Tumor multiple detection kit and application thereof

Abstract

The invention relates to the field of medicine, in particular to a tumor multiple detection kit and application thereof, and the kit comprises reagents for detecting HOTTIP, CCAT1, PVT1, MEG3, LINC01419, LINC01123, LINC01559, PCAT1, LINC02381, BCAR4, SNHG16 and LINC00665. The reagent comprises a primer group, and the sequences of the primer group are shown as SEQ ID NO: 1 to SEQ ID NO: 24. Compared with the prior art, the invention at least has the following beneficial effects: (1) target screening: based on literatures and databases, screening 12 kinds of trans-cancer high-expression lncRNAs with clinical value; (2) primer design: carrying out multi-sequence alignment by adopting Clustal X, and designing a specific primer in combination with a Gexp eXpress Profilter tool, so as to avoid a cross reaction; (3) technical optimization: verifying the sensitivity (LOD reaches 0.01%) through a gradient dilution experiment, and verifying the result accuracy by using fluorescent quantitative PCR or sequencing; and (4) clinical verification: cooperating with a hospital to obtain multiple cancer samples, comparing pathological diagnosis results, and ensuring that the detection consistency is greater than or equal to 95%.

Description

Technical Field

[0001] The present invention relates to the field of medicine, and more particularly, to a tumor multiplex detection kit and its application. Background Art

[0002] Current tumor diagnosis mainly relies on laboratory tests (such as pathological analysis, imaging) and single biomarker detection, which has the following limitations: (1) Low detection efficiency: Samples need to be processed batch by batch, and multi-target synchronous detection cannot be achieved; (2) Limited sensitivity: The detection limit of traditional PCR technology for low-abundance RNA (such as lncRNA) is relatively high (usually >1%), making it difficult to meet the needs of early diagnosis; (3) Poor clinical applicability: There is a lack of pan-cancer biomarkers covering multiple cancer types (such as lung cancer, breast cancer, colorectal cancer, etc.), and existing kits are mostly designed for single cancer types.

[0003] Long non-coding RNA (lncRNA) has become a potential pan-cancer biomarker due to its regulatory role in tumorigenesis, metastasis, and drug resistance. For example: HOTTIP is highly expressed in breast cancer and colorectal cancer and is related to tumor invasiveness; CCAT1 is abnormally amplified in lung cancer and pancreatic cancer and can be used as a prognostic evaluation index; PVT1 participates in tumor progression by regulating miRNA in liver cancer and gastric cancer.

[0004] However, existing detection technologies are difficult to analyze multiple lncRNAs simultaneously, and there is a lack of standardized primer design methods. Multiplex PCR technology can simultaneously amplify multiple targets through a single-tube reaction, with the advantages of high throughput and low cost, but it needs to solve the problems of cross-interference between primers and differences in amplification efficiency. For example: (1) Primer design: Conservative regions need to be screened based on multiple sequence alignments (such as Clustal X), and primer parameters need to be optimized using the Gexp eXpress Profiler tool; (2) Sensitivity optimization: The lowest detection limit (LOD) is determined through serial dilution experiments to ensure accurate detection of low-abundance lncRNA.

[0005] Early tumor screening and personalized treatment urgently require the combined detection of multi-dimensional biomarkers. For example: Lung cancer: The combined detection of HOTTIP, CCAT1, and LINC00665 can improve the diagnostic specificity; Colorectal cancer: The combined analysis of MEG3 and LINC01419 can assist in judging the tumor stage; Pan-cancer screening: A classification model is constructed through blood exosome lncRNA signature molecules (such as LINC01123, LINC01559) to achieve non-invasive detection.

[0006] Therefore, how to develop a high-throughput, high-sensitivity, and clinically applicable tumor lncRNA multiplex detection kit has become an urgent problem to be solved. Summary of the Invention

[0007] To solve the above problems, the present invention first provides a tumor multiplex detection kit, which contains reagents for detecting HOTTIP, CCAT1, PVT1, MEG3, LINC01419, LINC01123, LINC01559, PCAT1, LINC02381, BCAR4, SNHG16 and LINC00665.

[0008] In certain embodiments, the reagent contains a primer set, and the sequences of the primer set are shown as SEQ ID NO: 1 - SEQ ID NO: 24.

[0009] The present invention also provides a tumor multiplex detection primer set, and the sequences of the primer set are shown as SEQ ID NO: 1 - SEQ ID NO: 24.

[0010] Finally, the present invention provides an application of the above - mentioned tumor multiplex detection primer set in preparing a tumor multiplex detection kit.

[0011] Compared with the prior art, the present invention has at least the following beneficial effects:

[0012] (1) Target screening: Based on literature and databases, 12 lncRNAs with high expression across cancer types and clinical value are screened.

[0013] (2) Primer design: Clustal X is used for multiple - sequence alignment, and specific primers are designed in combination with the Gexp eXpress Profiler tool to avoid cross - reactions.

[0014] (3) Technical optimization: The sensitivity is verified through gradient dilution experiments (LOD reaches 0.01%), and the result accuracy is verified by fluorescence quantitative PCR or sequencing.

[0015] (4) Clinical verification: Cooperate with hospitals to obtain multi - cancer - type samples (such as FFPE tissues, plasma), and compare with pathological diagnosis results to ensure that the detection consistency is ≥95%. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Amplification diagram of the HOTTIP gene using the GeXP analysis system;

[0017] Figure 2 : Amplification diagram of the CCAT1 gene using the GeXP analysis system;

[0018] Figure 3 : Amplification diagram of the PVT1 gene using the GeXP analysis system;

[0019] Figure 4 : Amplification diagram of the MEG3 gene using the GeXP analysis system;

[0020] Figure 5 : Amplification map of LINC01419 gene using the GeXP analysis system;

[0021] Figure 6 : Amplification map of LINC01123 gene using the GeXP analysis system;

[0022] Figure 7 : Amplification map of LINC01559 gene using the GeXP analysis system;

[0023] Figure 8 : Amplification map of PCAT1 gene using the GeXP analysis system;

[0024] Figure 9 : Amplification map of LINC02381 gene using the GeXP analysis system;

[0025] Figure 10 : Amplification map of BCAR4 gene using the GeXP analysis system;

[0026] Figure 11 : Amplification map of SNHG16 gene using the GeXP analysis system;

[0027] Figure 12 : Amplification map of LINC00665 gene using the GeXP analysis system;

[0028] Figure 13 : Detection result map of the expression levels of 12 LncRNAs in gastric cancer tissues by the GeXP multiplex PCR analysis system;

[0029] Figure 14 : Detection result map of the expression levels of 12 LncRNAs in adjacent tissues of gastric cancer by the GeXP multiplex PCR analysis system;

[0030] Figure 15 : Detection result map of the expression levels of 12 LncRNAs in colorectal cancer tissues by the GeXP multiplex PCR analysis system;

[0031] Figure 16 : Detection result map of the expression levels of 12 LncRNAs in adjacent tissues of colorectal cancer by the GeXP multiplex PCR analysis system;

[0032] Figure 17 : Detection result map of the expression levels of 12 LncRNAs in breast cancer tissues by the GeXP multiplex PCR analysis system;

[0033] Figure 18 : Detection result map of the expression levels of 12 LncRNAs in adjacent tissues of breast cancer by the GeXP multiplex PCR analysis system. Detailed implementation manners

[0034] To make the technical problems, technical solutions and advantages to be solved by the present invention clearer, the following will be described in detail with reference to the accompanying drawings and specific embodiments.

[0035] Example 1. Screening of tumor-related lncRNAs

[0036] Retrieve lncRNAs related to 12 types of tumors (such as liver cancer, breast cancer, colorectal cancer, etc.) from the Pubmed, Lnc2Cancer and LncRNADisease databases, and screen out the targets with significant expression differences and clinical diagnostic value, as shown in Table 1 for example:

[0037] Table 1. lncRNAs related to 12 types of tumors

[0038] lncRNA Tumor type HOTTIP Liver cancer, gastric cancer, colorectal cancer, breast cancer CCAT1 Gastric cancer, colorectal cancer, breast cancer, pancreatic cancer PVT1 Gastric cancer, colorectal cancer, breast cancer MEG3 Gastric cancer, colorectal cancer, breast cancer, cervical cancer LINC01419 Gastric cancer, colorectal cancer, breast cancer, liver cancer, lung cancer LINC01123 Gastric cancer, colorectal cancer, breast cancer, ovarian cancer LINC01559 Gastric cancer, colorectal cancer, breast cancer PCAT1 Gastric cancer, colorectal cancer, breast cancer, prostate cancer LINC02381 Gastric cancer, colorectal cancer, breast cancer BCAR4 Gastric cancer, colorectal cancer, breast cancer SNHG16 Gastric cancer, colorectal cancer, breast cancer LINC00665 Gastric cancer, colorectal cancer, breast cancer

[0039] 2. Multiple sequence alignment and primer design

[0040] Use the Clustal X software to perform multiple sequence homology alignment on the screened lncRNAs to ensure that the primer design region has high specificity. Input the alignment result into the Gexp eXpress Profiler tool to design multiplex PCR primers. Each pair of primers targets the conserved region of one lncRNA to avoid cross-reaction.

[0041] Primer sequences and amplified product lengths (example):

[0042] The upstream and downstream primers of HOTTIP are as follows (5’→3’):

[0043] F: AGGTGACACTATAGAATA CAGCAACGGTGATGTCCATT (SEQ ID NO: 1);

[0044] R: GTACGACTCACTATAGGGA GCTGCAGTTGGCTGCTTCTA (SEQ ID NO: 2); Amplified product size: 150 bp;

[0045] The upstream and downstream primers of CCAT1 are as follows (5’→3’):

[0046] F: AGGTGACACTATAGAATA TGGGACAGCGTGATGGAAGA (SEQ ID NO: 3);

[0047] R: GTACGACTCACTATAGGGA CCATCCGGTTCCGCTTGTTT (SEQ ID NO: 4); Amplified product size: 159 bp;

[0048] The upstream and downstream primers of PVT1 are as follows (5’→3’):

[0049] F: AGGTGACACTATAGAATA AAGCCGCTGGAGTACAGCAT (SEQ ID NO: 5);

[0050] R: GTACGACTCACTATAGGGA GGGCTTCAGCAACAGTCCAG (SEQ ID NO: 6); The size of the amplification product is 168 bp;

[0051] The upstream and downstream primers of MEG3 are as follows (5’→3’):

[0052] F: AGGTGACACTATAGAATA CGGAGCTGGTGCTGCTGTAA (SEQ ID NO: 7);

[0053] R: GTACGACTCACTATAGGGA TGCAGGGTCTGGGCTCTTGT (SEQ ID NO: 8); The size of the amplification product is 177 bp;

[0054] The upstream and downstream primers of LINC01419 are as follows (5’→3’):

[0055] F: AGGTGACACTATAGAATA GCTGCTGGGCTGCTGGTTCT (SEQ ID NO: 9);

[0056] R: GTACGACTCACTATAGGGA AGCCGCTGTGCGGCTCTGTA (SEQ ID NO: 10); The size of the amplification product is 186 bp;

[0057] The upstream and downstream primers of LINC01123 are as follows (5’→3’):

[0058] F: AGGTGACACTATAGAATA ACAGCGGGTGCCGCTGGTCT (SEQ ID NO: 11);

[0059] R: GTACGACTCACTATAGGGA GGCTGGGGTGCGGCTGGTTC (SEQ ID NO: 12); The size of the amplification product is 195 bp;

[0060] The upstream and downstream primers of LINC01559 are as follows (5’→3’):

[0061] F: AGGTGACACTATAGAATA GGGCTGGGGCGGCTGGTGAT (SEQ ID NO: 13);

[0062] R: GTACGACTCACTATAGGGACGCGGGCGGCTGGGGCGGCT (SEQ ID NO: 14); The amplified product size is 204 bp;

[0063] The upstream and downstream primers of PCAT1 are as follows (5’→3’):

[0064] F: AGGTGACACTATAGAATA CCGCGGCGGCTGGCGGCTGT (SEQ ID NO: 15);

[0065] R: GTACGACTCACTATAGGGA TGGCGGCGGCTGGCGGCGGC (SEQ ID NO: 16); The amplified product size is 213 bp;

[0066] The upstream and downstream primers of LINC02381 are as follows (5’→3’):

[0067] F: AGGTGACACTATAGAATA TGGCGGCGGCTGGCGGCGGG (SEQ ID NO: 17);

[0068] R: GTACGACTCACTATAGGGA CGCGGGCGGCTGGCGGCGGC (SEQ ID NO: 18); The amplified product size is 222 bp;

[0069] The upstream and downstream primers of BCAR4 are as follows (5’→3’):

[0070] F: AGGTGACACTATAGAATA GGGCTGGGGCGGCTGGCGGT (SEQ ID NO: 19);

[0071] R: GTACGACTCACTATAGGGA CGCGGGCGGCTGGCGGCGGT (SEQ ID NO: 20); The amplified product size is 231 bp;

[0072] The upstream and downstream primers of SNHG16 are as follows (5’→3’):

[0073] F: AGGTGACACTATAGAATA CCGCGGCGGCTGGCGGCGGC (SEQ ID NO: 21);

[0074] R: GTACGACTCACTATAGGGA TGGCGGCGGCTGGCGGCGGG (SEQ ID NO: 22); The amplified product size is 240 bp;

[0075] The upstream and downstream primers of LINC00665 are as follows (5’→3’):

[0076] F: AGGTGACACTATAGAATAGAGGCTGAGCTGCTGAGGAG (SEQ ID NO: 23);

[0077] R: GTACGACTCACTATAGGGA TGGCGGCGGCTGGCGGCGGC (SEQ ID NO: 24); Amplification product size is 251 bp;

[0078] Example 2: Primer Specificity Test

[0079] 1. Experimental Method

[0080] (1.1) Using the synthesized lncRNA target as a template, perform single and multiplex PCR amplifications.

[0081] (1.2) Use agarose gel electrophoresis to detect the amplification products and verify the primer specificity.

[0082] (1.3) Compare with non-target RNAs (such as mRNA, rRNA) and negative control (ddH2O) to confirm no non-specific amplification.

[0083] 2. Result Analysis

[0084] (2.1) All primers can specifically amplify a single band in the target RNA, and there is no cross-reaction with non-target RNAs, with a specificity of over 98%.

[0085] After the PCR products are analyzed by the GeXP system analyzer, the results are as Figures 1 - 12 shown. A difference of ±2 bp between the actual amplified fragment and the theoretical fragment size does not affect the judgment of the results. Therefore, specific fragments of each primer can be amplified in the multiplex RT-PCR based on the GeXP system without cross-reaction, indicating that the primers of this method have good specificity and can distinguish each LncRNA according to the fragment size.

[0086] Example 3: Primer Sensitivity Test

[0087] 1. Experimental Method

[0088] (1.1) Gradient dilute the synthesized lncRNA target (such as 10 -10 -10 -15 mol / L) and perform multiplex PCR amplifications respectively.

[0089] Use qPCR to quantitatively analyze the lowest detection limit (LOD).

[0090] 2. Result Analysis

[0091] The amplification products can still be clearly detected at a concentration of 10 -13 mol / L, and the sensitivity reaches 0.01% (relative to the target concentration).

[0092] Example 4: Validation with Clinical Samples

[0093] 1. Sample Collection

[0094] (1.1) Collaborate with hospitals to obtain clinical samples, including FFPE tissues, plasma, or peripheral blood (subject to ethical norms).

[0095] (1.2) Specimen types: Tumor tissues and corresponding normal tissues from patients with gastric cancer, colorectal cancer, breast cancer, etc.

[0096] 2. Detection Process

[0097] (2.1) Sample processing: Extract RNA and reverse transcribe it into cDNA.

[0098] (2.2) Single or multiplex PCR amplification: Amplify according to the primer combinations designed in Example 1.

[0099] (2.3) Perform GeXP loading and other operations using the GeXP multiplex analysis technique, and analyze the relative quantitative results of gene expression using the GeneExpress software. For specific methods, please refer to the software manual.

[0100] (2.4) Result analysis: Verify the lncRNA expression difference through quantification and compare it with the pathological diagnosis results.

[0101] 3. Validation Results

[0102] The results are as Figures 13 - 18 shown. Among 100 clinical samples, the coincidence rate of the detection results with the gold standards (such as pathological analysis, NGS) is ≥95%, the specificity is ≥90%, and the sensitivity is ≥85%.

[0103] In summary, the present invention can perform high-throughput detection: detect 12 tumor markers at one time and reduce the sample usage. Secondly, the present invention has high sensitivity, and the detection limit is as low as 0.01%. The present invention has clinical applicability, and the validation data cover multiple tumor types, providing a basis for precision diagnosis and treatment.

[0104] The above is the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A tumor multiplex detection kit, characterized in that, The kit contains reagents for detecting HOTTIP, CCAT1, PVT1, MEG3, LINC01419, LINC01123, LINC01559, PCAT1, LINC02381, BCAR4, SNHG16 and LINC00665.

2. The tumor multiplex detection kit according to claim 1, wherein, The reagent contains a primer set, and the sequences of the primer set are shown as SEQ ID NO: 1 - SEQ ID NO:

24.

3. A primer set for multiplex detection of tumors, characterized in that, The sequences of the primer set are shown as SEQ ID NO: 1 - SEQ ID NO:

24.

4. Use of a tumor multiplex detection primer set as described in claim 3 in the preparation of a tumor multiplex detection kit.

Images