Application of OsACA1c gene in improvement of plant type, panicle type and grain shape of rice

Abstract

The invention discloses application of an OsACA1c gene in improvement of a plant type, an ear type and a grain shape of rice. Under the background of ZH11, the OsACA1c gene is knocked out, so that the grain length of a plant is remarkably increased, the grain width is not influenced, the length-width ratio of the grain is increased, meanwhile, the OsACA1c gene is knocked out, so that the plant height of the rice is remarkably reduced, the tillering of the rice is not influenced, secondary branches of the rice can be remarkably reduced, and the ear length and primary branches of the rice are not influenced. The results show that the OsACA1c gene under the background of ZH11 has important significance on crop breeding, and a target site is provided for accurate molecular breeding of crops.

Description

Technical Field

[0001] The present invention belongs to the technical fields of plant genetic engineering and plant genetic breeding, and particularly relates to the application of the OsACA1c gene in improving the plant type, panicle type and grain shape of rice. Background Art

[0002] Rice (Oryza Sativa L.) is one of the main food crops in the world, and more than half of the population mainly feeds on rice. Therefore, improving the yield and quality of rice is crucial for ensuring food security. The plant type, panicle type and grain shape of rice are the key factors determining its yield and quality. A reasonable plant type design can improve the photosynthesis efficiency, optimize nutrient absorption and enhance stress resistance, thereby promoting higher yields and adapting to different cultivation modes. The panicle type directly affects the seed setting rate, grain number and panicle grain distribution of rice, thus playing a crucial role in yield. The grain shape directly affects the appearance quality of rice, and further affects the processing quality and market competitiveness.

[0003] The plant type, panicle type and grain shape of rice are all regulated by multiple genes. In-depth study of these genes helps to reveal their molecular mechanisms and provide a theoretical basis for precision breeding. Combining molecular marker-assisted breeding and gene editing technologies can efficiently promote the optimization of the plant type, panicle type and grain shape of rice, improve the yield, quality and environmental adaptability of rice, and meet the global food demand. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide the application of biological materials related to the OsACA1c gene.

[0005] The OsACA1c gene is located on chromosome 12 at Chr12:24485276-24490995, and the gene locus number is LOC_Os12g39660 (phytozome database). Its full-length genomic sequence is 5719bp in total, including 7 exons, 6 introns, 5' untranslated region (5' UTR) and 3' untranslated region (3' UTR). Its cDNA full length is 3063bp (SEQ ID NO.1), encoding 1020 amino acids (SEQ ID NO.3), and the nucleotide sequence of the promoter is as shown in SEQ ID NO.2.

[0006] The purpose of the present invention is achieved by the following technical solutions:

[0007] Application of biological materials related to the OsACA1c gene, wherein:

[0008] The biological materials are any one or more of the following substances A, B, C, D, E, F:

[0009] The full-length genomic DNA of the A. OsACA1c gene or its homologous nucleic acid molecule;

[0010] The cDNA of the B. OsACA1c gene or its homologous nucleic acid molecule;

[0011] The protein encoded by the C. OsACA1c gene or its homologous protein;

[0012] The promoter for the expression of the D. OsACA1c gene or its homologous nucleic acid molecule;

[0013] E. A substance that can change the expression level and / or activity of substance A, B or D;

[0014] F. A substance that can change the expression level and / or activity of substance C.

[0015] Furthermore, the nucleotide sequence of the full-length genomic DNA described in A is as shown in the sequence with the gene locus number LOC_Os12g39660 in the phytozome database.

[0016] Furthermore, the homologous nucleic acid molecule described in A refers to a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the full-length genomic DNA.

[0017] Furthermore, the nucleotide sequence of the cDNA described in B is as shown in SEQ ID NO.1.

[0018] Furthermore, the homologous nucleic acid molecule described in B refers to a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the sequence shown in SEQ ID NO.1.

[0019] Furthermore, the amino acid sequence of the protein described in C is as shown in SEQ ID NO.3.

[0020] Furthermore, the homologous protein described in C refers to a protein having at least 60%, at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the sequence shown in SEQ ID NO.3.

[0021] Furthermore, the nucleotide sequence of the promoter described in D is as shown in SEQ ID NO.2.

[0022] Furthermore, the homologous nucleic acid molecule described in D refers to a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the sequence shown in SEQ ID NO.2.

[0023] Furthermore, the application described above is any one or more of the following applications 1), 2), 3), 4):

[0024] 1) Application in regulating rice grain shape;

[0025] 2) Application in improving rice plant type;

[0026] 3) Application in improving rice panicle type;

[0027] 4) Application in transgenic rice breeding.

[0028] Furthermore, the substance E includes any one of the following substances I and II:

[0029] I. A substance that can increase the expression level and / or activity of substance A, B or D;

[0030] II. A substance that can decrease the expression level and / or activity of substance A, B or D.

[0031] Furthermore, the substance F includes any one of the following substances i and ii:

[0032] i. A substance that can increase the expression level and / or activity of substance C;

[0033] ii. A substance that can decrease the expression level and / or activity of substance C.

[0034] Furthermore, the application described in 1) includes but is not limited to: the application of substance II or ii in increasing rice grain length, and / or the application of substance II or ii in increasing the length-width ratio of rice.

[0035] Furthermore, the application described in 2) includes but is not limited to: the application of substance II or ii in reducing rice plant height.

[0036] Furthermore, the reduction of rice plant height means reducing the rice plant height while the tiller number remains unchanged.

[0037] Furthermore, the application described in 3) includes but is not limited to: the application of substance II or ii in reducing the secondary branches of rice.

[0038] Furthermore, the reduction of the secondary branches of rice means reducing the secondary branches of rice while the primary branches and panicle length remain unchanged.

[0039] Furthermore, the breeding method described in 4) includes but is not limited to transgenesis, hybridization, backcrossing, self-crossing or asexual reproduction.

[0040] Further, the substance I or i is selected from: a recombinant vector containing the corresponding nucleic acid molecule, an expression cassette, a transgenic cell line, a transgenic plant tissue or a recombinant bacterium.

[0041] Further, the substance II or ii is selected from: an sgRNA for knocking out gene expression or a CRISPR system containing the sgRNA.

[0042] Furthermore, the 5'-3' targeting sequence of the sgRNA is: GCGGATGGGTTAAGTACAGC.

[0043] Furthermore, the vectors used in the CRISPR system include SK-gRNA and pC1300-Cas9.

[0044] Further, the rice includes Zhonghua 11 (ZH11).

[0045] The present invention has the following advantages and effects compared with the prior art:

[0046] (1) Knocking out the OsACA1c gene can significantly increase the length of plant grains, does not affect the grain width, and increases the length-width ratio of the grains.

[0047] (2) Knocking out the OsACA1c gene can significantly reduce the plant height of rice without affecting the tillering of rice.

[0048] (3) Knocking out the OsACA1c gene can significantly reduce the secondary branches of rice without affecting the panicle length and primary branches of rice.

[0049] The present invention discovers that knocking out the OsACA1c gene in rice can significantly increase the length of rice grains, does not affect the grain width, and increases the length-width ratio of the grains. At the same time, it can significantly reduce the plant height of rice without affecting the tillering of rice, and can significantly reduce the secondary branches of rice without affecting the panicle length and primary branches of rice. The above results are of great significance for crop breeding and provide target sites for precise molecular breeding of crops. Description of the Drawings

[0050] Figure 1Research result figure on the effect of knocking out the OsACA1c gene on rice grain size; among them, A. Mutation type of the KO-OsACA1c line; B. Grain shape diagrams of ZH11 and KO-OsACA1c plants (scale bar = 1 cm); C. Grain length statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 50); D. Grain width statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 50); E. Grain length-to-width ratio statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 5); t-test was used for significance analysis, **P < 0.01.

[0051] Figure 2 Research result figure on the effect of knocking out the OsACA1c gene on rice plant type; among them, A. Mutation type of the KO-OsACA1c line; B. Plant type diagrams of ZH11 and KO-OsACA1c plants (scale bar = 10 cm); C. Plant height statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 20); D. Tillering statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 20); t-test was used for significance analysis, **P < 0.01.

[0052] Figure 3 Research result figure on the effect of knocking out the OsACA1c gene on rice panicle type; among them, A. Mutation type of the KO-OsACA1c line; B. Panicle type diagrams of ZH11 and KO-OsACA1c plants (scale bar = 5 cm); C. Panicle length statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 20); D. Primary branch statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 20); E. Secondary branch statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 20); t-test was used for significance analysis, **P < 0.01. Detailed implementation manners

[0053] The present invention will be further described in detail below in conjunction with the embodiments and the accompanying drawings, but the implementation manners of the present invention are not limited thereto.

[0054] The experimental methods used in the following embodiments are all conventional methods unless otherwise specified.

[0055] Unless otherwise specified, m / v in the following embodiments is g / mL.

[0056] All raw materials and equipment used in the present invention are conventional commercially available products, which can be directly obtained through market purchase. The primer sequences used are all synthesized by Shanghai Genomics Co., Ltd.

[0057] The OsACA1c gene is located on chromosome 12, Chr12:24485276-24490995, and its locus ID is LOC_Os12g39660 (phytozome database). Its full-length genomic sequence is 5719 bp, including 7 exons, 6 introns, 5' untranslated region (5' UTR) and 3' untranslated region (3' UTR). Its cDNA full length is 3063 bp (SEQ ID NO.1), encoding 1021 amino acids (SEQ ID NO.3).

[0058] The intermediate / linearized vectors of the dual-target CRISPR editing vector used in the following examples: SKm-gRNA (equivalent to SK-gRNA) and the final vector: pC1300-Ubi-Cas9 (equivalent to pC1300-Cas9) have been disclosed in the literature "Wang C, Shen L, Fu Y, et al. A Simple CRISPR / Cas9 System for Multiplex Genome Editing in Rice [J]. Journal of Genetics and Genomics, 2015, 42(12):703-706".

[0059] Example 1: Construction of the OsACA1c gene knockout vector

[0060] 1) Construction of the pC1300-Ubi-Cas9::bZIP38 knockout vector

[0061] According to the structural characteristics of the OsACA1c gene, a specific target site: 5'-GCGGATGGGTTAAGTACAGC-3' was selected at the 3rd exon. Primers were designed, mixed and heated, and then cooled to room temperature to obtain a double-stranded target. The SK-gRNA vector was digested with AarI restriction endonuclease to form sticky ends, and the linearized SK-gRNA vector was purified and recovered by agarose gel electrophoresis. The double-stranded target and the linearized SK-gRNA vector were ligated with T4 ligase to obtain the recombinant vector SK-gRNA-OsACA1c. The pC1300-Cas9 vector was digested with Kpn I and BamH I restriction endonucleases and recovered by gel for standby. The recovered linearized pC1300-Cas9 vector and the obtained gRNA were ligated with T4 ligase to obtain the recombinant vector pC1300-Cas9::OsACA1c.

[0062] Example 2, Creation of KO-OsACA1c#1 and KO-OsACA1c#2 Transgenic Plants

[0063] 1) Surface Sterilization of Rice (ZH11) Seeds

[0064] Remove the glumes of rice seeds, wash the seeds with dishwashing liquid, after rinsing thoroughly, soak them in 70% ethanol for 1 - 2 min, rinse with sterile water 3 times, soak them in 30% sodium hypochlorite solution (volume percentage, the active chlorine in the sodium hypochlorite stock solution is not less than 5%) for 30 minutes, and rinse with sterile water 3 - 5 times.

[0065] 2) Callus Induction

[0066] Place the surface-sterilized seeds on sterile filter paper, blot dry the surface moisture, place them with sterile forceps on N6 medium containing 2 mg / L 2,4-D (2.5 mg / L), and culture in the dark at 26 - 28°C. Induce callus for 2 weeks, subculture the callus on NB medium for 2 weeks, and then select dense and bright yellow callus for subculture for one week for transformation.

[0067] 3) Agrobacterium Culture

[0068] Streak the Agrobacterium EHA105 with the recombinant vector pC1300-Ubi-Cas9::OsACA1c on a YM medium plate containing 50 mg / L Kanamycin, culture in the dark at 28°C for 2 - 3 days, collect the Agrobacterium cells with a metal spoon, suspend them in NB liquid medium, adjust the cell concentration to OD600 of 0.3 - 0.5, and add AS to make the final concentration of AS 100 μM, which is the Agrobacterium suspension for co-culturing and transforming rice.

[0069] 4) Agrobacterium Infection of Callus

[0070] Select vigorously growing callus granules, soak them in the Agrobacterium suspension for 10 - 20 min, filter dry the bacterial liquid, transfer the infected callus to sterile dry filter paper, and culture in the dark at 26 - 28°C for 2 - 3 days. After the co-culture, place the callus in a 100 mL Erlenmeyer flask and wash it thoroughly 5 times with sterile water containing 500 mg / L Cb, blot dry the moisture with sterile filter paper, and then transfer it to the selection medium (NB medium + 2 mg / L 2,4-D + 500 mg / L Cb + 50 mg / L Hyg) for selection culture. Replace the selection medium once every 2 weeks, and culture for another 2 - 3 weeks. Select vigorously growing and dense callus tissue and transfer it to the pre-differentiation medium (NB medium + 5 mg / L ABA + 1 mg / L 6BA + 2 mg / L NAA + 250 mg / L Cb + 50 mg / L Hyg), and culture in the dark at 26 - 28°C for about 1 week.

[0071] 5) Differentiation

[0072] Transfer the callus to a differentiation medium (NB medium + 2 mg / L 6-BA + 250 mg / L Cb + 50 mg / L Hyg + 1 g / L casein hydrolysate + 0.1 mg / L NAA), and culture it under light at 26-28 °C until regenerated plants differentiate.

[0073] 6) Identification of positive plants

[0074] Extract the total DNA of transgenic rice. Using the DNA as a template, specific primers are designed based on the tag gene carried by the vector and our target gene for PCR amplification. The positive transgenic plants are judged jointly according to the amplified bands and sequencing.

[0075] Example 3: Phenotype measurement and statistical analysis

[0076] The plants of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 are all planted in the field with a longitudinal plant spacing between 10-15 cm and a transverse plant spacing between 13-20 cm. After the seeds mature, phenotype photographs are taken and measurements are made as follows:

[0077] Analysis of grain length and width: Randomly collect 50 grains for statistics.

[0078] Analysis of plant height and tillering: Randomly collect 20 plants for statistics.

[0079] Analysis of panicle length, primary branch rachis, and secondary branch rachis: Randomly collect 20 plants for statistics.

[0080] All data are analyzed using Graphpad Prism 8 software. The standard deviation is represented by SD, and the t-test is used for variance analysis.

[0081] Figure 1 It is a result graph for studying the effect of knocking out the OsACA1c gene on rice grain size; among them, A. Mutation types of the KO-OsACA1c strain; B. Grain shape diagrams of ZH114 and KO-OsACA1c plants (scale bar = 1 cm); C. Grain length statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 50); D. Grain width statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 50); E. Grain length-width ratio statistics of ZH11, KO-OsACA1c#1, and KO-OsACA1c#2 plants (n = 50); The t-test is used for significance analysis, **P < 0.01.

[0082] From Figure 1It can be seen that knocking out the OsACA1c gene can significantly increase the grain length of plants, without affecting the grain width, and significantly increase the length-width ratio of plant grains. Generally speaking, knocking out the OsACA1c gene can change the shape of rice grains.

[0083] Figure 2 Figure showing the research results of the effect of knocking out the OsACA1c gene on the plant type of rice; among them, A. Mutation type of the KO-OsACA1c line; B. Plant type diagrams of ZH11 and KO-OsACA1c plants (scale = 10 cm); C. Plant height statistics of ZH11, KO-OsACA1c#1 and KO-OsACA1c#2 plants (n = 20); D. Tillering statistics of ZH11, KO-OsACA1c#1 and KO-OsACA1c#2 plants (n = 20); t-test was used for significance analysis, **P<0.01.

[0084] From Figure 2 It can be seen that knocking out the OsACA1c gene can significantly reduce the plant height of rice, without affecting the tillering of rice. Generally speaking, knocking out the OsACA1c gene can change the plant type of rice.

[0085] Figure 3 Figure showing the research results of the effect of knocking out the OsACA1c gene on the panicle type of rice; among them, A. Mutation type of the KO-OsACA1c line; B. Panicle type diagrams of ZH11 and KO-OsACA1c plants (scale = 5 cm); C. Panicle length statistics of ZH11, KO-OsACA1c#1 and KO-OsACA1c#2 plants (n = 20); D. Primary rachis branch statistics of ZH11, KO-OsACA1c#1 and KO-OsACA1c#2 plants (n = 20); E. Secondary rachis branch statistics of ZH11, KO-OsACA1c#1 and KO-OsACA1c#2 plants (n = 20); t-test was used for significance analysis, **P<0.01.

[0086] From Figure 3 It can be seen that knocking out the OsACA1c gene can significantly reduce the secondary rachis branches of rice, without affecting the panicle length and primary rachis branches of rice. Generally speaking, knocking out the OsACA1c gene can change the panicle type of rice.

[0087] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. Use of a biological material related to the OsACA1c gene, wherein the nucleotide sequence of the OsACA1c gene is as shown in SEQ ID NO.1, characterized in that: The biological material is any one or more of the following substances A, B, C, D, E, and F: A. The full-length genomic DNA of the OsACA1c gene or its homologous nucleic acid molecule; B. The cDNA of the OsACA1c gene or its homologous nucleic acid molecule; C. The protein encoded by the OsACA1c gene or its homologous amino acid sequence; D. A substance capable of changing the expression level and / or activity of substances A and B; E. A substance capable of changing the expression level and / or activity of substance C; The use is any one or more of the following uses 1), 2), 3), and 4): 1) Use in regulating rice grain shape; 2) Use in improving rice plant type; 3) Use in improving rice panicle type; 4) Use in transgenic rice breeding.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the full-length genomic DNA described in A is as shown in the sequence with the gene locus number LOC_Os12g39660 in the phytozome database; The homologous nucleic acid molecule described in A refers to a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the nucleotide sequence of the full-length genomic DNA.

3. The use according to claim 1, characterized in that: The nucleotide sequence of the cDNA described in B is as shown in SEQ ID NO.1; The homologous nucleic acid molecule described in B refers to a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the sequence shown in SEQ ID NO.

1.

4. The use according to claim 1, characterized in that: The amino acid sequence of the protein described in C is as shown in SEQ ID NO.3; The homologous amino acid sequence described in C refers to an amino acid sequence having at least 60%, at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the sequence shown in SEQ ID NO.

3.

5. The use according to any one of claims 1-4, characterized in that: Substance E includes any one of the following substances I and II: I. A substance capable of increasing the expression level and / or of substances A, B, or D; II. A substance capable of decreasing the expression level and / or of substances A, B, or D; Substance F includes any one of the following substances i and ii: i. A substance capable of increasing the expression level and / or of substance C; ii. A substance capable of decreasing the expression level and / or of substance C.

6. The application according to claim 5, wherein: Application 1) includes: the application of Substance II or ii in increasing the grain length of rice, and / or the application of Substance II or ii in increasing the length-width ratio of rice; Application 2) includes: the application of Substance II or ii in reducing the plant height of rice; Application 3) includes: the application of Substance II or ii in reducing the secondary branches of rice; Application 4) includes: the breeding method includes transgenic, hybridization, backcross, self-cross or asexual reproduction.

7. The application according to claim 6, wherein: The reduction of the plant height of rice is to reduce the plant height of rice while the tillering remains unchanged; The reduction of the secondary branches of rice is to reduce the secondary branches of rice while the primary branches and the panicle length remain unchanged.

8. The application according to claim 6, wherein: Substance I or i is selected from: a recombinant vector containing the corresponding nucleic acid molecule, an expression cassette, a transgenic cell line, a transgenic plant tissue or a recombinant bacterium; Substance II or ii is selected from: an sgRNA for knocking out gene expression or a CRISPR system containing the sgRNA.

9. The application according to claim 8, wherein: The 5'-3' targeting sequence of the sgRNA is: GCGGATGGGTTAAGTACAGC; The vectors used in the CRISPR system include SK-gRNA and pC1300-Cas9.

10. The application according to any one of claims 1-4, wherein: The rice is Zhonghua 11.

Images