Application of miRNA as alpha particle internal irradiation diagnosis molecular marker and screening method of miRNA

Abstract

The invention provides an application of miRNA as an alpha particle internal irradiation diagnosis molecular marker and a screening method, and the screening method comprises the following steps: constructing a model of damage of human normal hepatic epithelial cells caused by fractional accumulative irradiation of alpha particles, selecting total RNA of hepatic cells of a control group and an experimental group, and respectively carrying out miRNA gene chip detection; the method comprises the following steps: screening normal cells and differentially expressed miRNA in a cell injury process after accumulated irradiation of alpha particles, designing a primer for differentially expressed miRNA according to a miRBase published sequence of a miRNA database website, carrying out Real-time PCR verification, and screening a differentially expressed gene hsa-miR-8485 in a liver injury process after accumulated irradiation of alpha particles through a relative expression value of miRNA; a molecular marker is provided for health risk molecular flow regulation and early warning of liver injury caused by internal irradiation and systematic evaluation of alpha particle internal irradiation risk.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly relates to the application and screening method of miRNA as a diagnostic molecular marker for alpha particle internal irradiation. Background Art

[0002] In the process of health surveillance of post-processing occupational personnel, regular individual dose monitoring and occupational health physical examinations are the main means of health surveillance to achieve early detection and treatment of diseases. However, the individual dose estimation of extremely radioactive transuranic nuclides such as plutonium cannot accurately reflect the individual's damaged condition. The liver is the largest target organ for transuranic nuclides in the human body. Currently, the physical examinations for liver damage of workers are the clinically common blood routine, liver function, and chest and abdominal X-ray examinations, etc. When positive lesions are found, liver cancer has already occurred and developed irreversibly. Whether it is a tumor occurring in human tissues or a tumor model established in experimental research, it is the result of the interaction between environmental factors and the body's genetic material, ultimately causing instability of the cell's own genes, mutations, and leading to disordered cell growth behavior. For the health risks of transuranic nuclide internal irradiation, there is currently no early molecular warning index for target organ damage.

[0003] The International Agency for Research on Cancer (IARC) has clearly pointed out that transuranic nuclides and their decay products are Class I carcinogens, and their harm is mainly caused by nuclides with long half-lives. Once they enter the body and deposit in the target organ, they continuously produce alpha particle radiation. Whether alpha particle internal irradiation will increase the health risks of occupational personnel is an occupational health issue of concern in radiation protection. Currently, there is not enough population epidemiological investigation and data at the experimental animal and cellular levels to support it. Summary of the Invention

[0004] The present invention discloses the application and screening method of miRNA as a diagnostic molecular marker for alpha particle internal irradiation, aiming to solve the technical problems existing in the prior art.

[0005] The present invention adopts the following technical solutions:

[0006] In one aspect, the present invention provides miRNA as a diagnostic molecular marker for plutonium exposure damage, and the miRNA as a diagnostic molecular marker for plutonium exposure damage is the hsa-miR-8485 gene.

[0007] Preferably, the hsa-miR-8485 gene is differentially expressed in liver injury caused by internal irradiation of normal human liver epithelial cells.

[0008] In the second aspect, a screening method of miRNA as a diagnostic molecular marker for plutonium exposure includes the following steps:

[0009] Establish an alpha particle damaged cell model: construct a damaged model of hepatocyte LO2 caused by fractionated cumulative irradiation of alpha particles;

[0010] Gene chip screening: Total RNA of hepatocytes in the control group and the experimental group was selected and miRNA gene chip detection was performed separately to screen miRNAs with differential expression during the process of normal cell and cell damage after cumulative α-particle irradiation: According to the sequences published on the miRNA database website miRBase, primers for differentially expressed miRNAs were designed for Real-time PCR verification, and differentially expressed genes during liver injury after cumulative α-particle irradiation were screened through the relative expression values of miRNAs.

[0011] Preferably, the differentially expressed miRNA is hsa-miR-8485.

[0012] The qPCR primer sequence (5'-3') of hsa-miR-8485 is:

[0013] AACAAGCACACACACACACACA;

[0014] The reverse transcription primer sequence (5'-3') of hsa-miR-8485 is:

[0015] GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTCACACA.

[0016] Preferably, the establishment of the α-particle damaged cell model includes: Culturing hepatocytes LO2 in vitro, performing fractional cumulative α-particle irradiation on hepatocytes LO2, with each irradiation dose being 0.5 Gy, and establishing control group, 0.5 Gy group, 1 Gy group, and 2 Gy group hepatocytes after cumulative irradiation.

[0017] Preferably, the method of fractional cumulative α-particle irradiation: After each α-particle irradiation, continue to passage and culture for 10 generations, and then continue to passage and culture for 10 generations after the next α-particle irradiation; Hepatocytes LO2 that have not been irradiated with α-particles and have been passaged and cultured for the same number of generations are used as the control group.

[0018] Preferably, hybridize the RNA and chips of cells in each experimental group and the control group. After hybridization, use Genespring12.5 software to standardize the original data, filter the standardized data, and use the fold change value to screen for differential miRNAs. The screening criteria are that the up-regulation or down-regulation fold change value ≥ 2.0 and P < 0.05.

[0019] Preferably, use a miRNA fluorescence quantitative detection kit, and use U6 provided in the kit as an internal reference according to the designed primers to perform Real-time PCR verification on the miRNA expression of cells in each experimental group.

[0020] In a third aspect, the application of miRNA as a diagnostic molecular marker for plutonium exposure injury in the evaluation of liver injury caused by internal irradiation with alpha particles.

[0021] The present invention provides an application and screening method of miRNA as a diagnostic molecular marker for internal irradiation with alpha particles. By constructing a damage model of human normal liver epithelial cells irradiated with alpha particles in fractions and cumulatively, total RNA of hepatocytes in the control group and the experimental group is selected and miRNA gene chip detection is performed respectively, and miRNAs differentially expressed during the cell damage process of normal cells and cells after cumulative irradiation with alpha particles are screened out: According to the sequences published on the miRNA database website miRBase, primers for differentially expressed miRNAs are designed for Real-time PCR verification, and the differentially expressed gene hsa-miR-8485 during the liver injury process after cumulative irradiation with alpha particles is screened out through the relative expression values of miRNAs, providing a molecular marker for molecular epidemiological investigation, early warning of health risks caused by internal irradiation, and systematic evaluation of the risk of internal irradiation with alpha particles. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The following is a growth curve graph of hepatocytes irradiated with different doses of alpha particles provided by an embodiment of the present invention;

[0023] Figure 2 The following is a scanned image of a microRNA chip provided by an embodiment of the present invention ( Figure 2 A is the experimental group with 0 Gy, Figure 2 B is the experimental group with 0.5 Gy, Figure 2 C is the experimental group with 1 Gy, Figure 2 D is the experimental group with 2 Gy);

[0024] Figure 3 The following is a fluorescence quantitative PCR melting curve graph of hsa-miR-6849-5p provided by an embodiment of the present invention;

[0025] Figure 4 The following is a fluorescence quantitative PCR melting curve graph of hsa-miR-6891-5p provided by an embodiment of the present invention;

[0026] Figure 5 The following is a fluorescence quantitative PCR melting curve graph of hsa-miR-8485 provided by an embodiment of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0027] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with specific embodiments of the present invention and the corresponding drawings. In the description of the present invention, it should be noted that the term "or" is generally used in the sense of including "and / or" unless the content clearly indicates otherwise.

[0028] 1. Establish an α-particle damaged cell model

[0029] An α-particle damaged cell model was established by culturing hepatocytes LO2 (purchased from the Kunming Cell Bank of the Chinese Academy of Sciences) in vitro. The α-irradiation source device was the 241Am irradiation device of Soochow University. The hepatocytes LO2 were irradiated with α-particles in fractions and cumulatively. The irradiation dose rate was 0.138 Gy / min, and the irradiation dose per time was 0.5. After each irradiation, the cells were continuously passaged for 10 generations. Among them, 0 Gy was the control group (cells of the same passage number that were not irradiated and cultured synchronously). The hepatocytes LO2 were irradiated with α-particles once, and after passaging for 10 generations, the hepatocytes of the 0.5 Gy group were obtained; the hepatocytes LO2 were irradiated with α-particles once, and after passaging for 10 generations, they were irradiated again and cultured for 10 generations to obtain the hepatocytes of the 1 Gy group; the hepatocytes LO2 were irradiated with α-particles once, and after passaging for 10 generations, they were irradiated 3 times and cultured to 40 generations to obtain the hepatocytes of the 2 Gy group; the LO2 cells that were not irradiated with α-particles and passaged for the same number of generations were used as the control group.

[0030] 2. Detection of hepatocyte malignant transformation indicators

[0031] The CCK8 method was used to detect the proliferation viability of cells. The cells of each experimental group and the control group cultured to the logarithmic growth phase were inoculated at 8000 cells per well with 200 μL in a 96-well culture plate. Four replicate experiments were set for each sample. After culturing at 37 °C and 5% CO2 for 0 h, 12 h, 24 h, 48 h, and 72 h, reagents were added according to the CCK8 kit instructions. After reacting for 2 - 4 h, the absorbance value of the 96-well plate was measured at 450 nm. Figure 1 The following is the growth curve of hepatocytes irradiated with different doses of α-particles provided by an embodiment of the present invention; Table 1 shows the OD values of hepatocytes irradiated with different irradiation doses, as Figure 1 shown. Combining Table 1, the survival fraction of the control group (cultured for 72 h) was 126%, and the survival fractions of the hepatocytes in the 0.5 Gy and 1 Gy groups were 90%, slightly lower than that of the control group, with no significant difference (P > 0.05); the survival fraction of the hepatocytes in the 2 Gy group was 56.1%, significantly lower than that of the control group, with a statistically significant difference (P < 0.05). Different doses could all inhibit the growth of cells.

[0032] Table 1 OD values of hepatocytes irradiated with different doses of α-particles

[0033] Irradiation dose (Gy) Cultured for 0 h Cultured for 12 h Cultured for 24 h Cultured for 48 h Cultured for 72 h 0 Gy 2.201 2.201 2.44 2.401 2.784 0.5 Gy 2.209 2.309 2.234 2.409 2.482 1 Gy 2.209 2.209 2.243 1.909 2.005 2 Gy 2.224 2.004 2.047 1.624 1.248

[0034] The migration and invasion ability of hepatocytes was determined by the Transwell experiment. The cells of each experimental group and the control group cultured to the logarithmic growth phase were digested with 0.25% trypsin without EDTA. The single-cell suspension was prepared according to 2.5x105 Cells were seeded at a concentration of cells / ml per well on the upper chamber of a 24-well plate with an 8-μm pore size filter membrane. 500 μL of 1640 medium containing 20% fetal bovine serum was added to the lower chamber, making the liquid level just cover the cells to avoid air bubbles. After culturing for 24 h, the cells were stained with 0.1% crystal violet for 20 min. The upper non-migrated cells were gently wiped off with a cotton swab, washed 3 times with PBS, and the cells that had passed through the Transwell membrane were observed under an inverted microscope. Images were randomly collected from 5-10 fields of view. Table 2 shows the migration ability of hepatocytes after irradiation with different doses of α-particles. Compared with the control group (0 Gy), the number of migrated hepatocytes in the 0.5 Gy, 1 Gy, and 2 Gy groups was significantly higher than that in the control group (P < 0.05). The number of invaded cells in the 2 Gy group was significantly higher than that in the control group (P < 0.05). This indicates that irradiation of hepatocytes with different doses of α-particles induced cell migration.

[0035] Table 2 Statistical table of the number of migrated hepatocytes after irradiation with different doses of α-particles

[0036]

[0037] For the detection of cell invasion ability, Matrigel matrix glue needs to be embedded on the bottom membrane of the Transwell chamber. After slowly thawing Matrigel on ice and diluting it with serum-free medium at a ratio of 1:8, it was added to the bottom of the chamber and allowed to solidify at room temperature, and then the cell suspension was inoculated. The single-cell suspension was inoculated at a concentration of 50,000 cells / ml, 200 μL per well, on the upper chamber of a 24-well plate with an 8-μm pore size filter membrane. 500 μL of 1640 medium containing 20% fetal bovine serum was added to the lower chamber. After culturing for 24 h, the cells were stained with 0.1% crystal violet for 20 min. The upper non-migrated cells were gently wiped off with a cotton swab, and washed 3 times with PBS. The cells that had passed through the Transwell membrane were observed under an inverted microscope, and 5-10 fields of view were randomly selected for image collection under the microscope. The cell images were automatically counted for the number of hepatocytes using the Image J image processing software. Table 3 shows the statistical table of the number of invaded hepatocytes after irradiation with different doses of α-particles. As can be seen from Table 3, compared with the control group (0 Gy), the number of invaded hepatocytes in the 0.5 Gy, 1 Gy, and 2 Gy groups was significantly higher than that in the control group (P < 0.05). The number of invaded cells in the 2 Gy group was significantly higher than that in the control group (P < 0.05). This indicates that irradiation of hepatocytes with different doses of α-particles induced an invasion response in the cells.

[0038] Table 3 Statistical table of the number of invaded hepatocytes after irradiation with different doses of α-particles

[0039]

[0040] 3. Screening and verification of sensitive molecular indicators for single and multiple cumulative irradiations of α-particles

[0041] The control group of 0 Gy and LO2 hepatocytes with migratory / invasive ability at 0.5 Gy, 1 Gy, and 2 Gy were selected. Total RNA was extracted using the Trizol method. After the total RNA of the samples was extracted, it was quantified using NanoDrop ND-2000 (Thermo Scientific) and the RNA integrity was detected by Agilent Bioanalyzer 2100 (Agilent Technologies). The results of the RNA quality detection of the samples are shown in Table 4. The OD260 / 280 ratios of the total RNA of each sample measured by NanoDrop ND-2000 were all above 1.80. The amplification curves of the total RNA were measured by the Agilent 2100 bioanalyzer, and the results showed that RIN≥7 and 28S / 18S≥0.7. The total RNA of the experimental group samples was not degraded and the quality met the experimental requirements, so subsequent experiments could be carried out.

[0042] Table 4 Results of RNA quality detection

[0043]

[0044] After the RNA quality inspection was qualified, the samples were labeled, hybridized on the chip (the hybridization reaction was carried out using an Agilent Human miRNA chip (8×60K, Design ID: 070156)), and eluted according to the chip standard procedure of Shanghai OE Biotech Co., Ltd. First, the total RNA was dephosphorylated and denatured, and then further labeled with Cyanine-3-CTP (Cy3). The labeled RNA was purified and hybridized with the chip. After elution, the original image was scanned using an Agilent Scanner G2505C (Agilent Technologies). Figure 2 The scanning image of the microRNA chip provided by an embodiment of the present invention is shown ([ Figure 2 A is the 0 Gy experimental group, Figure 2 B is the 0.5 Gy experimental group, Figure 2 C is the 1 Gy experimental group, Figure 2 D is the 2 Gy experimental group), and it can be seen that Figure 2 the chip background is uniform, the background value signal is small, the brightness is high, clear, and dense and uniform, indicating that the hybridization condition is good.

[0045] The original images were scanned using an Agilent Scanner G2505C (Agilent Technologies) for data processing, and then the CV values were calculated. As shown in Table 4, the median was taken to represent the coefficient of variation (median CV%) of the chip. The smaller the median CV (%) value, the higher the experimental precision. Generally, the CV value is required to be less than 15%. The CV values in Table 5 are all less than 15%, indicating high experimental precision for the coefficient of variation of the repetitive probes of the samples.

[0046] Table 5 Quality control assessment results of experimental samples (CV values)

[0047] Sample number Fluorescent label medianCV (%) Result 0 Gy cy3 8.49 pass 0.5 Gy cy3 7.90 pass 1.0 Gy cy3 8.52 pass 2.0 Gy cy3 9.07 pass

[0048] High-throughput chips and related bioinformatics analysis methods were used to screen for differential miRNAs. The FeatureExtraction 10.7.1.1 software was used to process the original images to extract the original data. The original data was imported into the Genespring 12.5 software for quantile normalization and subsequent processing. The normalized data was filtered, and at least one set of probes with 100% labeled as Detected in each group of samples for comparison was left for subsequent analysis. The fold change value was used to screen for differential miRNAs, and the screening criteria were that the up-regulated or down-regulated fold change value ≥ 2.0 and P < 0.05. Compared with the control group, there were 79 differentially expressed miRNAs in the 0.5 Gy group, 42 up-regulated and 37 down-regulated; 106 differentially expressed miRNAs in the 1 Gy group, 41 up-regulated and 65 down-regulated; 92 differentially expressed miRNAs in the 2 Gy group, 35 up-regulated and 57 down-regulated. As shown in Table 6, the expressions of hsa-miR-6849-5p, hsa-miR-6891-5p, and hsa-miR-8485 molecules changed significantly in all three dose groups.

[0049] Table 6 miRNA molecular markers obtained by screening

[0050]

[0051] According to the sequences published on the miRNA database website miRBase, the sequences of the 3 selected differential miRNAs were searched. The sequence number of hsa-miR-8485 is MIMAT0033692, the sequence number of hsa-miR-6891-5p is MIMAT0027682, and the sequence number of hsa-miR-6849-5p is MIMAT0027598. miRNA gene primers were designed using http: / / www.srnaprimerdb.com / design and Primer, and the primer sequences are shown in Table 7 and were synthesized by Tiangen Biochemical Technology (Beijing) Co., Ltd. Then, Real-time PCR verification of the cells in each experimental group was performed.

[0052] Table 7 RT-qPCR primers

[0053]

[0054] The miRNAs of hepatocytes cultured to the logarithmic phase at 0 Gy, 0.5 Gy, 1 Gy, and 2 Gy were extracted using a miRNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). An appropriate amount of MZ was directly added to the culture flask to lyse the cells, and 1 ml of MZ was added per 10 cm 2 area. Subsequently, pipetting was performed with a 1 ml pipette. After placing the samples in each group at room temperature for 5 min, they were then centrifuged at 4 °C and 12,000 rpm for 5 min. After taking the supernatant, it was transferred to a new RNase-free centrifuge tube. The miRNAs of the samples in each group were extracted according to the kit instructions. Then, using a miRNA cDNA first-strand synthesis kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), the miRNAs of the samples in each group were reverse transcribed into cDNA. The reverse transcription system was 8 μl of Total RNA, 10 μl of 2×miRNART Reaction Buffer, 2 μl of miRNART Enzyme Mix, and RNase-Free ddH2O to 20 μl. Then, the reaction was carried out at 42 °C for 60 min (miRNA polyadenylation reaction and reverse transcription reaction), and at 95 °C for 3 min (enzyme inactivation reaction). The synthesized cDNA reaction solution was stored at -20 °C.

[0055] Using a miRNA fluorescence quantitative detection kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), according to the designed primers and U6 provided in the kit as an internal reference, Real-time PCR verification of the miRNA expression of the cells in each experimental group was performed. To obtain appropriate Ct values (between 15 and 30) and avoid the inhibition of the quantitative PCR reaction by the reverse transcription system, the cDNA reaction solution was first diluted 10 - 1000 times before use. The reaction system is shown in Table 8, and the reaction cycle was: 95 °C, 15 min, 1 cycle, initial template denaturation; 94 °C, 20 s, 40 cycles, template denaturation in the PCR cycle; 60 °C, 34 s, annealing and extension.Figure 3 Shown is the melting curve of hsa-miR-6849-5p fluorescence quantitative PCR provided by an embodiment of the present invention; Figure 4 Shown is the melting curve of hsa-miR-6891-5p fluorescence quantitative PCR provided by an embodiment of the present invention; Figure 5 Shown is the melting curve of hsa-miR-8485 fluorescence quantitative PCR provided by an embodiment of the present invention. As Figures 3 - 5 shown, by analyzing the melting curve of the amplification product and using the 2-ΔΔCt method to calculate the relative expression levels of the control group and each experimental group.

[0056] Table 8 miRNA fluorescence quantitative detection system

[0057] Composition 20 μl system Final concentration 2×miRcutePlus miRNA PreMix (SYBR) 10 μl 1X Forward Primer 0.4 μl 200 nM Reverse Primer (10 μM) 0.4 μl 200 nM miRNA first strand cDNA 2 μl - 50×ROX Reference Dye 1.5 μl 5X <![CDATA[ddH2O]]> Up to 20 μl -

[0058] Table 9 shows the relative expression values of miRNAs analyzed by RT-PCR. The results show that the expression levels of hsa-miR-8485 in the experimental groups of 0.5 Gy, 1 Gy, and 2 Gy are significantly different from the expression level in the control group of hepatocytes (P<0.05). The expression levels of hsa-miR-6849-5p and hsa-miR-6891-5p in the hepatocytes of the experimental groups of 0.5 Gy, 1 Gy, and 2 Gy are not significantly different from those of the control group (P>0.05).

[0059] Table 9 Relative expression values of miRNAs analyzed by qRT-PCR

[0060] hsa - miR - 8485 hsa - miR - 6891 - 5p hsa - miR - 6849 - 5p 0 Gy 1 1 1 0.5 Gy 1.27±0.57 2.72±1.67 2.99±0.61 1.0 Gy 3.68±0.46 1.98±1.74 3.64±0.64 2.0 Gy 8.67±0.91 2.69±1.45 3.02±0.70

[0061] Thus, through the experiment on cell damage caused by α-particle irradiation, the present invention uses miRNA chip technology to screen out the differential molecule miRNA-8485 during the process of liver injury after cumulative α-particle irradiation, providing a molecular marker for the molecular epidemiological investigation of the health risks of internal irradiation-induced liver injury, early warning, and systematic evaluation of the risks of α-particle internal irradiation.

[0062] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A miRNA as a diagnostic molecular marker for plutonium exposure injury, characterized in that, The miRNA serving as a diagnostic molecular marker for plutonium exposure injury is the hsa-miR-8485 gene.

2. The miRNA according to claim 1, as a diagnostic molecular marker for plutonium exposure injury, is characterized in that The hsa-miR-8485 gene is differentially expressed in liver injury induced by internal irradiation of normal human liver epithelial cells.

3. The screening method of miRNA as a diagnostic molecular marker for plutonium exposure according to claim 1 or 2, characterized in that It includes the following steps: Establish an α-particle damaged cell model: construct a damage model of hepatocyte LO2 induced by fractionated cumulative irradiation with α-particles; Gene chip screening: Select the total RNA of hepatocytes in the control group and the experimental group and perform miRNA gene chip detection respectively, and screen out the miRNAs that are differentially expressed during the cell damage process of normal cells and cells after cumulative irradiation with α-particles: According to the sequences published on the miRNA database website miRBase, design primers for differentially expressed miRNAs for Real-time PCR verification, and screen out the differentially expressed genes during the liver injury process after cumulative irradiation with α-particles through the relative expression values of miRNAs.

4. The screening method of miRNA as a diagnostic molecular marker for plutonium exposure according to claim 3, characterized in that The differentially expressed miRNA is hsa-miR-8485; The qPCR primer sequence (5'-3') of hsa-miR-8485 is: AACAAGCACACACACACACACA; The reverse transcription primer sequence (5'-3') of hsa-miR-8485 is: GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTCACACA.

5. The screening method of miRNA as a diagnostic molecular marker for plutonium exposure injury according to claim 4, characterized in that, The establishment of the α-particle damaged cell model includes: culturing hepatocyte LO2 in vitro, performing fractionated cumulative irradiation of hepatocyte LO2 with α-particles, with each irradiation dose being 0.5 Gy, and establishing control group, 0.5 Gy group, 1 Gy group, and 2 Gy group hepatocytes after cumulative irradiation.

6. The screening method of miRNA as a diagnostic molecular marker for plutonium exposure injury according to claim 4, characterized in that, The method of fractionated cumulative irradiation with α-particles: After each α-particle irradiation, continue to passage and culture for 10 generations, and then continue to passage and culture for 10 generations after the next α-particle irradiation; Use hepatocyte LO2 that has not been irradiated with α-particles and has been passaged and cultured for the same number of generations as the control group.

7. The screening method of miRNA as a diagnostic molecular marker for plutonium exposure injury according to claim 5, wherein Hybridize the RNA and chips of cells in each experimental group and the control group. After hybridization, use Genespring12.5 software to standardize the original data, filter the standardized data, and use the fold change value to screen for differentially expressed miRNAs. The screening criteria are that the up-regulated or down-regulated fold change value ≥ 2.0 and P < 0.

05.

8. The screening method of miRNA as a diagnostic molecular marker for plutonium exposure injury according to claim 3, wherein Use the miRNA fluorescence quantitative detection kit, and based on the designed primers and U6 provided in the kit as an internal reference, perform Real-time PCR verification on the miRNA expression of cells in each experimental group.

9. The application of the miRNA according to claim 1 or 2 as a diagnostic molecular marker for plutonium exposure injury in the evaluation of liver injury induced by internal irradiation with α-particles.

Images