ß proteins in DF-1 cells infected with MG after silencing the JNK1 gene;

[0021] (B) ELISA was used to detect the expression of anti-inflammatory factors IL-10 and IL-4 proteins in DF-1 cells infected with MG after silencing the JNK1 gene; DETAILED DESCRIPTION OF THE INVENTION

[0022] The technical solutions of the present invention are conventional solutions in the art unless otherwise specified; the reagents or materials are from commercial channels unless otherwise specified.

[0023] Example 1: Detection of the expression level of JNK1 gene in chicken lung tissues and cells after MG infection;

[0024] 1. Preparation and culture of chicken alveolar type II epithelial cells

[0025] Sterilely isolate the lung tissues of SPF eggs with similar size and weight from chicken embryos hatched for 14.5 - 15.5 days, remove other tissues except lung tissues, such as trachea, lung mucosa, etc. The taken-out lung tissues are placed in a penicillin glass bottle pre-added with 3 ml of PBS, washed with PBS until the liquid is clear, and the chicken lung tissues are cut into pieces of 1 mm3 with sterile scissors. Add 1 ml of pre-warmed 0.25% trypsin to each lung tissue, pipette and mix evenly, place in a 37 °C, 5% CO2 incubator for digestion for 10 min, take out and shake once every 2 min. When the digestive juice becomes turbid and the cell clumps are completely digested, and the cells are pipetted evenly with a pipette tip to form single cells, add an equal amount of DMEM complete culture medium containing 10% FBS to terminate digestion, centrifuge at 800 r / min for 10 min, discard the supernatant, resuspend the cell precipitate with 1 mL of 0.1% type IV collagenase, place in a 37 °C, 5% CO2 incubator for digestion for 15 min, centrifuge, discard the supernatant, add DMEM complete medium containing 10% FBS, gently pipette and mix evenly, then filter through a 200-mesh sieve into a sterile petri dish with a diameter of 100 mm for cell attachment to remove miscellaneous cells. Add the above DMEM complete medium containing 10% FBS to the cell dish, place in a 37 °C, 5% CO2 incubator for culture for 1 h, gently take out the non-attached cell suspension, repeat the above operation twice to make the fibroblasts attach to the wall as much as possible to remove impurities. Centrifuge the non-attached suspension at 1200 r / min for 5 min, resuspend the cells with the culture medium again, and centrifuge again, repeat 3 times. Resuspend the precipitate with DMEM culture medium containing 20% FBS, mix evenly, filter through a 400-mesh sieve, adjust the cell concentration of the filtrate to 1.5×106 cells / ml with DMEM containing 20% FBS, inoculate the adjusted cells into a culture flask, and culture in a 37 °C, 5% CO2 incubator for 18 h. After culturing for 18 h, change the culture medium. At this time, the attached cells are chicken alveolar type II epithelial cells. The cell passage method is the conventional cell passage method.

[0026] 2. Culture of DF-1 cells

[0027] The specific steps are as follows:

[0028] (1) Resuscitation of DF-1 cells: Take out the cryopreserved cells from the liquid nitrogen tank, quickly thaw the cells in a 37°C water bath. During the thawing process, constantly shake the cryopreservation tube to enable the cells to pass through the ice crystal stage. Transfer the thawed cell mixture into a 15 mL centrifuge tube, add 10 mL of cell culture medium DMEM, centrifuge at 1000 r / min for 5 min, and discard the supernatant. Add 1 mL of complete cell culture medium, resuspend the cells, inoculate them into a culture flask for culture, and supplement the medium to about 3 mL. Gently shake the culture flask to evenly spread the cells on the bottom of the flask, place it in a 39°C, 5% CO2 incubator for culture, and observe the cell growth status at any time.

[0029] (2) Subculture of DF-1 cells: Observe the cells. When the cells in the culture flask are basically confluent and the cell density reaches more than 90%, the cells need to be subcultured. The basic subculture operations are as follows: Aspirate the cell culture medium in the culture flask, add PBS to wash the cells, and repeat the operation twice. After discarding the PBS, add an appropriate amount of 0.25% trypsin to cover the bottom of the flask. Place the cells in the incubator and let them stand for 2 min. Observe the cell digestion under a microscope. When the cells begin to shrink, become round and small, add cell culture medium with twice the volume of trypsin to terminate the digestion. Pipette the cells in the culture flask to form a single-cell suspension and collect the cells. Transfer the cell suspension into a 15 mL centrifuge tube, centrifuge at 1000 r / min for 5 min, and discard the supernatant. Add complete cell culture medium, pipette to resuspend the cells, transfer the cells into a new culture flask, supplement an appropriate amount of cell culture medium, place it in a 39°C, 5% CO2 constant temperature incubator for culture, and observe the cell growth status at any time.

[0030] (3) Cryopreservation of DF-1 cells: Select cells with strong growth. After the cells grow confluently in the culture flask, according to the cell subculture operation steps, centrifuge and resuspend the cells with cryopreservation solution, aliquot them into appropriate cryopreservation tubes, with a maximum of 1 mL of cells added to each cryopreservation tube. After marking the cryopreservation tubes, place them in a 4°C refrigerator for 30 min, then transfer them to -20°C for freezing for 1 h. Finally, place the cryopreservation tubes in the liquid nitrogen tank, hang them at the mouth of the liquid nitrogen tank overnight, and put them into the liquid nitrogen for cryopreservation the next day.

[0031] (4)Virus challenge of DF-1 cells: One day before transfection, inoculate an appropriate number of cells into a 6-well cell culture plate. When the cell density reaches 50%-60% and the cell state is good, conduct a cell virus challenge test and set up a normal cell control group. Aspirate the original cell culture medium, wash 3 times with PBS buffer to remove as much of the original cell culture medium as possible; according to the MG-HS virulence detection results, select an appropriate virus challenge dose and supplement the cell culture medium (without penicillin and streptomycin) to 2 mL. Place the 6-well cell culture plate in a 37°C, 5% CO2 constant temperature incubator and culture for 24 h. Aspirate the original cell culture medium, wash 3 times with PBS buffer to remove as much of the original cell culture medium as possible; collect the cells with 1 mL of TRIzol and store at -20°C for later use.

[0032] 3. Extraction of total RNA from lung tissue and cells

[0033] The specific steps are as follows:

[0034] (1) Extraction and quality detection of total RNA from chicken embryo lung tissue: Extract total RNA from the lung tissues of SPF chicken embryos in the MG infection groups at 15d, 16d, 17d, 18d and the normal control group (3 biological replicates each). The specific operation steps are as follows: Take out the tissue from -80°C, take about 100 mg from it, add it to a homogenization tube containing 1 mL of TRizol, homogenize it twice in a homogenizer, 20 s each time, ensure that the tissue is completely broken, and immediately place the sample on ice after homogenization; In the ultra-clean workbench, incubate for 5 min, centrifuge at 4°C and 12,000 r / min for 10 min; Pipette the upper layer of liquid into a new 1.5 mL processed centrifuge tube, add 200 μL of chloroform, shake vigorously, let stand at room temperature for 3 min, centrifuge at 4°C and 12,000 r / min for 15 min; Pipette the supernatant into a new processed 1.5 mL centrifuge tube, add 600 μL of isopropanol, invert the centrifuge tube several times to mix well, let stand at -20°C for 15 min, centrifuge at 4°C and 12,000 r / min for 15 min, and discard the supernatant; Add 1 mL of 75% absolute ethanol (750 μL absolute ethanol + 250 μL DEPC water), gently flick the precipitate to wash the precipitate, centrifuge at 4°C and 9,500 r / min for 5 min, and discard the supernatant; Add 1 mL of absolute ethanol to wash the precipitate, centrifuge at 4°C and 9,500 r / min for 5 min, discard the supernatant, and dry at room temperature for 10 min; According to the amount of precipitate, add an appropriate amount of DEPC water to dissolve the RNA precipitate, gently mix to dissolve, measure the concentration and purity of the extracted total RNA with NanoDrop-2000, take 2 μL of total RNA, perform electrophoresis detection on a 1.2% agarose gel, and store the remaining RNA in a -80°C refrigerator for later use. Observe the three bands of 28s rRNA, 18s rRNA, and 5.8s rRNA to judge the quality of RNA extraction; Measure the purity and concentration of RNA: RNA has the maximum absorption peak at a wavelength of 260 nm. Measure the concentration of total RNA with a spectrophotometer at a wavelength of 260 nm. The ratio of OD260 / OD280 of a pure RNA sample is about 2.0. Therefore, the purity of RNA can be estimated according to the ratio of OD260 / OD280.

[0035] (2) Method for extracting RNA from cells: Add 200 μL of chloroform to 1 mL of Trizol cell suspension, shake vigorously, let stand at room temperature for 3 min, centrifuge at 4 °C and 12,000 r / min for 15 min; aspirate the supernatant into a new 1.5 mL centrifuge tube treated without RNase, add an equal volume of isopropanol, invert the centrifuge tube several times to mix well, let stand at -20 °C for 15 min, centrifuge at 4 °C and 12,000 r / min for 15 min, discard the supernatant; add 1 mL of 75% absolute ethanol (750 μL absolute ethanol + 250 μL DEPC water), gently flick the precipitate to wash the precipitate, centrifuge at 4 °C and 9,500 r / min for 5 min, discard the supernatant; add 1 mL of absolute ethanol to wash the precipitate, centrifuge at 4 °C and 9,500 r / min for 5 min, discard the supernatant, dry at room temperature for 10 min; add an appropriate amount of DEPC water to dissolve the RNA precipitate, gently mix to dissolve, and measure the concentration and purity of the total RNA extracted by NanoDrop-2000.

[0036] 4. Detect the expression level of JNK1 in lung tissues and cells after MG infection

[0037] (1) Synthesis of the first strand of cDNA

[0038] According to the instructions of the reverse transcription kit from Takara Company, the specific operations are as follows:

[0039] Reaction for removing genomic DNA

[0040]

[0041] Mix well, and the PCR reaction program is as follows: PCR reaction conditions: 42 °C, 2 min.

[0042] Reverse transcription

[0043]

[0044] The concentration of RTPrimer Mix is 10 μm. After mixing, load the sample. PCR reaction conditions: 37 °C, 15 min; 85 °C, 5 sec. After the reaction, take a part of the obtained cDNA sample, dilute it 5-fold and aliquot, and store it at -20 °C for later use.

[0045] Obtain the gene sequence of JNK1 from NCBI, design primers using Primer5.0 software, and the primer sequences are as follows:

[0046]

[0047] The reaction system for qPCR to detect the relative expression level of JNK1 in tissues and cells after MG infection is as follows:

[0048]

[0049] After mixing and centrifuging, load onto the machine. The qPCR reaction program is as follows: 95°C: 3 min; (95°C: 25 s; 58°C: 25 s; 72°C: 25 s) × 40

[0050] Example 2: Construction of the JNK1 gene silencing model

[0051] The specific operation steps are as follows: Prepare a cell suspension from DF-1 cells in the logarithmic growth phase, inoculate it into a 6-well plate, set up the experimental groups [Si-NC(MG)], [Si-JNK1(MG)], the positive control group [MG], and the negative control group [BLANK], with 3 biological replicates in each group. The transfection steps are as follows:

[0052] (1) One hour before transfection, aspirate the cell culture medium, wash the cells twice with PBS without antibiotics, aspirate the PBS, and add 1.5 mL of Opti-MEM® I Reduced Serum Medium;

[0053] (2) Pipette 1.5 μL of LipofectamineTM 3000 and mix it into 50 μL of Opti-MEM® I Reduced Serum Medium;

[0054] (3) Pipette 1.5 μL of si-JNK1 and si-NC respectively and mix them into 50 μL of Opti-MEM® I Reduced Serum Medium, and let it stand at room temperature for 5 min;

[0055] (4) Mix the mixtures in steps (2) and (3), and let it stand at room temperature for 20 min to form a complex;

[0056] (5) Pipette 100 μL of the mixture into the prepared cells respectively, gently shake the cell culture plate to mix evenly, and replace the complete medium (containing 1% antibiotics) 4 - 6 h after transfection;

[0057] (6) Culture in a cell incubator at 39°C and 5% CO2 for 24 - 72 h, and then carry out subsequent experiments.

[0058] The reaction system for detecting whether the JNK1 silencing model is successfully constructed by qPCR is as follows:

[0059]

[0060] After mixing and centrifuging, load the sample onto the machine. The qPCR reaction program is as follows: 95°C: 3 min; (95°C: 25 s; 58°C: 25 s; 72°C: 25 s) × 40

[0061] Example 3: Silencing the JNK1 gene inhibits MG replication

[0062] 1. The cell resuscitation, culture, and construction of the silencing model refer to Examples 1 and 2

[0063] 2. Extract cell DNA using a kit:

[0064] (1) Take 0.5 - 2 mL of cell suspension, centrifuge at 10,000 r / min for 30 sec, aspirate and discard the supernatant as much as possible, and collect the cells.

[0065] (2) Resuspend with 200 µL of buffer RB, centrifuge at 10,000 r / min for 30 sec, and discard the supernatant. Vortex or pipette to resuspend the cells thoroughly in 180 µL of buffer RB.

[0066] (3) Add 20 µL of proteinase K (20 mg / mL) solution, mix well, then add 200 µL of binding buffer CB, immediately vortex thoroughly to mix, and incubate at 70°C for 10 min.

[0067] (4) After cooling, add 100 µL of isopropanol, immediately vortex thoroughly to mix. Flocculent precipitates may appear at this time.

[0068] (5) Transfer the mixture from the previous step (including any possible precipitates) to an adsorption column AC (the adsorption column is placed in a collection tube), centrifuge at 13,000 r / min for 30 - 60 sec, and pour out the waste liquid in the collection tube.

[0069] (6) Add 500 µL of inhibitor removal solution IR, centrifuge at 12,000 r / min for 30 sec, and discard the waste liquid.

[0070] (7) Add 600 µL of wash buffer WB (check if absolute ethanol has been added), centrifuge at 12,000 r / min for 30 sec, and discard the waste liquid.

[0071] (8) Add 600 µL of wash buffer WB, centrifuge at 12,000 r / min for 30 sec, and discard the waste liquid.

[0072] (9) Place the adsorption column AC back into an empty collection tube, centrifuge at 13,000 r / min for 2 min to remove as much wash buffer as possible to avoid residual ethanol in the wash buffer inhibiting downstream reactions.

[0073] (10) Take out the adsorption column AC and place it in a clean centrifuge tube. Add 10 µL of elution buffer EB to the middle part of the adsorption membrane (the elution buffer is preheated in a water bath at 65 - 70 °C for better effect), let it stand at room temperature for 3 - 5 min, and centrifuge at 12,000 r / min for 1 min. Re-add the obtained solution to the centrifugal adsorption column, let it stand at room temperature for 2 min, and centrifuge at 12,000 r / min for 1 min.

[0074] (11) DNA can be stored at 2 - 8 °C. If it needs to be stored for a long time, it can be placed at -20 °C.

[0075] 3. The method for extracting RNA from cells refers to step 3 in Example 1.

[0076] 4. qPCR was used to detect the expression levels of the adhesion protein MGC2 and GAPA of MG in DF-1 cells after silencing JNK1.

[0077] The primers used are as follows: MGC2-F: GGATGAGAACCAGTAGGGCG, MGC2-R: CTCCTTGAATGTCACCCGCT

[0078] GAPA-F: CAAGGTGCGTTCATTAGT, GAPA-R: GGATTGTTTTGAGGTGGA. The reaction system and procedure refer to Example 2.

[0079] Example 4: Effect of JNK1 on the proliferation of MG-infected DF-1 cells

[0080] The CCK-8 kit was used to detect cell proliferation. The specific steps are as follows:

[0081] (1) Prepare a cell suspension from DF-1 cells in the logarithmic growth phase, inoculate 8×10³ cells per well into a 96-well plate, and set up experimental groups [Over-JNK1 (MG+)], [SP600125 (MG+)], positive control groups [pcDNA3.1 (MG+)] and [DMSO (MG+)], and normal cell control group [Blank (MG-)]. Each group has 3 biological replicates and is detected at 3 time points.

[0082] (2) When the cells grow to 50 - 70%, transfect Over-JNK1 / SP600125 according to the instructions of Invitrogen's LipofectamineTM 2000, and culture in a cell incubator at 37 °C and 5% CO₂ for 10 h.

[0083] (3) MG challenge: Wash three times with PBS, add medium without antibiotics. For all groups except the blank group, add 8 μL of MG at a concentration of 1×10 10 CCU / ml to each well;

[0084] (4) At 12 h, 24 h, and 48 h after transfection, add 10 µL of CCK-8 reagent to each well at each time point, continue to culture for 3 h, and measure the absorbance at 450 nm using a microplate reader;

[0085] (5) Plot the proliferation curves of DF-1 at 12, 24, and 48 h after transfection.

[0086] Example 5: Detection of MG-induced cell inflammation using an ELISA kit

[0087] The relative expression levels of inflammatory factors were detected by enzyme-linked immunosorbent assay (ELISA). The specific operation steps are as follows: Dilution of standards: Prepare 6 small test tubes, number them in sequence. First, add 100 μL of standard diluent to each small test tube, then take 100 μL of the original concentration standard and add it to a numbered test tube, and mix well; then take 100 μL from this test tube and add it to the second test tube, and mix well; and so on. Set standard wells on the enzyme-coated plate, and add 50 μL of standards with different concentrations in sequence; Sample addition: Set blank wells (the blank control well does not add samples, enzyme-labeled reagents, and biotin-labeled antibodies, and the operations in the remaining steps are the same), and wells for samples to be tested. First add 40 μL of the sample to the wells for samples to be tested on the enzyme-coated plate, and then add 10 μL of the biotin-labeled antibody. When adding the sample, add it to the bottom of the wells on the enzyme plate, try not to touch the well walls, and gently shake to mix well; Enzyme addition: Add 50 μL of the enzyme-labeled reagent to each well, except for the blank well; Incubation: Seal the plate with a sealing film and incubate at 37 °C for 30 minutes; Solution preparation: Dilute the 30-fold concentrated washing solution 30-fold with distilled water and reserve it for use; Washing: Carefully remove the sealing film, discard the liquid, shake dry, fill each well with the washing solution, let it stand for 30 seconds and then discard, repeat this 5 times, and pat dry; Color development: First add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake to mix well, and develop color at 37 °C in the dark for 10 minutes; Termination: Add 50 μL of the termination solution to each well to terminate the reaction (at this time, the blue immediately turns yellow); Measurement: Set the blank well to zero, and measure the absorbance (OD value) of each well in sequence at a wavelength of 450 nm. The measurement should be carried out within 15 minutes after adding the termination solution; Calculation of experimental results: Use the concentration of the standard as the abscissa and the OD value as the ordinate, draw a standard curve on the coordinate paper, and find the corresponding concentration from the standard curve according to the OD value of the sample; or calculate the linear regression equation of the standard curve with the concentration of the standard and the OD value, substitute the OD value of the sample into the equation, and calculate the sample concentration, which is the actual concentration of the sample.

[0088] For the above data, two-group comparisons were performed using the two-tailed analysis of t-test in Microsoft Excel 2016. The test statistical results were expressed in the form of mean ± standard deviation (Mean ± SD). *p < 0.05 indicates significant difference, and **p < 0.01 indicates extremely significant difference.

[0089] SEQ ID NO.1

[0090] Nucleotide sequence of JNK1 gene: ATGATCCGCTCCGCTGTTGACATCCAGCCCGCCTGCCTGGGGCTGTACTGCGGCAGGGTCGTCCTGGCTGTCAACGGCTCCGTGGAGGTCTACGGGGACTGCGGGGTGTGTCCCAGAGGTCAACGAACCGATGACAACAAAATCTGCCGGGAGTGCGTGGGATCCCCGGACCGCTATGACTGGCTGTACCTCGGCTTCATGGCCATGCTGCCCCTCGTTCTGCACTGGTTCTTTATTGAGTGGTACTCGGGCAAAAAGAGTTCCAGTGCACTGTTGCAGCACATCACTGCCTTGTTTGAGTGCAGCATTGCAGCAATTGTTACTCTGCTAGTGAGTGACCCCGCTGGCTCTCTGCACATCCGTTCCTGCAAGGTGAAGAAGCTTTCAGACTGGTATACAATGCTCTACAACCCAAGTCCTGATTACATCACTACAGTGCACTGCACTCATGAAGCAGTCTATCCCCTGTACACGATTGTGTTTATATATTACGCCTTCTGCCTTGTGCTAATGATGCTACTTCGACCTTTTCTGGTTAAGAAAATTGCCTGTGGCTTAGGAAAGTCTGACCGATTTAAAAGCATTTATGCAGCGCTTTACTTCTTCCCAGTCCTCACTGTGCTCCAGGCAGTTGGAGGAGGCCTGCTCTATTATGCCTTTCCATACATCATACTGGTGTTGTCTCTGGTTACGTTGGCTGTGTACTTGTCTGCTTCTGAAGTGGAGTCTTTCAAGGATCTTCTTGTCAGGAAGAAAAGGCTTGTTGTCCTCCTCAGCCACTGGTTGCTTCATGCCTATGGAATCATCTCCATTCCCAAACTGGATAAGCTTGAGCAAGACCTCCCACTGCTTGCCTTGGTACCTGCACCTGCCATCTTCTACTTGATGACAGCAAAGTACACCGAGCCATCACGCATACTCTCAGAAGGTGGAAATGGACATTAA。

Claims

1. The JNK1 gene described above is the chicken JNK1 gene, and the nucleotide sequence encoded by this gene is as shown in SEQ ID NO.

1.

2. Use of a chicken JNK1 gene inhibitor, characterized in that, For the preparation of drugs for preventing or treating MG infection.

3. The use according to claim 2, characterized in that, The chicken JNK1 gene inhibitor includes siRNA that interferes with the expression of JNK1 protein through the RNAi mechanism, or a nucleic acid molecule or its expression vector that gene-edits and targets the knockout of the chicken JNK1 gene.

4. The use according to claim 2, wherein The sense strand of the siRNA is: GGCCAGAACUGCAGGAACUTT, and the antisense strand is: AGUUCCUGCAGUUCUGGCCTT.

5. For the preparation of a drug for preventing or treating MG infection, characterized in that, It includes a nucleic acid molecule that targets and knockdown / knocks out the chicken JNK1 gene and interferes with the expression of JNK1 protein.

6. A genetically engineered cell resistant to MG infection, characterized in that, The cell is a DF-1 cell with knockdown of the JNK1 gene.

7. Use of the DF-1 cell line in screening drugs against MG infection, characterized in that, A test group and a control group are set up. The test group is to add a test compound to DF-1 cells, and the control group is not to add a test compound to DF-1 cells. Compare the expression levels of the JNK1 gene in DF-1 cells in the test group and the control group, and screen for test compounds that significantly reduce the expression level of the JNK1 gene.

8. Application of the DF-1 cell line, characterized in that, A cell model for MG infection research.

Images