Application of chrysanthemum MYB-A protein to regulation and control of flower color of day lily, cultivation method of chrysanthemum MYB-A protein and related biological materials

By introducing the chrysanthemum MYB-A gene into the daylily and overexpressing it, the problem of time-consuming and low efficiency of traditional daylily breeding methods is solved, and the precise regulation and diversification of the colors are achieved to meet market demand.

CN120350064APending Publication Date: 2025-07-22SHANDONG HEZHENG ECOLOGICAL AGRI DEV CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510341681.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-21
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The existing daylily flower-color breeding methods rely on traditional hybridization and mutagenesis breeding, which consumes time and is inefficient, making it difficult to accurately control the color changes of the color, and lacks in-depth understanding of the color-control genes, which limits the accuracy and diversity of color breeding.

Method used

By cloning the MYB-A gene from chrysanthemum, constructing a recombinant plant expression vector, and introducing it into daylily using Agrobacterium transformation method, the overexpression of chrysanthemum MYB-A protein in daylily is achieved, and the color of the chrysanthemum is regulated, making it darker or mottled.

Benefits of technology

It has achieved precise control of the color of daylily, enriched the types of color, shortened the breeding cycle, improved the breeding efficiency, and met the market's demand for diversified ornamental flowers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350064A_ABST
    Figure CN120350064A_ABST
Patent Text Reader

Abstract

The invention relates to the field of plant breeding, and particularly discloses application of chrysanthemum MYB-A protein to regulation and control of flower color of day lily, a cultivation method of the chrysanthemum MYB-A protein and a related biological material. According to the application, the MYB-A gene is cloned from chrysanthemum, a recombinant plant expression vector is successfully constructed, and the recombinant plant expression vector containing the chrysanthemum MYB-A gene is transformed into day lily by adopting an agrobacterium transformation method. Researches show that overexpression of the MYB-A gene in hemerocallis fulva remarkably affects the flower color of the hemerocallis fulva, so that the flower color of a transgenic plant is darkened or mottle phenomenon occurs. The discovery proves that the chrysanthemum MYB-A gene plays an important role in regulating and controlling the flower color of the hemerocallis fulva, the effective regulation and control on the flower color of the hemerocallis fulva are realized, and the flower color characteristics of the hemerocallis fulva can be accurately changed under the condition of not depending on traditional hybridization or mutation breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of plant breeding, and more specifically, to an application of chrysanthemum MYB-A protein in regulating the flower color of daylilies, a cultivation method thereof, and related biological materials. Background Art

[0002] Daylilies (Hemerocallis spp.) are perennial herbaceous flowers with slender green scapes during the flowering period. The petals are brightly colored and graceful, and have high ornamental value. Because of its strong resistance to adversity, easy cultivation, various forms, and cultural value, it has become one of the world's famous ornamental flowers. Daylilies have a long history of cultivation in Chinese classical gardens. Their bright colors and lovely postures add a lot of poetry and liveliness to the gardens. There are many descriptions of the flowers and colors of daylilies in Tang Dynasty poems, showing their important position in culture and aesthetics. Daylilies are not only ornamental, but also edible and medicinal. At present, daylily color breeding has become a hot area of breeding research. Through the study of flower color changes, we can not only deeply understand the genetic mechanism of daylilies, but also cultivate more new varieties with specific flower colors.

[0003] The MYB transcription factor gene family is the second largest transcription factor superfamily in flowering plants. It has a large number of family members. It mainly activates or inhibits the transcription process of genes by specifically binding to cis-factors, and then participates in the regulation of plant growth and development, metabolism, and stress. A large number of studies have shown that MYB transcription factors are widely involved in the regulation and accumulation of anthocyanin biosynthesis in horticultural plants, including common fruits and vegetables such as grapes (Vitis vinifera), apples (Malus domestica), tomatoes (Solanum lycopersicum), peppers (Capsicum annuum), and important ornamental horticultural plants such as orchids (Cymbidium), lilies (Lilium), and roses (Rosa chinensis).

[0004] However, there are relatively few studies on the involvement of MYB transcription factors in the regulation of carotene synthesis, especially in the study of daylilies, where no relevant reports have been reported so far. This research gap not only limits our comprehensive understanding of the mechanism of daylily flower color formation, but also hinders the process of using MYB transcription factors for daylily flower color breeding. At present, the existing daylily flower color breeding methods mainly rely on traditional hybrid breeding and mutagenesis breeding, which are often time-consuming, inefficient, and difficult to accurately control the changes in flower color. In addition, due to the lack of in-depth understanding of daylily flower color regulatory genes, it is difficult to carry out targeted genetic engineering modifications, which limits the accuracy and diversity of daylily flower color breeding. Summary of the invention

[0005] The purpose of the present application is to provide an application of chrysanthemum MYB-A protein in regulating the color of Hemerocallis flowers, a cultivation method for deepening or mottling the color of Hemerocallis flowers, and biological materials for cultivating Hemerocallis flowers of different colors, which have the advantages of improving the accuracy and diversity of Hemerocallis flower color breeding, shortening the breeding cycle, and improving the breeding efficiency.

[0006] The present application adopts the following technical solutions: In the first aspect, the present application provides an application of chrysanthemum MYB-A protein in regulating the color of Hemerocallis flowers, and the amino acid sequence of the above-mentioned chrysanthemum MYB-A protein is shown in SEQ ID NO.01.

[0007] Furthermore, the gene sequence of the ORF region encoding the chrysanthemum MYB-A protein is shown in SEQ ID NO.02.

[0008] Through the above technical solution, as a regulatory factor, chrysanthemum MYB-A protein can specifically participate in the synthesis pathway of Hemerocallis flower pigments through its specific amino acid sequence, thereby affecting the expression of Hemerocallis flower color. By introducing chrysanthemum MYB-A protein, this technical solution can effectively regulate the color of Hemerocallis flowers, making the color of Hemerocallis flowers deeper or mottled, and more diverse and beautiful. Specifically, in the present invention, the MYB-A gene was cloned from chrysanthemum, a recombinant plant expression vector was successfully constructed, and the recombinant plant expression vector containing the chrysanthemum MYB-A gene was transformed into Hemerocallis by Agrobacterium-mediated transformation. The experimental results showed that the overexpression of the MYB-A gene in Hemerocallis significantly affected the color of Hemerocallis flowers, making the flower color of transgenic plants deeper or showing mottled phenomena. This finding confirmed the important role of the chrysanthemum MYB-A gene in regulating the color of Hemerocallis flowers.

[0009] In the second aspect, the present application provides a cultivation method for deepening or mottling the color of Hemerocallis flowers, which includes: (1) Introducing the gene encoding the chrysanthemum MYB-A protein into Hemerocallis plants to obtain transgenic plants, wherein the gene sequence of the gene encoding the chrysanthemum MYB-A protein is shown in SEQ ID NO.02; (2) Overexpressing the gene of the chrysanthemum MYB-A protein in Hemerocallis plants.

[0010] Through the above technical solution, by introducing the gene encoding chrysanthemum MYB-A protein into Hemerocallis plants and overexpressing this gene in Hemerocallis, the effect of deepening or mottling the flower color of Hemerocallis is achieved. This method can be realized in the following ways: One is through the Agrobacterium-mediated transformation method, introducing the recombinant plant expression vector containing the chrysanthemum MYB-A gene into the callus of Hemerocallis plants to obtain transgenic plants; the other is directly introducing the gene into Hemerocallis plant cells by the particle bombardment method. No matter which method is adopted, ultimately it is necessary to ensure that the chrysanthemum MYB-A gene can be stably and highly expressed in Hemerocallis plants, so as to achieve the expected flower color change effect.

[0011] The cultivation method of this application has successfully achieved the deepening or mottling of the flower color of Hemerocallis by introducing and overexpressing the chrysanthemum MYB-A gene. Compared with the prior art, by introducing and overexpressing specific genes, this application can precisely regulate the flower color change of Hemerocallis, improving the efficiency and success rate of breeding.

[0012] Furthermore, the process of obtaining the transgenic plants includes: the step of introducing a bioengineered bacterium containing a recombinant plant expression vector into the callus of the Hemerocallis plant; The recombinant plant expression vector contains the gene sequence encoding the chrysanthemum MYB-A protein.

[0013] Furthermore, the above bioengineered bacterium is Agrobacterium tumefaciens GV3101.

[0014] Furthermore, the above recombinant plant expression vector is the GV1300-GFP recombinant plasmid containing the gene sequence encoding the chrysanthemum MYB-A protein.

[0015] In the third aspect, this application provides a biological material for cultivating Hemerocallis with different flower colors, which is characterized in that it includes the gene sequence encoding the chrysanthemum MYB-A protein as shown in SEQ ID NO.02.

[0016] Furthermore, the above biological material includes any one of the following: (a) A recombinant cloning vector containing the gene encoding chrysanthemum MYB-A; (b) A recombinant plant expression vector containing the gene encoding chrysanthemum MYB-A; (c) A recombinant plant expression vector obtained by connecting a tag to the N-terminus and / or C-terminus of the gene described in (b); (d) A bioengineered bacterium containing the recombinant vector described in (a) or (b).

[0017] Through the above technical solutions, the specific forms of the biological materials include recombinant cloning vectors and recombinant plant expression vectors. The recombinant cloning vector is to clone the chrysanthemum MYB-A gene into the vector to facilitate gene amplification and operation. The recombinant plant expression vector is to insert the chrysanthemum MYB-A gene into a vector that can be expressed in plant cells, and these vectors usually contain elements such as promoters and terminators. By connecting tags to the N-terminus and / or C-terminus of the gene in the recombinant plant expression vector, the stability and expression level of the gene can be increased. The bioengineered bacteria containing these recombinant vectors can transfer the genes in the recombinant vectors into Hemerocallis plants, thereby achieving gene integration and expression.

[0018] In this application, by introducing the chrysanthemum MYB-A gene into Hemerocallis plants, it is found that the overexpression of the MYB-A gene can affect the flower color of Hemerocallis, making its flower color mottled or darker. Thus, the chrysanthemum MYB-A gene, as an excellent gene resource, can be widely applied to the genetic breeding fields of Hemerocallis or other flower plants, which is of great significance for flower color breeding.

[0019] Furthermore, the above plant expression vector is GV1300.

[0020] In the above technical solutions, by using GV1300 as the plant expression vector, it can ensure the stable and efficient expression of the chrysanthemum MYB-A gene in Hemerocallis.

[0021] Furthermore, the above bioengineered bacteria are Agrobacterium tumefaciens GV3101.

[0022] In the above technical solutions, Agrobacterium tumefaciens GV3101 has high efficiency and stability in the transformation process, and can effectively introduce the gene sequence encoding the chrysanthemum MYB-A protein, thereby achieving the overexpression of the gene in Hemerocallis. By using Agrobacterium tumefaciens GV3101 as the bioengineered bacteria, the recombinant plant expression vector containing the chrysanthemum MYB-A gene can be efficiently introduced into Hemerocallis plants to ensure the stable expression of the gene, thus solving the technical problem of the darker or mottled flower color of Hemerocallis.

[0023] In summary, this application has the following beneficial effects: 1. Through the application of the chrysanthemum MYB-A protein in this application, the effective regulation of the flower color of Hemerocallis is achieved, and the flower color characteristics of Hemerocallis can be precisely changed without relying on traditional hybridization or mutagenesis breeding. 2. After introducing the chrysanthemum MYB-A protein gene in this application, the flower color of Hemerocallis can become darker or show a mottled effect, enriching the flower color types of Hemerocallis and meeting the market demand for diversified ornamental flowers. 3. This application provides an efficient breeding method based on genetic engineering technology, significantly shortening the breeding cycle and improving the breeding efficiency, and solving the problems of long cycle and low efficiency in the prior art. Brief Description of the Drawings

[0024] Figure 1 Shown is the PCR identification electrophoresis map of transgenic Hemerocallis fulva in Example 3 of the present invention, where M is DL2000 marker, 1 is the GV1300-MYB-A-GFP recombinant plasmid, and 2-8 are 7 transgenic Hemerocallis fulva lines; Figure 2 Shown is the positive Hemerocallis fulva callus map taken by using a fluorescence microscope in Example 3 of the present invention, where WT is the wild type, GV1300-MYB-A-GFP is the empty vector transformed callus, and MYB-A is the transgenic callus; Figure 3 Shown is the phenotype map of wild type and transgenic Hemerocallis fulva in Example 3 of the present invention, where WT is the wild type, and MYB-A is the transgenic Hemerocallis fulva flower; Figure 4 Shown is the carotenoid content in the petals of Hemerocallis fulva transformed with chrysanthemum MYB-A gene in Example 3 of the present invention. Detailed Embodiments

[0025] The following will describe the implementation schemes of the present invention in detail in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. For the specific conditions not specified in the examples, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. For the reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0026] The following will detail the specific embodiments of the present invention. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not used to limit the present invention.

[0027] Example 1 This example provides the cloning of chrysanthemum MYB-A protein gene 1. Extraction of total plant RNA Take 50-100 μg of chrysanthemum leaves (stored at -80 °C) and add them to a mortar fully cooled with liquid nitrogen, and grind until powdery.

[0028] The total plant RNA is extracted using the OminiPlant RNA Kit (Dnase I) (ComWin Biotech Co., Ltd., China) kit, and the total RNA in chrysanthemum leaves is extracted according to the instructions.

[0029] 2. cDNA synthesis: The cDNA was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser (PerfectReal Time) (Takara, Japan) according to the instructions to obtain the cDNA of chrysanthemum leaves.

[0030] 1. Gene cloning Primers were designed to clone the ORF region encoded by the chrysanthemum MYB-A gene. The primers are as follows: MYB-A-F1: 5’-TGGAGCCCAGACGAGGAC-3’ (SEQ ID NO.03) MYB-A-R1: 5’-CATTCCGTTACCACCACCAC-3’ (SEQ ID NO.04) Using the first strand of chrysanthemum leaf cDNA as a template (the amount used was 1 - 5 μL, not exceeding 1 / 10 of the total PCR reaction volume), and the specific primers of the gene as the upstream and downstream primers, PCR amplification was carried out according to the PCR reaction system and PCR reaction program. The high-fidelity enzyme of vazyme company was used to amplify the target gene.

[0031] The PCR reaction system was 50 μL, including 2 μL of template cDNA, 25 μL of 2×PCR buffer for KOD FX, 10 μL of 2 mM dNTPs, 1 μL of each upstream and downstream primer, 1 μL of KOD FX, and 10 μL of ddH2O.

[0032] The PCR reaction program was: 94℃ for 2 min; 98℃ for 10 s, 58℃ for 30 s, 68℃ for 90 s, with 35 cycles; 68℃ for 10 min.

[0033] After PCR amplification, the amplification product was obtained; the amplification product was ligated to the cloning vector PEASY-Blun-Zero (TransGen Biotech, China), transformed into Escherichia coli, and positive clones were screened for sequencing.

[0034] The obtained sequence of the ORF region encoded by the chrysanthemum MYB-A gene is as follows: TGGAGCCCAGACGAGGACGAAATGTTGACGAACCTGGTCGAAAAACACGGGCCGAGAAACTGGTCTTTGATAAGTAAATCAATACCGGGTAGATCGGGTAAATCGTGCAGGTTGCGTTGGTGTAACCAGTTGTCACCAGAAGTGGAGCATAGGGCTTTTACACCAGAAGAAGATGAGACGATCTTACGTGCACATGCTAGGTTTGGTAATAAATGGGCAACTATTGCTAGGCTTTTATCAGGCAGGACTGATAATGCTATTAAGAACCATTGGAATTCTACTTTGAAAAGAAAATGCTCCTCTATGACTAACGAGGAGTTTAATGAGCTGCAGGTTCAACAGCCCATGTTGAAAAGATCTGTTAGCGCGGGTTCAGGCGTACCCATTTCTTCTTCTGGTTACTTTCACCAGTTCAATAATACTCCAAACAGTCCAACCGGTTCCGAGATTAGTGATTCCAATATCCAAGGGCTGACGTCATCAACAAATCTTTTCACCGTCGTTCCTCCTCCGCCACCGGTGGTCAATGATCCTCCGACGAGCTTAAGCCTATCATTACCAGGAGTTGATTCTGATATGAAGGAAAACTCTCCACCGCCGCCGGTGACGGTTGCGGCGAATGTGATGCCGATAAGACAAGTACCGGCGGAGATGATGACGGCGATACCGGCGGCGATATCGACGGCGATGCAGGAGTTGAGGGTGTCGAAGCCGCCGGCGCCGGAGAAGCCGTTTGTGCCGTTTAATAATGAGTTTATGAGTGTGATGCAAGAGATGATAAGGAAGGAGGTTAGGAAATATATGATGGAGCAACGGGGTGGTGGTGGTGGTAACGGAATG (SEQ ID NO.02).

[0035] The ORF region encoded by the chrysanthemum MYB-A gene contains 840 bases and encodes 280 amino acids. The sequence is as follows: WSPDEDEMLTNLVEKHGPRNWSLISKSIPGRSGKSCRLRWCNQLSPEVEHRAFTPEEDETILRAHARFGNKWATIARLLSGRTDNAIKNHWNSTLKRKCSSMTNEEFNELQVQQPMLKRSVSAGSGVPISSSGYFHQFNNTPNSPTGSEISDSNIQGLTSSTNLFTVVPPPPPVVNDPPTSLSLSLPGVDSDMKENSPPPPVTVAANVMPIRQVPAEMMTAIPAAISTAMQELRVSKPPAPEKPFVPFNNEFMSVMQEMIRKEVRKYMMEQRGGGGGNGM (SEQ ID NO.01).

[0036] Example 2 This example provides the construction of a plant expression vector The vector construction was carried out using the ClonExpress II One Step Cloning Kit (Vazyme, China) homologous recombination kit according to the instructions: (1) Using the method of homologous recombination, vector homologous arm primers with Sal I and BamH I restriction sites were designed to amplify the chrysanthemum MYB-A gene, and the target fragment was recovered. The vector homologous arm primers were Sal I and BamH I restriction sites, as follows: MYB-A-F2: (SEQ ID NO.05) 5’-TTGATACATATGCCCGTCGACTGGAGCCCAGACGAGGAC-3’ MYB-A-R2: (SEQ ID NO.06) 5’-CCCTTGCTCACCATGGATCCCATTCCGTTACCACCACCAC-3’ (2) The expression vector GV1300-GFP plasmid was digested with Sal I and BamH I restriction endonucleases, and the vector fragment was recovered. The linearized vector was ligated with the MYB-A gene fragment, transformed into competent Escherichia coli and plated, and monoclonal strains were selected.

[0037] (3) Through colony PCR detection and sequencing verification, the recombinant plant expression vector GV1300-MYB-A-GFP was obtained.

[0038] Example 3 This example provides the Agrobacterium-mediated genetic transformation of Hemerocallis fulva with the chrysanthemum MYB-A gene 1. Prepare the media used in the experiment: (1) LB liquid medium (100 ml): 0.5 g yeast extract + 1 g tryptone + 1 g sodium chloride; (2) LB solid medium (100 ml): 0.5 g yeast extract + 1 g tryptone + 1 g sodium chloride + 1.5 g agar; (3) YEP liquid medium (100 ml): 1 g yeast extract + 1 g tryptone + 0.5 g sodium chloride; (4) YEP solid medium (100 ml): 1 g yeast extract + 1 g tryptone + 0.5 g sodium chloride + 1.5 g agar; (5) MS1 medium: MS + 6BA 1.0 mg / L + NAA 0.05 mg / L + AS 100 mg / L; (6) MS2 medium: MS + 6BA 1.0 mg / L + NAA 0.05 mg / L + Hyg 50 mg / L + Timentin 200 mg / L; (7) MS3 medium: MS + 6BA 1.0 mg / L + NAA 0.05 mg / L; (8) MS4 medium: 1 / 2MS + NAA 0.1 mg / L.

[0039] 2. Culture of Hemerocallis callus as infection material Use MS medium to induce Hemerocallis callus, and select the Hemerocallis callus after subculture for 1 or 2 times. Plant it in an artificial culture room at a culture temperature of 25 °C and a humidity of 75%.

[0040] 3. Preparation of bioengineered bacteria (1) Transform Agrobacterium tumefaciens. The Agrobacterium competent is GV3101 (Veidi, China), and the transformation steps refer to the instruction manual.

[0041] (2) Pick a single colony on the transformation plate into 10 ml of YEP (or LB) liquid medium containing 50 mg / L Kan and 25 mg / L Rif, and culture it at 28 °C with shaking at 180 rpm for 12 - 16 h; (3) Pipette 1 ml of the bacterial liquid into 50 ml of YEP (or LB) liquid medium containing 50 mg / L Kan and 25 mg / L Rif, and culture it at 28 °C with shaking at 180 rpm until the OD 600 reaches 0.6 - 0.8; (4) Centrifuge the cultured bacterial liquid at 5000 rpm for 5 min, discard the supernatant, and suspend the bacterial cell precipitate with an equal volume (50 ml) of 1 / 2MS osmotic medium (pH 5.8) under sterile conditions, and place it on ice for use in infecting Hemerocallis callus.

[0042] 4. Infection of Hemerocallis callus (1)Cut the Hemerocallis callus into small pieces and place them in the infection solution; (2)The infection time is 15 min; (3)Put them into MS1 medium and culture them in the dark for 3 d; (4)Wash the bacteria with carbenicillin washing solution (100 mg / ml); (5)After air-drying, transfer them to MS2 screening medium. After screening and culturing for 1 month, transfer them to MS3 medium; (6)Rooting: When adventitious buds about 1 cm long grow on the plant, cut off the adventitious buds and transfer them to MS4 medium to induce rooting. Adventitious roots can grow in about 10 days; (7)Hardening off: After the regenerated seedlings grow well-developed roots, open the lid and culture them for 2 days for hardening off. The purpose is to strengthen the plants. After taking them out, wash the agar on the roots of the plants with sterile water, transplant them into small pots filled with sterilized soil, and place them in the room temperature for cultivation; (8)Extract DNA from the obtained transgenic Hemerocallis plants, and perform PCR identification using MYB-A homologous arm primers to obtain transgenic positive Hemerocallis plants.

[0043] 5. Identification of transgenic positive Hemerocallis plants: Extract DNA from the obtained 7 transgenic Hemerocallis plants, and perform PCR identification using the vector homologous arm primers of MYB-A gene. The wild-type Hemerocallis is used as a control, and the GV1300-MYB-A-GFP recombinant plasmid is used as a positive control.

[0044] The results are as Figure 1 shown. All 7 transgenic Hemerocallis lines have the target bands. Observe the positive plants using a stereoscopic fluorescence microscope. As Figure 2 shown, the transgenic positive Hemerocallis plants have green fluorescence signals excited, indicating that the MYB-A gene has been successfully inserted into the Hemerocallis genome.

[0045] 6. Observation of the flower color of transgenic positive Hemerocallis plants: Compare and observe the flower colors of wild-type Hemerocallis and transgenic positive Hemerocallis plants. The results are as Figure 3 shown. The flower colors of the transgenic Hemerocallis plants are deepened and some lines show mottled flower colors. Thus, it can be seen that the chrysanthemum MYB-A gene has the function of regulating the flower color of plants. Through the application of chrysanthemum MYB-A protein, the effective regulation of the flower color of Hemerocallis has been achieved, and the flower color characteristics of Hemerocallis can be precisely changed without relying on traditional hybridization or mutagenesis breeding.

[0046] 7. Analysis of the carotenoid content of transgenic positive Hemerocallis plants Detect the carotenoid content in the petals of transgenic positive daylilies and compare it with the carotenoid content in the petals of wild-type daylilies.

[0047] The results are as Figure 4 shown. The overexpression of the chrysanthemum MYB-A gene significantly increased the carotenoid content in the flower color of daylilies, indicating that the overexpression of the chrysanthemum MYB-A gene can regulate the flower color of daylilies.

[0048] This specific embodiment is only an interpretation of the present application and does not limit the present application. Those skilled in the art can make modifications to this embodiment without creative contributions according to their needs after reading this specification, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. An application of using chrysanthemum MYB-A protein to regulate the flower color of daylily, characterized in that, The amino acid sequence of the chrysanthemum MYB-A protein is shown in SEQ ID NO.

01.

2. Use of chrysanthemum MYB-A protein for regulating the flower color of daylily according to claim 1, characterized in that, The gene sequence of the ORF region encoding the chrysanthemum MYB-A protein is shown in SEQ ID NO.

02.

3. A cultivation method for the color of Hemerocallis flowers to become darker or mottled, characterized in that, It includes: Introducing the gene encoding the chrysanthemum MYB-A protein into Hemerocallis plants to obtain transgenic plants; The gene of the chrysanthemum MYB-A protein is overexpressed in Hemerocallis plants; Among them, the gene sequence encoding the chrysanthemum MYB-A protein is shown in SEQ ID NO.

02.

4. The cultivation method for the hemerocallis flower color to become darker or mottled according to claim 3, characterized in that, The process of obtaining the transgenic plants includes: the step of introducing a bioengineered bacterium containing a recombinant plant expression vector into the callus of the Hemerocallis plant; The recombinant plant expression vector contains the gene sequence encoding the chrysanthemum MYB-A protein.

5. The cultivation method for the hemerocallis flower color to become darker or mottled according to claim 4, characterized in that, The bioengineered bacterium is Agrobacterium tumefaciens GV3101.

6. The cultivation method for the hemerocallis flower color to become darker or mottled according to claim 4, characterized in that, The recombinant plant expression vector is the GV1300-GFP recombinant plasmid containing the gene sequence encoding the chrysanthemum MYB-A protein.

7. A biological material for cultivating Hemerocallis with different flower colors, characterized in that, It includes the gene sequence encoding the chrysanthemum MYB-A protein shown in SEQ ID NO.

02.

8. The cultivation method for the hemerocallis flower color to become darker or mottled according to claim 7, characterized in that, The biological material includes any one of the following: (a) A recombinant cloning vector containing the gene encoding the chrysanthemum MYB-A gene; (b) A recombinant plant expression vector containing the gene encoding the chrysanthemum MYB-A gene; (c) A recombinant plant expression vector obtained by connecting a tag to the N-terminus and / or C-terminus of the gene described in (b); (d) A bioengineered bacterium containing the recombinant vector described in (a) or (b).

9. The cultivation method for the hemerocallis flower color to become darker or mottled according to claim 8, characterized in that, The plant expression vector is GV1300.

10. The cultivation method for the hemerocallis flower color to become darker or mottled according to claim 8, characterized in that, The bioengineered bacterium is Agrobacterium tumefaciens GV3101.