A plasmid vector and cell line capable of inducing targeted genomic DNA double-strand breaks

By constructing a plasmid vector containing the DNA endonuclease AscI and ERT2/Tet-on system, combined with chemical small molecule induction, precise spatiotemporal control of DNA double-strand break is achieved, and the shortcomings of multi-site induced DNA double-strand break in the existing technology are solved, providing efficient research tools and low-cost solutions.

CN120350068BActive Publication Date: 2025-08-29WESTLAKE UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510837495.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-23
Publication Date
2025-08-29
Estimated Expiration
2045-06-23

AI Technical Summary

Technical Problem

In the process of multi-site induced DNA double-strand breaking, the existing technology has problems such as poor spatial and temporal control accuracy, limited number of cleavage sites and poor randomness of cleavage sites. It is difficult to truly simulate the random distribution characteristics of endogenous DNA damage events, which affects the research on DNA damage repair mechanism and the efficiency and safety of CRISPR gene editing technology.

Method used

The DNA endonuclease AscI and the chemically induced nuclear localization regulation system ERT2 and Tet-on systems were used to construct plasmid vectors through lentiviral vectors, and combined with the induction of chemical small molecules 4-hydroxytamoxifen and doxycycline, the spatiotemporal expression and nuclear localization control of AscI endonuclease are achieved, and DNA double-strand breaks are accurately induced at specific genome sites.

Benefits of technology

It realizes the widely distributed DNA double-strand break events in the genome, meets the needs of statistical analysis, provides efficient research tools for DNA damage repair mechanisms, simplifies operations and reduces costs, is suitable for a variety of cell types, and has a wide range of application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350068B_ABST
    Figure CN120350068B_ABST
Patent Text Reader

Abstract

The present invention discloses a plasmid vector and cell line that can induce targeted genomic DNA double-strand breaks. The present invention constructs a nuclease AscI expression plasmid based on a lentiviral vector backbone by integrating the Tet-on chemically inducible transcription control system and the ERT2 ligand-dependent nuclear localization control system. The vector regulates the transcription of AscI through the Tet-on system and uses the 4-hydroxytamoxifen-induced ERT2 system to achieve spatiotemporal specific nuclear translocation of the endonuclease AscI. The present invention also constructs and screens a cell line that stably expresses AscI. With the help of small chemical molecules, the spatiotemporal expression of the AscI endonuclease in cells can be precisely regulated, thereby inducing DNA double-strand breaks at specific sites in the genome. The present invention provides an efficient and accurate research tool for the field of DNA damage repair, which can be widely used in studying DNA damage repair mechanisms and high-throughput screening of related drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular and cell biology, and more specifically, to the construction and application of a plasmid vector and cell line that induces DNA double-strand breaks at specific genomic sites using small chemical molecules. Background Art

[0002] As the key carrier of genetic information, the integrity of DNA is crucial for the normal physiological function of cells, individual development, and genetic stability. However, DNA within cells is constantly under attack from endogenous and exogenous factors, resulting in various types of damage, among which double-strand breaks (DSBs) are the most serious form. If DSBs are not promptly and accurately repaired, they can lead to chromosomal structural variations such as gene deletions, translocations, and inversions, which in turn can trigger cell apoptosis, aging, or malignant transformation. These changes are closely associated with the development and progression of numerous major human diseases, including cancer, neurodegenerative diseases, and immunodeficiency. Therefore, in-depth research on DNA double-strand breaks and their repair mechanisms is crucial for understanding the nature of life processes, revealing the pathogenesis of related diseases, and developing effective therapeutic strategies. Furthermore, the repair mechanism of DSBs is the foundation of CRISPR gene editing technology, and studying DSB repair mechanisms is crucial for optimizing the efficiency, precision, and safety of CRISPR technology.

[0003] When a DNA double-strand break (DSB) occurs, cells rapidly initiate a complex and sophisticated repair mechanism, including the recruitment of repair proteins, the involvement of RNA, the remodeling of chromatin's three-dimensional structure, and the selection of repair pathways. The randomness and heterogeneity of naturally occurring DSBs make the repair process difficult to precisely track. Therefore, artificially controlling the occurrence of DSBs in both time and space can effectively eliminate background noise, allowing precise analysis of changes in chromatin's three-dimensional structure near DSBs, the order of repair protein recruitment, the preferred repair pathways, and their regulatory mechanisms. Several systems have been reported for generating DSBs at specific sites, primarily categorized as single-site systems and multi-site systems. Single-site systems include the I-SceI endonuclease system, the I-PpoI endonuclease system, and the CRISPR / Cas9 system. Most of these systems require plasmid transfection or complex gene editing prior to use and can only generate DSBs at a specific site. Studies based on these systems cannot reflect universal patterns, significantly compromising the reliability of the results and hindering statistical analysis. Multi-site systems primarily refer to the AsiSI endonuclease system. Although the AsiSI endonuclease has multiple cutting sites in the genome, DNA methylation modification can significantly weaken the accessibility of most sites. Studies have shown that only about 100 AsiSI sites can be effectively cut and produce detectable double-strand breaks. Moreover, these observable DSBs sites are not randomly distributed, and their formation efficiency is highly affected by the local chromatin open state (such as active transcription regions or nuclear matrix attachment regions). These two factors make it difficult for the AsiSI system to truly simulate the random distribution characteristics of endogenous DNA damage events, which in turn leads to significant deviations in the statistical analysis of DSBs repair mechanisms. In addition, existing ChIP-seq data show that no typical DSBs peak shape is presented at the AsiSI site. Summary of the Invention

[0004] To address the existing issues of poor spatiotemporal control precision, limited number of cleavage sites, and poor randomness in the induction of DNA double-strand breaks at multiple sites, the present invention is dedicated to developing a multi-site DSB induction system with precise control capabilities. To achieve this goal, the present invention selected the DNA endonuclease AscI as the research target, introduced Tet-on (a chemically inducible gene expression system) and ERT2 (a chemically inducible nuclear localization control system), and constructed an expression vector based on a lentiviral plasmid vector. Through lentiviral infection and screening of monoclonal stable expression cell lines, a cell line stably expressing ERT2-AscI was successfully constructed.

[0005] The specific technical solutions of the present invention are as follows:

[0006] The present invention provides a plasmid vector capable of inducing targeted genomic DNA double-strand breaks, which uses a lentiviral vector as a backbone and comprises the following elements:

[0007] Coding sequence of DNA endonuclease AscI;

[0008] and an ERT2 element for chemically inducing and regulating the nuclear localization of the DNA endonuclease AscI; or

[0009] ERT2 element and Tet-on element, the ERT2 element is used for chemical induction regulation of the nuclear localization of the DNA endonuclease AscI, and the Tet-on element is used for chemical induction regulation of the expression of the DNA endonuclease AscI gene.

[0010] The sequence of the ERT2 element is the sequence of 1753-4668 bp in the pCAG-ERT2CreERT2 (addgene, Plasmid #13777); the sequence of the Tet-on element is the sequence of 3441-4187 bp in the pLVX-TetOne-puro (Clontech, catalog number 631849631847).

[0011] Specifically, the amino acid and nucleotide sequences of the coding sequence of the DNA endonuclease AscI are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. To promote its efficient expression in human cells, the original DNA sequence was codon optimized, and the optimized sequence is shown in SEQ ID NO.3.

[0012] In specific applications, the Tet-on element induces the expression of AscI through doxycycline (Dox), and the ERT2 element induces the nuclear localization of AscI through 4-hydroxytamoxifen (4-OHT).

[0013] Preferably, the plasmid vector is in any of the following forms:

[0014] Single-strand control system: the ERT2 element and the coding sequence of the DNA endonuclease AscI are connected downstream of the constitutive promoter;

[0015] Dual control system: The ERT2 element and the coding sequence of the DNA endonuclease AscI are connected to the downstream of the inducible promoter regulated by the Tet-on system, and the DNA endonuclease AscI cleavage site in the vector is eliminated by site mutation.

[0016] Furthermore, in the single-plex control system, the lentiviral vector used is pLVX-IRES-puro, and the constitutive promoter is the CMV promoter.

[0017] In a specific embodiment of the present invention, the specific steps are as follows: after the 3×Flag-ERT2 and AscI fragments are sequentially inserted into the CMV promoter of the lentiviral vector pLVX-IRES-puro, the recombinant plasmid pLVX-3×Flag-ERT2-AscI-IRES-puro is obtained, which is a single-plex control system.

[0018] Furthermore, in the dual control system, the lentiviral vector used is pLVX-TetOne-puro, and the inducible promoter is TRE3GS promoter;

[0019] In the dual control system, the restriction site of DNA endonuclease AscI is mutated from GGCGCGCC to GGGCCGCC.

[0020] In a specific embodiment of the present invention, the specific steps are as follows: after connecting the 3×Flag-ERT2-AscI fragment in the single control system to the TRE3GS promoter of the Tet-on lentiviral vector pLVX-TetOne-puro, the recombinant plasmid pLVX-TetOne-3×Flag-ERT2-AscI-puro is obtained. Because there is an AscI restriction site on the pLVX-TetOne-puro vector, the pLVX-TetOne-3×Flag-ERT2-AscI-puro plasmid constructed based on this vector also contains this restriction site. After AscI is expressed in cells, it will act on this site, thereby interfering with the sustained expression of the Tet-on element and AscI. Therefore, this site was mutated from GGCGCGCC to GGGCCGCC through point mutagenesis.

[0021] The present invention also provides a cell line capable of inducing targeted genomic DNA double-strand breaks, which is constructed by the following steps:

[0022] The above-mentioned plasmid vector and lentiviral packaging plasmid are co-transfected into engineered cells to package and produce lentivirus; the lentivirus is used to infect target cells, and a stably expressing monoclonal cell line is screened to obtain.

[0023] By integrating Tet-on and / or ERT2 elements mediated by small chemical molecules, precise regulation of the spatiotemporal expression of AscI endonuclease in cells can be achieved, thereby generating DNA double-strand breaks (DSBs) at specific sites in the genome.

[0024] Furthermore, the screening of the monoclonal cell line comprises:

[0025] Puromycin (at a concentration of 0.5-10 mg / ml) was used for continuous selection; monoclonal cell lines were obtained by limiting dilution.

[0026] In a specific embodiment of the present invention, the specific steps are:

[0027] (1) The above-mentioned lentiviral vector pLVX-3×Flag-ERT2-AscI-IRES-puro and packaging plasmid pMD2.G and psPAX2 were transfected into the engineered cell 293FT for lentiviral packaging;

[0028] (2) The above-mentioned lentiviral vector pLVX-TetOne-3×Flag-ERT2-AscI-puro and packaging plasmids pMD2.G and psPAX2 were transfected into the engineered cells 293FT for lentiviral packaging;

[0029] (3) Infecting target cells with the lentivirus produced in (1) and (2) to establish cell lines of single control system and dual control system, respectively, and the infection lasts for 24 hours;

[0030] (4) After infection, the culture medium was replaced with fresh complete culture medium and the antibiotic puromycin was added for screening. The screening time lasted for 3 days.

[0031] (5) The screened cells were digested with trypsin, diluted appropriately and inoculated into 96-well plates, and cultured in a cell culture incubator at 37°C and 5% CO2 for 2 weeks. Puromycin was continuously added during the culture period.

[0032] (6) Select the monoclonal cell wells formed by single cell growth, detect the expression of 3×Flag-ERT2-AscI by Western blot and immunofluorescence staining, select and retain those single cell clones with moderate expression levels for expansion culture, and thus obtain cell lines of single control system and dual control system;

[0033] (7) The expanded single cell clones were numbered and frozen, and the stable cell line containing 3×Flag-ERT2-AscI elements was named AscID ( Asc I- I nduced- D SBs) cells.

[0034] The present invention utilizes AscI restriction endonuclease to generate DSBs at its specific recognition site.

[0035] Specifically, the monoclonal cell line induces DNA double-strand breaks by:

[0036] When the monoclonal cell contains a coding sequence for DNA endonuclease AscI and an ERT2 element: 4-hydroxytamoxifen is added during culture to induce nuclear translocation and induce DNA double-strand breaks at specific sites in the genome;

[0037] When the monoclonal cell contains a coding sequence for a DNA endonuclease AscI, an ERT2 element, and a Tet-on element: doxycycline is first added to the culture medium to induce expression of the ERT2 element and the coding sequence for the DNA endonuclease AscI, and then 4-hydroxytamoxifen is added to induce the ERT2 element and the coding sequence for the DNA endonuclease AscI to enter the nucleus, thereby inducing DNA double-strand breaks at specific sites in the genome.

[0038] Preferably, the concentration of 4-hydroxytamoxifen is 300 nM, and the induction time is at least 1.5 h; further, the induction time is 1.5-3 h; the concentration of doxycycline is 1 μg / mL, and the induction time is 4-12 h.

[0039] More specific steps are:

[0040] In the described single-regulatory system cell line, 3×Flag-ERT2-AscI is constitutively expressed in the cytoplasm. By adding 4-hydroxytamoxifen (300 nM, 1.5 h) to the cell culture medium, 3×Flag-ERT2-AscI is induced to be transported from the cytoplasm to the nucleus, thereby achieving cutting of specific genomic sites.

[0041] The dual regulation system cell line is induced to express 3×Flag-ERT2-AscI in the cytoplasm by adding doxycycline (1 μg / mL, 12 h) to the cell culture medium, and then induced to translocate 3×Flag-ERT2-AscI from the cytoplasm to the nucleus by adding 4-hydroxytamoxifen (300 nM, 1.5 h) to the cell culture medium, thereby achieving cleavage of specific genomic sites.

[0042] The present invention also provides the use of the cell line in studying DNA damage repair mechanisms, gene editing or high-throughput screening of DNA repair regulatory drugs.

[0043] The plasmid vector and cell line of the present invention that can induce targeted genomic DNA double-strand breaks can be applied to studying DNA damage repair mechanisms, screening compounds that inhibit / enhance repair, and gene editing.

[0044] The experimental results in the examples of the present invention fully demonstrate that by inducing the expression and nuclear translocation of the DNA endonuclease AscI through chemical small molecules, extensive DNA double-strand break events can be generated at the AscI restriction sites in the genome.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] (1) The present invention uses AscI endonuclease to generate DNA double-strand breaks. After AscI endonuclease is expressed in different cells, its DNA-cutting enzymatic activity is less affected, and the enzymatic activity is sufficient to generate sufficient DNA double-strand breaks.

[0047] (2) The number of AscI sites in the genome is moderate; neither an excessive number of sites will affect cell status nor a lack of sites will reduce the reliability of experimental results. Immunofluorescence and CUT&Tag-seq results showed that AscI cells can generate sufficient DSBs to meet the requirements of statistical analysis.

[0048] (3) The CUT&Tag-seq results showed that the double-strand break events near the AscI site showed a typical concave shape, which is a feature not possessed by other systems that generate DSBs at specific sites, further highlighting the superiority of the present invention.

[0049] (4) The present invention utilizes two commercial chemical small molecules, 4-hydroxytamoxifen and doxycycline, to induce the spatiotemporal expression of AscI, which are easy to obtain and low in cost.

[0050] (5) The present invention uses the Tet-on system to control the expression of AscI and the ERT2 system to control the nuclear entry of AscI, which can strictly regulate the occurrence of DSBs and provide a powerful tool for studying the changes in events before and after DNA breakage.

[0051] (6) The two lentiviral plasmid vectors in the present invention can be conveniently applied to a variety of cell types and have the characteristics of simple operation, low cost and high efficiency.

[0052] (7) The chemical small molecule control strategy adopted in the present invention can be used to regulate the spatiotemporal expression of any protein molecule and has broad implications. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 : Distribution of AscI restriction sites in the human genome (hg38).

[0054] Figure 2 : Schematic diagram of the spatiotemporal control of AscI expression; A: single regulation system; B: dual regulation system.

[0055] Figure 3 : Western Blot was used to detect the changes in the phosphorylation levels of ATM and H2AX proteins in AscID cells after treatment with 4-OHT for different time periods.

[0056] Figure 4: Immunofluorescence detection of AscI protein nuclear entry and 53BP1 foci formation in AscID cells before and after treatment with Dox and 4-OHT; scale bar is 10 μm.

[0057] Figure 5 : CUT&Tag-seq analysis of the enrichment of 53BP1 (A) and γH2AX (B) at AscID-induced DNA double-strand break sites in AscID cells before and after 4-OHT treatment.

[0058] Figure 6 : Taking human chromosome 13 as an example, Karyoplot (genome coverage map) is used to display the CUT&Tag-seq results; the red vertical line represents the position of the AscI restriction site, and the blue peak graph represents the CUT&Tag-seq signal of 53BP1 (A) and γH2AX (B). DETAILED DESCRIPTION

[0059] The technical solutions provided by the present invention are described in detail below, but they should not be understood as limiting the scope of protection of the present invention.

[0060] Unless otherwise specified, the following technical solutions are all conventional methods, and the materials and reagents used are all commercially available.

[0061] Example 1

[0062] This example aims to explain in detail the construction process of plasmid vectors with single and dual regulatory systems, which specifically includes the following steps:

[0063] 1. Selection of cutting enzymes: Using the NEB website, obtain information on endonucleases with cleavage sites of 8 bases or more. By searching the human genome (hg38) sequence, determine the number of recognition sites for these enzymes in the genome. Endonucleases with less than 10,000 sites were selected. After screening, the rare cutting enzyme AscI (recognition sequence: 5'-GG^CGCGCC-3') was selected. Its 8 bp recognition site has a total of 4722 sites in the human genome (hg38). Figure 1 ), which enables sparse and controllable DSBs induction. AscI The gene is derived from Arthrobacter luteus ( Arthrobacter The amino acid and nucleotide sequences of AscI were obtained from the UniProt website (accession number: E3VXA3), and the sequences are shown as SEQ ID NO. 1 and SEQ ID NO. 2, respectively.

[0064] 2. To achieve efficient expression of AscI in human cells, codon optimization was performed and a DNA fragment encoding AscI was obtained by chemical synthesis. The sequence is shown in SEQ ID NO. 3. If expression in cells of other species is desired, codon optimization for the corresponding species can be performed.

[0065] 3. Construction of single regulatory system vector:

[0066] The nuclear localization regulatory module sensitive to 4-hydroxytamoxifen (4-OHT) was combined with the optimized AscI The genes were fused to obtain ERT2-AscI.

[0067] The specific procedure is as follows: The DNA sequence of the ERT2 element (bp 1753-4668 in Plasmid #13777) was obtained from the pCAG-ERT2CreERT2 plasmid (Addgene, Plasmid #13777) using conventional PCR. To facilitate detection of ERT2-AscI expression in cells, a 3× Flag tag was added to the 5' end of ERT2 by adding the Flag tag DNA sequence to the 5' end of the ERT2 amplification primer. The ERT2 amplification primers are as follows:

[0068] The forward primer sequence is: GAGGATCTATTTCCGGTGAATTTGCCACCATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGGAATTCGAGCCATCTGCTGGAGACATGAGAGCTGCCAACCTT (SEQ ID NO. 4),

[0069] The reverse primer sequence is: TGTGGCAGGGAAACCCT CTGCCTCCCCCGTGATG (the underlined sequence is the homology arm sequence) (SEQ ID NO. 5).

[0070] PCR amplification used 2× Phanta Flash Master Mix (P510-01) from Novozymes, and the PCR program was set as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s; annealing at 60°C for 5 s; and extension at 72°C for 5 s / kb, with a cycle number of 34.

[0071] By homologous recombination, the PCR-amplified 3×Flag-ERT2 and chemically synthesized AscI fragments were sequentially inserted into the rear end of the CMV promoter of the lentiviral vector pLVX-IRES-puro (Clontech, catalog number 632183). Eco RI and Bam The pLVX-3×Flag-ERT2-AscI-IRES-puro recombinant plasmid was constructed by PCR amplification of the AscI residues (SEQ ID NO. 6) and PCR amplification of the AscI residues (SEQ ID NO. 7). The upstream homology arm sequence is AGGGTTTCCCTGCCACAGCTGTCGA (SEQ ID NO. 6), and the downstream homology arm sequence is GGATCCCGCCCCTCTCCCTCCCC (SEQ ID NO. 7). Homologous recombination was performed using the ClonExpress MultiS One-Step Cloning Kit (C113) from Novozymes.

[0072] 4. Construction of dual regulatory system vector:

[0073] The 3×Flag-ERT2-AscI recombinant fragment in the above single regulatory system was inserted into the Tet-On lentiviral vector.

[0074] The specific operation steps are as follows: 3×Flag-ERT2-AscI recombinant fragment was obtained from pLVX-3×Flag-ERT2-AscI-IRES-puro recombinant plasmid by conventional PCR, and then the fragment was ligated to the rear of TRE3GS promoter of Tet-on lentiviral vector pLVX-TetOne-puro (Clontech, catalog number 631847, Tet-on element sequence is 3441-4187 bp sequence) by homologous recombination method. Eco RI and Bam The pLVX-TetOne-3×Flag-ERT2-AscI-puro recombinant plasmid was constructed between the HI restriction sites (GGCGCGCC and GGGCCGCC). Because the pLVX-TetOne-puro vector contains an AscI restriction site, the pLVX-TetOne-3×Flag-ERT2-AscI-puro plasmid constructed based on this vector also contains this restriction site. Upon expression in cells, AscI targets this site, interfering with the Tet-on system and the sustained expression of AscI. Therefore, this site was mutated from GGCGCGCC to GGGCCGCC using a point mutagenesis technique.

[0075] Example 2

[0076] This example details the process of establishing cell lines with single and dual regulatory systems. The specific steps are as follows:

[0077] 1. Single-regulatory system lentivirus packaging: using liposome Lipofectamine TMLentiviral packaging was performed by transfecting 293FT cells with pLVX-3×Flag-ERT2-AscI-IRES-puro and the packaging plasmids pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) mediated by 2000. Transfections were performed in 35 mm culture dishes with the packaging plasmid ratio of pLVX-3×Flag-ERT2-AscI-IRES-puro: pMD2.G: psPAX2 = 10 mg: 3 mg: 7.5 mg. Eight hours after transfection, the medium was replaced with fresh culture medium. After 48–72 hours of continued culture, the cell culture supernatant containing the lentivirus was collected and filtered through a 0.45 mm filter to remove cell debris and impurities, yielding a preliminarily purified lentivirus. This is a single-regulatory system lentivirus (containing only the ERT2 element).

[0078] 2. Dual regulatory system lentivirus packaging: using liposome Lipofectamine TM Lentiviral packaging was performed by transfecting 293FT cells with pLVX-TetOne-3×Flag-ERT2-AscI-puro and the packaging plasmids pMD2.G and psPAX2 using 2000. Transfection was performed in 35 mm culture dishes with the packaging plasmid ratio and dosage being: pLVX-TetOne-3×Flag-ERT2-AscI-puro: pMD2.G: psPAX2 = 10 mg: 3 mg: 7.5 mg. Eight hours after transfection, the culture medium was replaced with fresh medium. After 48–72 hours of continued culture, the cell culture supernatant containing the lentivirus was collected and filtered through a 0.45 mm filter to remove cell debris and impurities, yielding a preliminarily purified lentivirus. This is a dual-regulatory lentivirus containing both the Tet-on and ERT2 elements.

[0079] 3. Infect cells with lentivirus:

[0080] Target cells to be infected are plated in a 6-well plate and cultured in appropriate culture medium and conditions to a confluency of 30%-40% at infection. Add an appropriate amount of lentivirus solution to the 6-well plate containing target cells, along with polybrene at a final concentration of 5-10 mg / mL to promote viral binding to cells. Gently shake the plate to evenly distribute the virus solution, then return the plate to a cell culture incubator at 37°C and 5% CO2 for continued incubation. 12-24 hours after infection, replace the plate with fresh complete culture medium to remove uninfected virus. After an additional 24 hours of incubation, select with the antibiotic puromycin (0.5-10 mg / mL) for selection. The concentration of puromycin should be adjusted based on the cell type (range, 0.5-10 mg / mL). Selection typically continues for 3 days, until all uninfected cells have died. Surviving cells are considered stably infected with the lentivirus. Selected cells are trypsinized and diluted to a concentration of 10-20 cells / mL. Inoculate the diluted cell suspension into a 96-well plate, adding 100 mL of cell suspension to each well. Theoretically, each well should contain an average of 1-2 cells. After inoculation, place the 96-well plate in a cell culture incubator at 37°C and 5% CO2, and continue to add puromycin during the incubation period.

[0081] 4. Monoclonal identification and expansion culture:

[0082] Continue culturing for 2 weeks, regularly observing cell growth. Single cell clones formed from single cell growth were selected for further characterization. Specifically, the cells were trypsinized and seeded into 24-well plates. Culture continued until the confluence reached 80%-90%. The cells were then trypsinized again, half seeded into a 24-well plate, and the other half seeded into a 24-well plate with a cell slide for immunofluorescence analysis. Cells were cultured for 16 hours.

[0083] For the single-regulatory system, the spatiotemporal control diagram of AscI expression is shown in Figure 2. Figure 2As shown in Figure A, direct immunofluorescence detection of ERT2-AscI expression using a Flag antibody is performed. At this point, ERT2-AscI expression should be in the cytoplasm. The specific steps are as follows: Cells seeded on a cell slide are rinsed once with PBS. After aspirating the PBS, the cells are fixed with 4% paraformaldehyde (4% PFA) for 15 minutes. The fixed cells are rinsed three times with PBS. After aspirating the PBS, the cells are permeabilized with 0.5% Triton X-100 for 10 minutes. The permeabilized cells are rinsed three times with PBS. The Flag antibody is diluted to the appropriate concentration in PBS. The diluted Flag antibody (Sigma, F9291) is then applied dropwise to the cell slide (on the side covered with cells) and incubated at 37°C for 1 hour. After incubation, the cells are rinsed three times with PBS to remove unbound Flag antibody. Select a fluorescently labeled secondary antibody (Abcam, ab150117) that matches the species of the Flag antibody. Dilute it with PBS to an appropriate concentration and apply the diluted secondary antibody to the cell slide. Incubate at 37°C in the dark for 1 hour. After incubation, rinse the cells three times with PBS to remove unbound secondary antibody. Apply anti-fluorescence quenching mounting medium containing DAPI to the slide and invert it onto a glass slide. Once the mounting medium has dried, fluorescence microscopy is available.

[0084] For the dual regulatory system, the spatiotemporal control diagram of AscI expression is shown in Figure 2. Figure 2 As shown in Figure B, Dox (1 mg / mL, 12 h) was first added to the culture medium to induce ERT2-AscI expression, followed by immunofluorescence staining as described above. Based on the immunofluorescence results, single-cell clones with moderate expression were selected and retained. The remaining half of the cells were transferred to a 6-well plate for expansion and subsequently transferred to larger culture vessels, such as 10-cm dishes and flasks. The cells were then frozen for subsequent experimental studies.

[0085] Example 3

[0086] This example aims to verify that double-strand breaks can be induced in the AscID cell line.

[0087] When a double-strand break (DSB) occurs in cells, the ATM protein (ataxia telangiectasia mutated protein) is recruited to the site of damage and activated by autophosphorylation (pATM). Activated ATM rapidly phosphorylates histone H2AX to form γH2AX. 53BP1 (p53 binding protein 1) recognizes and binds to γH2AX via its BRCT domain, leading to its recruitment to the site of DNA DSBs. Following DSB formation, phosphorylation levels of ATM and H2AX increase (i.e., pATM and γH2AX levels increase), and distinct punctate structures form at the site of damage. Simultaneously, 53BP1 rapidly shifts from a diffuse state to aggregate at the site of damage, also forming distinct punctate structures known as 53BP1 foci. Therefore, pATM, γH2AX, and 53BP1 foci are widely used as biomarkers of DSBs, indicating double-strand DNA damage.

[0088] This example verifies the occurrence of DSBs in the AscID cell line through the following experiments:

[0089] 1. Western blot analysis: 300 nM 4-OHT was added to the culture medium and cells were collected after treatment for different time periods. The levels of γH2AX and pATM were detected by western blot to observe the time of DSBs occurrence. The experimental results showed that ( Figure 3 ), 4-OHT treatment for 1.5 h can induce sufficient DNA damage, manifested by increased levels of pATM and γH2AX.

[0090] 2. Immunofluorescence detection: Dox (1 mg / mL) was added to the dual-regulated AscID cell line. After treatment for 12 hours, the expression of 3×Flag-ERT2-AscI was detected by immunofluorescence. Figure 4 The red fluorescence channel in the middle showed that Dox induced the expression of 3×Flag-ERT2-AscI in the cytoplasm. After the addition of 300nM 4-OHT for 1.5h, immunofluorescence results showed that 3×Flag-ERT2-AscI was induced to translocate to the nucleus ( Figure 4 The red fluorescent channel is 3×Flag-ERT2-AscI, and the blue fluorescent channel is the cell nucleus. 53BP1 immunostaining showed that after 3×Flag-ERT2-AscI entered the cell nucleus, the number of 53BP1 foci increased dramatically ( Figure 4 The green fluorescence channel indicates that a large number of DSBs occurred.

[0091] 3. CUT&Tag-seq Validation: CUT&Tag-seq was used to validate DSBs occurring at the AscI locus in the AscID cell line. The CUT&Tag assay used the Novozymes Hyperactive Universal CUT&Tag Assay Kit for Illumina Pro (TD904) according to the kit's instructions. The generated sequencing library was sequenced on an Illumina high-throughput sequencing platform. Specific antibodies against two DSB markers, 53BP1 and γH2AX, were used to detect DSBs in the genome.

[0092] The experimental results are as follows Figure 5 As shown, after AscID cells were treated with 4-OHT, significant 53BP1 was detected at the AscI site in the cell genome ( Figure 5 A) and γH2AX ( Figure 5 B) Enrichment, indicating that double-strand breaks occurred at these AscI sites.

[0093] More importantly, in the CUT&Tag-seq results, it was observed that 53BP1 and γH2AX had obvious concave shapes near the AscI site ( Figure 5 (enlarged images of A and B in Figure 3), indicating that the DNA on both sides of the AscI site is broken and partially removed, which is a typical feature of DNA double-strand break.

[0094] Taking the CUT&Tag-seq sequencing results on human chromosome 13 as an example, the gene coverage map ( Figure 6 ) is shown at the AscI site ( Figure 6 53BP1 can be detected in the middle (indicated by the red line) Figure 6 A) and γH2AX ( Figure 6 B), indicating that double-strand breaks occurred at these AscI sites.

Claims

1. A plasmid vector capable of inducing targeted genomic DNA double-strand breaks, characterized in that: The lentiviral vector is used as the backbone and contains the following elements: Coding sequence of DNA endonuclease AscI; and an ERT2 element for chemically inducing and regulating the nuclear localization of the DNA endonuclease AscI; or ERT2 element and Tet-on element, the ERT2 element is used for chemical induction regulation of the nuclear localization of the DNA endonuclease AscI, and the Tet-on element is used for chemical induction regulation of the expression of the DNA endonuclease AscI gene.

2. The plasmid vector according to claim 1, characterized in that The coding sequence of the DNA endonuclease AscI is codon-optimized, and the sequence is shown in SEQ ID NO.

3.

3. The plasmid vector according to claim 1, characterized in that The Tet-on element induces the expression of AscI by doxycycline, and the ERT2 element induces the nuclear localization of AscI by 4-hydroxytamoxifen.

4. The plasmid vector according to claim 1, characterized in that The plasmid vector is in any of the following forms: Single-strand control system: the ERT2 element and the coding sequence of the DNA endonuclease AscI are connected downstream of the constitutive promoter; Dual control system: The ERT2 element and the coding sequence of the DNA endonuclease AscI are connected to the downstream of the inducible promoter regulated by the Tet-on element, and the DNA endonuclease AscI cleavage site in the vector is eliminated by site mutation.

5. The plasmid vector according to claim 4, characterized in that In the single-plex control system, the lentiviral vector used is pLVX-IRES-puro, and the constitutive promoter is the CMV promoter.

6. The plasmid vector according to claim 4, characterized in that In the dual control system, the lentiviral vector used is pLVX-TetOne-puro, and the inducible promoter is the TRE3GS promoter; In the dual control system, the restriction site of DNA endonuclease AscI is mutated from GGCGCGCC to GGGCCGCC.

7. A cell line capable of inducing targeted genomic DNA double-strand breaks, characterized in that: Build it by following these steps: Co-transfecting the plasmid vector according to any one of claims 1 to 6 and a lentiviral packaging plasmid into engineered cells to package and produce lentivirus; The target cells are infected with the lentivirus, and a stably expressing monoclonal cell line is obtained by screening.

8. Use of the cell line according to claim 7 in studying DNA damage repair mechanisms, gene editing, or high-throughput screening of DNA repair regulatory drugs.

Citation Information

Patent Citations

  • Chemical-inducible genome engineering technology

    WO2017078631A1

  • Improved ERT2 mutants, inducible cell death systems, and uses thereof

    WO2024163908A2