Automatic continuous multi-sample digital nucleic acid isothermal amplification method and device
By mixing the amplification reagents of samples before being sent to the microcontrolled flow chip, the problem of large deviations in the quantitative results in the prior art is solved, and isothermal amplification of multi-sample digital nucleic acids with high accuracy and consistency is achieved, reducing errors and preventing aerosol contamination.
Patent Information
- Application Number
- CN202410084264.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-19
- Publication Date
- 2025-07-22
AI Technical Summary
The existing digital isothermal amplification technology cannot perform digital segmentation in time after mixing, resulting in excessive deviation from the actual results, and different samples cannot perform digital segmentation within the same time after mixing, resulting in incomparable quantitative results.
The amplification reagent of each sample is divided into Group A and Group B, and only mixed before being sent to the microcontrolled flow chip to ensure that the mixing time of Group A and Group B of each sample is equal, and the Group A and Group B of other samples are kept unmixed before being sent to the microcontrolled flow chip. After mixing, it is quickly sent to the microcontrolled flow chip for amplification reaction.
The accuracy and consistency of quantitative results of isothermal amplification of continuous multi-sample digital nucleic acids is improved, aerosol contamination is avoided, the error is reduced to less than ±10%, and the detection level of digital PCR is reached.
Smart Images

Figure CN120350098A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a method and device for digital nucleic acid isothermal amplification. Background Art
[0002] Nucleic acid isothermal amplification technology can rapidly amplify nucleic acids in vitro without temperature rise and fall or temperature cycling, with fast detection speed and high efficiency. However, conventional nucleic acid isothermal amplification detection technology can only achieve qualitative detection of nucleic acids and cannot achieve quantitative detection and analysis of nucleic acids. Currently, based on digital isothermal amplification detection technology, nucleic acid molecules can be segmented into a large number of independent microdroplets, and after single-molecule nucleic acid isothermal amplification in each independent microdroplet, signal detection can be performed, enabling highly accurate nucleic acid isothermal quantitative detection and analysis.
[0003] However, current digital isothermal technologies still have some deficiencies. For example, isothermal amplification can achieve amplification reactions at relatively low temperatures. Once the system is mixed together, the amplification reaction starts immediately. At this time, since the amplification reaction has not yet entered the detection system, it cannot be detected, which will seriously affect the accuracy of quantification and cause the quantitative results to deviate too much from the actual results. Moreover, if different samples are not digitally segmented within the same time after mixing, it will also lead to incomparability between different quantitative results.
[0004] Therefore, in actual experimental processes, ensuring that the mixed isothermal reagents are digitally segmented as quickly as possible and ensuring that each result is digitized after the same mixing time are of great significance for the quantitative accuracy and comparability of digital isothermal quantification results. Summary of the Invention
[0005] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide an automated continuous multi-sample digital nucleic acid isothermal amplification method and device for solving the problem of large deviation in detection results in the prior art.
[0006] The present invention provides an automated continuous multi-sample digital nucleic acid isothermal amplification method, which includes:
[0007] 1) Divide all the reagents required for amplifying each sample into group A and group B. Only when each sample to be detected is about to be fed into the microfluidic chip, mix the group A and group B of this sample in an automated manner, and when the group A and group B reagents of this sample to be detected are mixed, there are no group A and group B of other samples in the mixed state; the mixing time of the group A and group B reagents of each sample is equal; the time from when the group A and group B of each sample are mixed well to when they are fed into the microfluidic chip is equal;
[0008] 2) Feed the mixed sample into a microfluidic chip for digital isothermal amplification reaction and detect the signal after the reaction.
[0009] For example, group A and group B of sample 1 are denoted as group A1 and group B1 respectively, group A and group B of sample 2 are denoted as group A2 and group B2 respectively, and group A and group B of sample 3 are denoted as group A3 and group B3 respectively. Only when sample 1 is about to be amplified, group A1 and group B1 are mixed, and so on. The whole process is operated in an automated manner to ensure that the mixing time of reagents in group A and group B of each sample is equal; the time from mixing group A and group B of each sample to feeding it into the microfluidic chip is equal. In the traditional amplification method, the staff prepares all the sample reaction systems and places them in the reaction tube positions, and then prepares droplets and detects each sample in turn. Since isothermal amplification does not require high temperature and heat activation process and can occur rapidly at room temperature or relatively low temperature conditions, when detecting sample 1, sample 2, sample 3 and subsequent samples have already started the amplification reaction. And for the part that has already reacted, since it has not entered the microfluidic chip yet, when adding subsequent samples into the microfluidic chip, the actual nucleic acid template amount is no longer the initially intended detection amount, but the amount after amplification for a certain time, which will lead to inaccurate quantitative results and may be much higher than the actual amount to be measured. In addition, since the waiting time for each sample is different and the non-target reaction time before adding to the chip is also different, this will inevitably result in the inability to compare the detection results of different samples consistently. However, in this method, since part of the reaction reagents of each sample are removed and the two are only mixed when the sample is about to be fed into the microfluidic chip, the waiting time after sample mixing is eliminated, and the inaccurate quantitative results caused by the above problems can be avoided.
[0010] Preferably, the mixing time of reagents in group A and group B of each sample is equal and less than 1 min.
[0011] Preferably, the time from mixing group A and group B of each sample to feeding it into the microfluidic chip is less than 1 min.
[0012] Preferably, the number of the samples is N, where N≥2. The A group of each sample contains nucleic acid, and the other reagents in the A group of each sample are exactly the same. The reagents contained in the B group of each sample are exactly the same. The reagents required for isothermal amplification usually include initiation reagents (such as isothermal amplification enzymes, coenzymes, magnesium ions), nucleic acid, and dNTP. We can place the initiation reagents of sample 1 in group B1, and place the other reagents in group A1; place the initiation reagents of sample 2 in group B2, and place the other reagents in group A2; place the initiation reagents of sample 3 in group B3, and place the other reagents in group A3. Therefore, all the B groups contain the same initiation reagents. Thus, we can also combine all the B groups. According to the actual reaction requirements, all the B groups can be located in only 1-3 test tubes.
[0013] In addition, due to different isothermal amplification methods, different reagents are used. For example, currently commonly used isothermal amplification methods include LAMP (Loop-mediated Isothermal Amplification), RPA (Recombinase Polymerase Amplification), etc., and the method described in this case is suitable for each isothermal amplification method.
[0014] Preferably, after adding the reagents after mixing the A group and the B group into the microfluidic chip, an oil phase is aspirated to seal the remaining reagents in the sample tube. This step can be carried out before the droplet preparation is completed or after the droplet preparation is completed.
[0015] Preferably, the oil phase used for sealing the reagents and the oil phase used for microdroplet preparation are the same oil phase.
[0016] It should be noted that this oil phase reagent is immiscible with the reaction reagent, and its density is less than that of the reaction reagent, so it can be suspended above the reagent to avoid the nucleic acid aerosol contamination caused by the volatilization of the residual reagent in the tube; this oil phase can be mineral oil, silicone oil, and other oils that meet the requirements.
[0017] Furthermore, before mixing the A group and the B group of each sample in step 1), the microfluidic chip is pretreated. For example: before adding the reagents to some microfluidic chips, it is necessary to perform a vacuum treatment on the microfluidic chip in advance to ensure that the reagents can be added to the inside of the microfluidic chip faster and more fully. Therefore, the pretreatment process of the microfluidic chip before the reagent mixing can more fully ensure that the mixed reagents are added to the microfluidic chip in a timely and intact manner, achieving the purpose realized by this solution.
[0018] Furthermore, after the reagents after mixing the A group and the B group are filled into the chambers and channels of the microfluidic chip, after replacing the reagents in the microchannels with an oil phase that is immiscible with the reagents, independent and separated microdroplets are formed in the microchambers.
[0019] Further, after adding the mixed Group A and Group B into the microfluidic chip in step 2), an oil phase immiscible with the reagent needs to be added.
[0020] Further, step 1) also includes setting the ambient temperature around the mixing of Group A and Group B to 4 - 30°C.
[0021] Further, the mixing of Group A and Group B is carried out by a pipette.
[0022] On the other hand, the present invention provides a reagent placement module applicable to automated continuous multi - sample digital nucleic acid isothermal amplification. The module at least includes several reagent Group A sub - tube positions and several reagent Group B sub - tube positions. The reagent Group A sub - tube positions are in a row, and the reagent Group B sub - tube positions are in a row.
[0023] Further, the reagent Group B sub - tube positions include 1 - 20 test tube holes, and the reagent Group A sub - tube positions include 2 - 20 test tube holes.
[0024] Further, an oil phase tube position is also provided on the reagent placement module.
[0025] Further, the reagent placement module is provided with a refrigeration unit.
[0026] On the other hand, the present invention provides an automated continuous multi - sample digital nucleic acid isothermal amplification device, which includes the above - mentioned reagent placement module.
[0027] Further, the digital nucleic acid isothermal amplification device further includes a liquid transfer module, a temperature control module, and a signal reading module. The liquid transfer module can mix Group A and Group B of each sample and send the mixed reagent into the microfluidic chip. The liquid transfer module includes an injection pump, which realizes the aspiration, transfer, and mixing of Group A and Group B components through a pipette tip.
[0028] It should be noted that the liquid transfer module of this device can process 1 sample at a time or process multiple samples in parallel; regardless of the number of samples processed in parallel, it must be ensured that only when each sample to be detected is about to be sent into the microfluidic chip, Group A and Group B of this sample are mixed, and when Group A and Group B of this sample to be detected are mixed at the same time, there is no other sample's Group A and Group B in a mixed state; the time from mixing Group A and Group B of each sample to sending it into the microfluidic chip is equal.
[0029] As described above, the automated continuous multi - sample digital nucleic acid isothermal amplification method and its automated device of the present invention have the following beneficial effects:
[0030] Using the automated continuous multi-sample digital nucleic acid isothermal amplification method and its automated device can greatly improve the accuracy and consistency of the quantitative results of continuous multi-sample digital nucleic acid isothermal amplification, and prevent aerosol contamination caused by isothermal amplification reagents. Description of the Drawings
[0031] Figure 1 Shown as a schematic diagram of the structure of the reagent placement area
[0032] Figure 2 Schematic diagrams of each module of the digital nucleic acid isothermal amplification device in this application
[0033] Figure 3 Scatter plot of the detection results of 12 samples in Example 1
[0034] Figure 4 Scatter plot of the detection results of the control sample in Example 1
[0035] Figure 5 Scatter plot of the detection results of 12 samples in Example 2
[0036] Figure 6 Scatter plot of the detection results of the control sample in Example 2
[0037] Reference Signs
[0038] 1B Group Sub-tube Position
[0039] 2 Oil Phase Tube Position
[0040] 3A Group Sub-tube Position
[0041] 4 Pipette Tip Tube Position
[0042] 5 Microfluidic Chip
[0043] 6 Droplet Generation Position
[0044] 7 Signal Reading Module
[0045] 8 Positive and Negative Pressure Generation Module
[0046] 9 Pipetting Module Detailed Description of the Invention
[0047] Isothermal amplification can achieve the amplification reaction without high and low temperature cycling, and can be carried out under constant temperature conditions; moreover, the reaction temperature is generally relatively low (30 - 70 °C), with high reaction efficiency, and the amplification reaction starts as soon as the system is mixed together. The digital isothermal detection technology is a technology that combines isothermal amplification technology with digital PCR. The digital PCR detection system usually includes a microfluidic chip, especially a chamber array chip, which can complete the segmentation of isothermal reagents and droplet preparation in fixed chambers. The nucleic acid template undergoes a single-molecule reaction in the chip chambers and emits fluorescence signals; the signal reading module uses a fluorescence imaging system for imaging analysis, distinguishes positive and negative droplets according to the fluorescence intensity of different droplets, and calculates the nucleic acid concentration through Poisson distribution.
[0048] Currently, the conventional digital isothermal detection method is to configure the reaction system of each sample simultaneously and then place it in the tube position to be detected, and then add them one by one into the microfluidic chip for reagent segmentation and droplet preparation; however, at this time, the amplification reaction has already started in the tube to be detected, and this part that has already reacted has not yet entered the microfluidic chip. Therefore, the actual amount of nucleic acid template is no longer the initially desired detection amount, but the amount after a certain period of amplification, which will lead to inaccurate quantitative results and may be much higher than the actual amount to be measured.
[0049] To ensure the quantitative consistency and accuracy when processing continuous multiple samples, we take out a part of the reaction reagents required in the reaction system of each sample, and only when the sample is about to enter the microfluidic chip, all the reagents are mixed in an automated manner, thus avoiding the situation that the sample has already started to react before entering the microfluidic chip. The specific operation method is as follows: divide all the reagents required for the amplification of each sample into group A and group B, and only when each sample to be detected is about to be sent into the microfluidic chip, the group A and group B of this sample are mixed in an automated manner, and when the group A and group B of this sample to be detected are mixed, the group A and group B of other samples are not in a mixed state; the mixed sample is sent into the microfluidic chip in an automated manner for amplification reaction and detection of the reaction signals, ensuring that the mixing time of all reagents is equal and the time from mixing well to being sent into the microfluidic chip is equal.
[0050] For example, the A and B groups of sample 1 are denoted as group A1 and group B1 respectively, the A and B groups of sample 2 are denoted as group A2 and group B2 respectively, and the A and B groups of sample 3 are denoted as group A3 and group B3 respectively. Only when sample 1 is about to be amplified, groups A1 and B1 are mixed, and so on. The whole process is operated in an automated manner to ensure that the reagent mixing time of the A and B groups of each sample is equal; the time from mixing the A and B groups of each sample to feeding them into the microfluidic chip is equal. In the traditional amplification method, the staff prepares all the sample reaction systems and places them in the reaction tubes to be tested, and then detects each sample in turn. This results in that when detecting sample 1, sample 2, sample 3 and subsequent samples have already started the amplification reaction, and this part that has reacted cannot be detected because it has not entered the microfluidic chip, which will inevitably lead to detection errors; in addition, since the waiting time for each sample is different, the detection time obtained is also different, which will also cause detection errors. However, this method removes part of the reaction reagents of each sample, and only mixes the two when the sample is about to be fed into the microfluidic chip, so the waiting time of the sample is eliminated, avoiding the errors caused by the above problems.
[0051] In one embodiment, the reagent mixing time of the A and B groups of each sample is equal. An ideal time is 10 s.
[0052] In one embodiment, the time from mixing the A and B groups of each sample to feeding them into the microfluidic chip is less than 1 min. Usually, the time we can achieve is 10 s. In the traditional detection method, the time required for preparing each sample droplet is about 2 - 8 min, the waiting time for sample 2 is about 2 - 8 min, the waiting time for sample 3 is about 4 - 16 min, and so on. It can be seen that for subsequent samples, due to the too long waiting time, more and more serious non-target amplification will occur, resulting in a higher result and causing experimental errors. We have confirmed through experiments that by using our method, the error can be reduced to within ±10%, reaching the digital PCR detection level.
[0053] Generally, the number of the samples is N, where N≥2. The A group of each sample contains nucleic acid, and the other reagents in the A group of each sample are exactly the same except for the nucleic acid. The reagents contained in the B group of each sample are exactly the same. The reagents required for isothermal amplification usually include initiation reagents (such as isothermal amplification enzymes, coenzymes, magnesium ions), nucleic acid, and dNTP. We can place the initiation reagents of each sample 1 in group B1, place the other reagents in group A1, place the initiation reagents of sample 2 in group B2, place the other reagents in group A2, place the initiation reagents of sample 3 in group B3, and place the other reagents in group A3. Therefore, all the B groups contain the same initiation reagents. Thus, we can also combine all the B groups. According to the actual reaction requirements, all the B groups can be located in only 1 - 3 test tubes.
[0054] In one embodiment, due to different isothermal amplification methods, different reagents are used. For example, commonly used isothermal amplification methods currently include LAMP and RPA, and the method described in this article is suitable for each isothermal amplification method.
[0055] In one embodiment, after the A group and the B group are mixed and added to the microfluidic chip, the oil phase is aspirated to seal the reagents that are no longer used, usually the group containing nucleic acid. This can prevent aerosol contamination caused by isothermal amplification and reagent volatilization.
[0056] In one embodiment, the oil phase used to seal the reagent tube is the same as the oil phase used for microdroplet preparation.
[0057] In one embodiment, before mixing the A group and the B group of each sample in step 1), the microfluidic chip is evacuated to ensure that the reagents can enter the microfluidic chip faster and more fully to complete the microdroplet preparation process.
[0058] In one embodiment, after adding the mixed A group and B group to the microfluidic chip in step 2), an oil phase immiscible with the reagent needs to be added. Commonly used oil phases such as mineral oil, silicone oil, etc.; the density of the oil phase is less than that of the isothermal amplification reagent.
[0059] In one embodiment, the mixing of the A group and the B group is carried out by a pipette. For example, a liquid transfer pump, and a pipette tip can be loaded on the liquid transfer pump.
[0060] In one embodiment, step 1) further includes setting the ambient temperature around when mixing the A group and the B group to be 4 - 30°C. A lower temperature can reduce the amplification of the reaction system.
[0061] In one embodiment, a reagent placement module applicable to a digital nucleic acid isothermal amplification device is provided. The module includes at least a number of A tube positions and a number of B tube positions. The A tube positions are in a row, and the B tube positions are in a row. For the convenience of detection, we place those of the same attribute in a row to facilitate the setting of the pipetting procedure.
[0062] In one embodiment, the B tube positions include 1 - 20 test tube holes, and the A tube positions include 2 - 20 test tube holes. This can meet most of the current detection needs. Of course, when the need for detection expansion arises, we can also correspondingly adjust the specific number of reagent holes. As Figure 1 and 2 shown, a schematic diagram of the A - group tube positions and B - group tube positions in this area is presented. 1 is the B - group sub - tube position, 2 is the oil - phase tube position, 3 is the A - group sub - tube position, and 4 is the pipette tip tube position.
[0063] In one embodiment, the reagent placement module is provided with a refrigeration unit. The refrigeration unit reduces the amplification reaction during the mixing process as much as possible. For example, we can use a thermoelectric cooler to control the temperature.
[0064] In one embodiment, we provide a digital nucleic acid isothermal amplification device, which includes the above - mentioned reagent placement module.
[0065] In one embodiment, the digital nucleic acid isothermal amplification device further includes a pipetting module 9. The pipetting module can mix the A group and B group of each sample and send the mixed reagent into the microfluidic chip 5. The pipetting module includes an injection pump, which realizes the aspiration and transfer of the A component and B component and the reagent mixing through a pipette tip, and the pipetting module automatically picks up the pipetting tip and automatically realizes the liquid aspiration and reagent mixing operations. All operations rely on the piston movement of the injection pump. The reaction system is made into small droplets through the droplet generation position 6.
[0066] In one embodiment, the digital nucleic acid isothermal amplification device further includes a temperature control module. The temperature control module can set different temperatures to achieve the isothermal amplification control of the chip, and the temperature control range is 4 - 100 °C.
[0067] In one embodiment, the digital nucleic acid isothermal amplification device further includes a positive and negative pressure generating module 8, which is used to provide the positive and negative pressures required by the environment. The positive pressure generating device and the negative pressure generating device are an integrated whole, which can provide both positive pressure and negative pressure.
[0068] In one embodiment, the outlet of the positive and negative pressure generating module is connected to the pipetting module, and the pressure can be transmitted into the chip through the pipetting tip to drive the reagent into the micro - chamber array of the chip.
[0069] In one embodiment, the digital nucleic acid isothermal amplification device further includes a signal reading module 7 for reading the fluorescence signal generated during the reaction, and signal analysis software for analyzing the obtained fluorescence signal. There are already many softwares for processing signals on the market currently, and the software developed by ourselves can also be used. The signal reading process uses a CCD camera or a CMOS camera.
[0070] The following uses specific specific examples to illustrate the embodiments of the present invention. Those skilled in the art can easily understand the other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the process equipment or devices not specifically noted in the following embodiments all use conventional equipment or devices in the art. In addition, it should be understood that one or more method steps mentioned in the present invention do not exclude the existence of other method steps before and after the combined steps, nor the insertion of other method steps between these clearly mentioned steps, unless otherwise stated; it should also be understood that the combined connection relationship between one or more devices / devices mentioned in the present invention does not exclude the existence of other devices / devices before and after the combined devices / devices, nor the insertion of other devices / devices between these two clearly mentioned devices / devices, unless otherwise stated. Moreover, unless otherwise stated, the numbers of the method steps are only convenient tools for identifying the method steps, rather than limiting the arrangement order of the method steps or the scope in which the present invention can be implemented. The change or adjustment of their relative relationship, without substantial change in technical content, should also be regarded as the scope in which the present invention can be implemented.
[0071] Example 1 Detection of African swine fever virus by digital loop-mediated isothermal amplification (LAMP) technology
[0072] Sample preparation: Collect tissue samples such as blood, lymphoid tissue or other tissue samples from pigs infected with African swine fever virus. Use a suitable method to extract DNA to ensure that sufficient pure DNA is extracted for subsequent LAMP reactions. Then divide the sample into 12 equal parts.
[0073] Preparation of reagent group A: Add components such as LAMP primers (including inner primers, outer primers, loop primers, etc.), fluorescent probes, reaction buffers, and dNTPs to the reaction tubes according to the formula, with the total amount meeting the requirements of 12 samples. Add them to sample tubes numbered 1-12 containing sample DNA according to the required amounts.
[0074] The added LAMP primer sequences are:
[0075] F3 primer: GCGCGTAGGTTGAGTGAAATAAATG (SEQ ID NO.1);
[0076] B3 primer: CTTTTCGACGTTCTTCTGCACTGTA (SEQ ID NO.2);
[0077] FIP primer: ATGGCGTGACGCCTTCAATGAGATTTTTTACTGCTGACGAC (SEQ ID NO.3);
[0078] BIP primer: AATTCTAGCGTGAGGTTGCGGTGATGTGTCTCAGCAGC (SEQ ID NO.4);
[0079] Loop-F primer: CACATGGTTCATCTTGCCTG (SEQ ID NO.5);
[0080] Loop-B primer: GCACCTCTTCTCCTGAGGAT (SEQ ID NO.6).
[0081] Preparation of reagent B component: Mix the enzymes required for LAMP and place them in the reagent position of group A in the digital isothermal amplification device, with the total amount meeting the requirements of 12 samples. (Since the B components are exactly the same, the B group reagents are combined)
[0082] Setting of reaction conditions: Set the digital LAMP reaction temperature to 65 °C and set the reaction time to 40 minutes to ensure sufficient DNA amplification.
[0083] The device performs reagent preparation, droplet preparation, isothermal amplification, signal acquisition and data analysis under an automated program; the entire automated process is as follows: transfer the chip to the chip processing position and close the chip sample outlet; pick up the first pipette tip, insert it into the sample inlet of the chip, and under the action of vacuum, perform vacuum treatment on the chip; after 30 s, close the sample inlet; use the first pipette tip to aspirate 10 μL of reagent in group B and add it to sample tube 1 (i.e., A1), pipette and mix 5 times, aspirate 25 μL of the reagent in the mixed sample tube 1 and add it to the sample inlet of the chip, and under the drive of positive pressure and vacuum, add the reagent into the chip interior; remove the first pipette tip, pick up the second pipette tip, aspirate 120 μL of oil phase, drop 30 μL into sample tube 1, and then at the chip sample inlet, under the action of positive pressure, add the oil phase into the chip interior to complete the reagent replacement process and generate droplets in the chip; remove the second pipette tip, transfer the chip to a hot plate for isothermal amplification reaction; continue the droplet preparation process for the second chip and the second sample to ensure that the time interval for each sample is exactly the same; after amplification, transfer the chip to the imaging module for signal reading and analysis.
[0084] Result analysis: According to the acquisition results of the digital isothermal amplification device (such as Figure 3 ), count the proportion of positive and negative droplets, calculate the copy number of African swine fever virus in the sample, and then determine whether the sample contains African swine fever virus. The test results show that the CV of 12 samples is within ±5.82%, and it achieves the same effect as digital PCR (digital PCR has amplification with hot start and high and low temperature cycling and will not produce pre-amplification, and the quantitative CV is generally within ±10%).
[0085] At the same time, we conducted a control experiment: using the traditional method for detection, preparing a known sample of 200 copies / μL at the same time, and performing droplet preparation in sequence: the time difference between sample 1 and sample 2 is 8 min, and the results are shown as Figure 4 follows: the copy number increased from 232 copies / μL to 300 copies / μL; sample 6 was delayed by 40 min compared to sample 1, and the copy number increased to 2524 copies / μL; it was nearly 10 times higher than sample 1.
[0086] Example 2 Detection of rabies virus by digital recombinase polymerase amplification (RPA) technology
[0087] Sample preparation: Collect tissue samples from dogs that may be infected with rabies virus, such as saliva, brain tissue, blood, etc. Use a suitable method to extract viral RNA to ensure that sufficient pure nucleic acid is extracted for subsequent RPA reactions. Then divide the sample into 12 equal parts.
[0088] Preparation of Reagent A Components: Add components such as RNA extract, RPA primers (including core primers and external primers), recombinase polymerase, dNTPs, etc. to the reaction tube according to the formula. The reagents are added to sample tubes 1 - 12 containing sample DNA (Group A sub - tubes) respectively according to the required amounts.
[0089] Prepare the RPA reaction mixture. The added RPA primer sequences are as follows:
[0090] RPA - F primer: AGGAGCTGCTGAGACACACGCTG (SEQ ID NO.7);
[0091] RPA - B primer: GGAAGGCCGATGATATACAAAGT (SEQ ID NO.8).
[0092] Preparation of Reagent B Components: Place the initiator required for RPA, as Component B, into the positions of Group B sub - tubes. The total amount meets the requirements of 12 samples. (Since Component B is completely the same, the reagents in Group B are combined)
[0093] Reaction Condition Setting: Set the reaction temperature to 42°C. The RPA reaction usually proceeds at this temperature. Set the reaction time to 30 minutes to ensure sufficient DNA amplification.
[0094] Then the device performs reagent preparation, droplet preparation, isothermal amplification, signal acquisition, and data analysis under an automated program; the entire automated process is as follows: Transfer the chip to the chip processing position and close the chip sample outlet; Pick up the first pipette tip, insert it into the chip inlet, and under the action of vacuum, perform vacuum pumping on the chip; After 30 s, close the inlet; Use the first pipette tip to aspirate 1 μL of Reagent B and add it to sample tube 1 (i.e., A1), pipette and mix 5 times, aspirate 25 μL of the reagent in the mixed sample tube 1 and add it to the chip inlet, and under the drive of positive pressure and vacuum, add the reagent into the chip; Remove the first pipette tip, pick up the second pipette tip, aspirate 120 μL of the oil phase, and add 30 μL to the first sample tube; The remaining oil phase is added to the chip inlet under the action of positive pressure to complete the reagent replacement process and generate droplets inside the chip; Remove the second pipette tip, transfer the chip to the hot plate for isothermal amplification reaction; Continue the droplet preparation process for the second chip and the second sample to ensure that the time interval for each sample is exactly the same; After amplification, transfer the chip to the imaging module for signal reading and analysis.
[0095] Result Analysis: According to the results collected by the digital isothermal amplification device, count the proportion of positive and negative droplets and calculate the copy number of rabies virus in the sample. The results are as Figure 5 shown: The CV of 12 samples is within ±5%, achieving the same effect as digital PCR.
[0096] Meanwhile, we conducted a control experiment: detecting by the traditional method, preparing a known sample of 20 copies / μL at the same time, and performing droplet preparation in sequence: there was an 8-minute difference between Sample 1 and Sample 2. The results are as Figure 6 shown: the copy number increased from 24.3 copies / μL to 2520.6 copies / μL; it was nearly 100 times higher than that of Sample 1. Compared with LAMP, RPA has a lower amplification temperature and higher amplification efficiency, and is more sensitive to the delayed treatment after sample mixing.
[0097] The above embodiments are intended to illustrate the embodiments disclosed in the present invention and should not be construed as limitations on the present invention. In addition, various modifications listed herein and changes in the methods and compositions of the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in connection with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, all obvious modifications to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.
Claims
1. An automated continuous multi-sample digital nucleic acid isothermal amplification method, the method comprising at least: 1) All reagents required for amplification of each sample are divided into Group A and Group B, and Group A and Group B of each sample are mixed in an automated manner only before each sample to be tested is about to be sent into the micro-control flow chip, and when the reagents of Group A and Group B of the sample to be tested are mixed, no Group A and Group B of other samples are in a mixed state; the mixing time of Group A and Group B reagents of each sample is equal; the time from the mixing of Group A and Group B of each sample to the sending of the sample into the micro-control flow chip is equal; 2) The mixed sample is sent into a micro-control flow chip for droplet preparation and digital isothermal amplification reaction and the signal after the reaction is detected.
2. The method according to claim 1, wherein: Before mixing the reagents of group A and group B of each sample in step 1), the microfluidic chip is pretreated.
3. The method according to claim 1, characterized in that: After the mixed reagents of group A and group B are filled into the chambers and channels of the microfluidic chip, the reagents in the microchannels are replaced by the oil phase that is immiscible with the reagents, and independently divided microdroplets are formed in the microchambers.
4. The method according to claim 1, wherein: The number of the samples is N, N≥2, each of the sample groups A contains at least nucleic acid, and the reagents other than the nucleic acid in each of the sample groups A are completely identical, and the reagents contained in each of the sample groups B are completely identical.
5. The method according to claim 4, characterized in that: All of the Group B reagents were combined together.
6. The method according to claim 1, wherein: The method comprises adding the mixed reagents of group A and group B into the microfluidic chip, and then aspirating the oil phase to seal the remaining reagents in the sample tube.
7. A reagent placement module for continuous and diverse sample digital nucleic acid isothermal amplification applicable to automation, characterized in that: The module at least comprises a plurality of reagent A group pipe positions and a plurality of reagent B group pipe positions, wherein the reagent A group pipe positions are located in one row, and the reagent B group pipe positions are located in another row.
8. The reagent placement module according to claim 7, wherein: The reagent B group tube positions include 1-20 test tube holes, and the reagent A group tube positions include 2-20 test tube holes.
9. An automated continuous multi-sample digital nucleic acid isothermal amplification device, characterized in that: The device comprises a reagent placement module as described in any one of claims 7-8.
10. The automated continuous multi-sample digital nucleic acid isothermal amplification device according to claim 9, characterized in that: The digital nucleic acid isothermal amplification device also includes a pipetting module, a temperature control module, and a signal reading module. The pipetting module can mix group A and group B of each sample and send the mixed reagents into the microfluidic chip.
Citation Information
Patent Citations
Digital isothermal nucleic acid detecting device and detecting method thereof
CN105505761A
Microfluidic chip component capable of realizing digital PCR (polymerase chain reaction) quickly and application thereof
CN110205242A
Apparatus and method for nucleic acid extraction and detection
CN112553042A
PCR micro-fluidic chip and application thereof
CN113117770A
Digital micro-fluidic platform-based nucleic acid enrichment and sequencing library construction methods
WO2021232186A1