Target gene, primer group and detection kit for detecting pea foot rot

By screening the specific molecular marker sequences and PCR technology of pea foot rot bacteria, a rapid detection system was established, which solved the problem of long-term morphological identification and difficulty in distinguishing close species, and achieved efficient pathogen detection and early warning.

CN120350156AActive Publication Date: 2025-07-22HUANGPU CUSTOMS TECH CENT
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510618176.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-07-22
Estimated Expiration
2045-05-14

AI Technical Summary

Technical Problem

In the prior art, the quarantine identification of pea foot rot bacteria depends on morphological methods, which has great environmental interference, long time, and is difficult to distinguish close species, and cannot meet the needs of rapid customs clearance.

Method used

Specific molecular marker sequences are used to screen pea foot rot bacteria's unique single-copy genes, combined with PCR technology, and establish a rapid detection system, including direct sample detection, target enrichment and signal amplification processes.

Benefits of technology

The pathogen detection was completed within 8 hours, with an efficiency improvement of 96%, which can accurately distinguish pea foot rot from relative species, improve customs clearance efficiency and achieve early warning.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350156A_ABST
    Figure CN120350156A_ABST
Patent Text Reader

Abstract

The invention discloses a target gene, a primer group and a detection kit for detecting pea foot rot, and belongs to the technical field of plant quarantine. The invention creatively develops a rapid detection technology system based on a specific molecular marker aiming at the core pain points of long detection period (the detection period is longer than or equal to 20 days in a traditional method), difficulty in identification of sibling species (such as D.pinodes and A.pisi) and the like in quarantine identification of Didymellinosporium petiolatum (Didymellinosporium petiolatum (Didymellinosporium petiolatum (Didymellinosporium petiolatum (Didymellinosporium petiolatum (Didymellinosporium)). By screening a unique single copy gene sequence of D.pinodella and combining a PCR technology, a sample direct detection-target enrichment-signal amplification whole process system is established, pathogen detection can be completed within 8 hours, compared with a traditional method, the efficiency is improved by 96%, the efficiency is greatly improved, near-source species can be effectively distinguished, the customs clearance efficiency is greatly improved, and the method is suitable for large-scale popularization and application. The technical support is provided for the detection of the pea foot rot and the pea disease-resistant breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant quarantine, and more specifically, to a target gene, a primer set and a detection kit for detecting Didymella pinodella of peas. Background Art

[0002] Didymella pinodella, belonging to Ascomycota, Pleosporales, Didymellaceae, Didymella, can cause Ascochyta blight (also known as black spot disease) together with Ascochyta pinodes, Ascochyta pisi, etc., and is one of the most important diseases on peas. This disease is almost distributed in all pea production areas, seriously affecting the quality of peas and causing a yield loss of 10%-60% every year. The host range of D. pinodella is very wide, and it can infect at least 21 plant genera, mainly leguminous plants such as peas and soybeans. Even in the case of crop rotation, this bacterium may still exist. The bacterium can form lesions on stems, leaves and pods, and these spots will expand and merge, resulting in complete withering and shedding of the lower leaves. Severe stem infection may lead to girdling near the soil, known as Ascochyta Blight of Peas. Although it is reported that this bacterium has been found in China at present, the distribution areas are not clear.

[0003] China imports about 2 million tons of peas every year. This disease is very likely to be introduced into China along with imported peas, and once introduced, it will have a great impact on our pea industry. At present, D. pinodella, as a key detection object for imported plants and plant products, has been included in the quarantine list of China.

[0004] The current quarantine and identification standards for Didymella pinodella mainly rely on morphological identification methods, but there are multiple limitations in its practical application. First, morphological identification is easily interfered by environmental factors. Variables such as culture medium components, temperature and humidity conditions, and the source of the pathogen can significantly affect the morphological characteristics of the strain, resulting in deviations in the identification results. Second, the traditional identification process requires a series of operations such as isolation and culture of the pathogen, verification of Koch's postulates, and observation of morphological characteristics. It usually takes at least more than 3 weeks, making it difficult to meet the timeliness requirements of rapid customs clearance at ports. More critically, D. pinodella shows high similarity with the closely related species Ascochyta pis and D. pinodes in terms of the symptoms of infection on the host, macroscopic morphological characteristics, and some conserved gene sequences (such as ITS, rpb2, etc.). Conventional morphological identification and general gene barcode analysis are difficult to achieve accurate differentiation.

[0005] Therefore, developing target sequences and molecular marker sequences with species-level resolution and establishing molecular detection techniques based on specific sequences are technical problems that need to be urgently solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a target gene, primer set, and detection kit for detecting pea foot rot. By research, a target gene for detecting pea foot rot was discovered, and a specific amplification primer set was constructed based on the above target gene. It can successfully identify pea foot rot, has extremely high accuracy and timeliness, and has species specificity, and can be effectively distinguished from Ascochyta pis and D. pinodes.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] Application of a gene of Didymella pinodella as a target gene in the preparation of a product for detecting pea foot rot; the nucleotide sequence of the target gene is as follows:

[0009] A: As shown in SEQ ID NO.1;

[0010] B: Or a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.1;

[0011] C: Or a nucleotide sequence having more than 90% homology with the nucleotide sequence defined by A or B.

[0012] Another object of the present invention is to provide: a primer set for detecting foot rot of peas, the primer set being designed according to the above target gene, and the nucleotide sequences of the primer set being shown in SEQ ID NO.2 and SEQ ID NO.3.

[0013] Another object of the present invention is to provide: a kit for detecting foot rot of peas, including the above primer set.

[0014] Another object of the present invention is to provide: the application of the above primer set or the above kit, and the application is any of the following directions:

[0015] A: Application in pea disease-resistant breeding;

[0016] B: Application in the analysis and identification of closely related species of pea foot rot.

[0017] Another object of the present invention is to provide: a non-disease diagnosis and treatment PCR method for detecting foot rot of peas, using the above primer set or the above kit for detection, including the following steps: extracting the DNA of the sample to be tested as a template, and using the above primer set or the above kit for detection.

[0018] As a preferred technical solution, when there is an amplification band of 391bp in the amplification band, it represents that the sample to be tested contains the pathogen of pea foot rot.

[0019] As a preferred technical solution, the amplification reaction system of the PCR method is as follows: 25 μL, including 2×Pro TaqMasterMix(dye plus)*112.5 μL, 1 μL of each of the upstream and downstream primers, 2 μL of DNA template, and water is added to make up to 25 μL.

[0020] As a preferred technical solution, the concentrations of the upstream and downstream primers are both 10 μM / L.

[0021] As a preferred technical solution, the amplification reaction program of the PCR method is as follows: 94 °C for 3 min; 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, 35 cycles; 72 °C for 5 min.

[0022] It can be seen from the above technical solutions that compared with the prior art, the present invention has the following beneficial effects:

[0023] In view of the core pain points in the quarantine and identification of Didymella pinodella, such as the long detection cycle (traditional method ≥ 20 days) and the difficulty in differentiating related species (such as D. pinodes, A. pisi), a rapid detection technology system based on specific molecular markers was innovatively developed. By screening the unique single-copy gene sequences of D. pinodella and combining with PCR technology, a whole-process system of "direct sample detection - target enrichment - signal amplification" was established, which can complete pathogen detection within 8 hours, with an efficiency increase of 96% compared to the traditional method. This greatly improves the efficiency, significantly enhances the customs clearance efficiency, realizes the early warning of the infection of this pathogen in the field, and blocks the risk of cross-border transmission of D. pinodella through imported seeds. Brief Description of the Drawings

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on the provided drawings.

[0025] Figure 1 It is the test result of the specificity experiment of the primer, where M is DNA marker DL 2000; P is the positive control of D. pinodella (Australia); 1 is Phomopsis longicolla; 2 is Diaporthe phaseolorum var. sojae; 3 is D. glomerata; 4 is Diaporthe phaseolorum var. caulivora; 5 is Diaporthe phaseolorum var. meridionalis; 6 is D. rabiei; 7 is Plenodomus lindquistii; 8 is Diaporthe helianthi; 9 is D. pomorum 7728; 10 is D. americana 8806-3; 11 is D. pinodes 2517-2; 12 is D. pinodes 9609-5; 13 is D. pinodes 2517-2-1; 14 is D. pinodes 2517-2-2; 15 is D. pinodes T01; 16, 17 are CK.

[0026] Figure 2It is the test result of the sensitivity experiment of the primer, where M is DNA marker DL 2000; the concentrations of 1 and 2 are 18.6 ng / μL; the concentrations of 3 and 4 are 1.86 ng / μL; the concentrations of 5 and 6 are 0.186 ng / μL; 7 and 8 are CK (water).

[0027] Figure 3 It is the amplification effect of the primer on different positive samples, where M is DNA marker DL 2000; 1 and 2 are negative controls, which are D. pinodes 3084 - 19 and 3084 - 27 respectively; 3, 4, 5, 6, and 10 are positive controls from different sources, which are D. pinodella 2517 - 6, D. pinodella 2517 - 6 - 1, D. pinodella 9780, D. pinodella Australia, and D. pinodella 38814 - 4 respectively; 7, 8, and 9 are negative controls, which are D. pinodella 3085 - 2 / 10 / 12 respectively; 11 and 12 are blank controls. Specific implementation manners

[0028] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0029] Embodiment 1

[0030] Application of a gene of Phytophthora pinodes as a target gene in the preparation of a product for detecting Phytophthora pinodes. The position of the target gene in the genome is as follows: Genome accession number: GCA_022609545.1, JAGKQD010000075.1: 104201 - 104700. The specific sequence is as follows:

[0031] TTCGCTTCACGAAGCGTTCGACTTCCTGTAAGTACCTTCACCAGCAGA

[0032] GCAATGTTCTTGGTCTTATCTTTCTTGATAACGCCGATGAACGGTTTCAAC

[0033] GTTTTGAGCTTCCGAATGATGTCAAGCACTAACTCTTCGTAAGGCGTTCCG

[0034] TTTGGTTGACCCCTCCAAAAGAGTTGGCCAGCTTTGCGAACTTCTTCAGGT

[0035] GTCACTATCGCACCGCAGTCAGCCAACGTCCAAGCCTCGAACGATGAGCA

[0036] TTGAAGCGTCCACGTCCCTCTCCCGAACGCCGTCCATCCGCACACATGCA

[0037] AACGCCCGCGTGGCTGCGCAGCTTGTTGTGCACGTCGGTCGACGATGACT

[0038] CGTCACGCGTTGACAGGCACAGCAATCTGGCAGTGTTGTCCGCTACCGGG

[0039] GACCGACTATGCCCACAGCGACCTCTCGACTGGTGCGCTCGTCCCACAGG

[0040] CACTGCTCGCAGAACATGATGATCGGTGTCGATCATCATGAACCTATCG, SEQ ID NO.1。

[0041] Example 2

[0042] A primer set for detecting foot rot of peas, using the nucleotide sequence shown in SEQ ID NO.1 above as the target gene, and according to the primer design principle, the primer set is designed to obtain the specific amplification primer sequence. The specific primer sequences are shown in Table 1.

[0043] The specific primer design principles are as follows:

[0044] (1) The primer fragment length is between 18 - 25 bp;

[0045] (2) The GC content of the primer sequence is between 40% - 60%;

[0046] (3) The primer binding position is in the homologous region of 7 reference genomes;

[0047] (4) The annealing temperature is between 57°C - 65°C.

[0048] Table 1 Specific amplification primers for D.pinodella

[0049]

[0050] Example 3

[0051] Determine the specificity of the pinodella 11F and pinodella 11R primers

[0052] Select strains of the same genus D.glomerata, D.rabiei, D.helianthi, D.pomorum 7728, D.americana 8806-3, D.pinodes 2517-2, D.pinodes 9609-5, D.pinodes 2517-2-1, D.pinodes 2517-2-2 and peripheral strains Phomopsis longicolla, Diaporthephaseolorumvar.sojae, Diaporthe phaseolorum var.caulivora, Diaporthe phaseolorumvar.meridionalis, Plenodomus lindquistii, etc. as negative controls for the experiment, use D.pinodella38814 as a positive control, and RNase-free-water as a blank control to verify the specificity of this primer pair (pinodella11F / pinodella 11FR).

[0053] (I) Nucleic acid extraction

[0054] (1) Pick about 0.1 g of the mycelium of the above strains, dry it with a sterilized filter paper, put it into a 1.5 mL centrifuge tube, freeze it with liquid nitrogen, and grind the mycelium with a plastic pestle for later use;

[0055] (2) Add 400 μL - 500 μL of CTAB buffer and 0.1 g of proteinase K to the centrifuge tube, mix well, incubate in a water bath at 65 °C for 1 h, centrifuge at 14000 g for 5 min, and retain the supernatant;

[0056] (3) Take the supernatant, add 500 μL of Tris-saturated phenol: chloroform: isoamyl alcohol (25:24:1), mix well, and centrifuge at 14000 g for 5 min;

[0057] (4) Take the supernatant into a 1.5 mL centrifuge tube, add 500 μL of chloroform: isoamyl alcohol (24:1), gently shake and mix well, and centrifuge at 14000 g for 5 min;

[0058] (5) Take the supernatant, add 1 mL of isopropanol and mix well, place it at -70 °C for 1 h, or overnight at -20 °C; centrifuge at 13000 g for 10 min, and visible DNA precipitation can be seen;

[0059] (6) Discard the supernatant, wash the DNA precipitate twice with cold 70% ethanol, dry at room temperature; dissolve the DNA with 30 μL - 50 μL of Tris-EDTA buffer;

[0060] Note: Commercial DNA extraction kits can also be used for nucleic acid extraction.

[0061] (II) PCR Amplification

[0062] Using the genomic DNA of different strains obtained in step (1) as a template, perform PCR amplification, and the amplification results are as Figure 1 shown.

[0063] The amplification system and amplification program are as follows:

[0064] Amplification reaction system: 25 μL, including 2×Pro TaqMasterMix (dye plus) * 12.5 μL, 1 μL each of the upstream and downstream primers, 2 μL of DNA template, and make up to 25 μL with water; the concentrations of the upstream and downstream primers are both 10 μM / L.

[0065] Amplification reaction program: 94°C for 3 min; 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.

[0066] Result analysis: As can be seen from Figure 1 it, the pinodella 11F and pinodella 11R primer sets of the present invention have species specificity and can accurately distinguish Didymella pinodella from other strains of the same genus and peripheral strains.

[0067] Example 4

[0068] Determine the detection sensitivity of the pinodella 11F and pinodella 11R primers

[0069] Using D. pinodella with an initial concentration of 18.6 ng / μL as a template, dilute it to 1.86 ng / μL and 0.186 ng / μL respectively for sensitivity testing, and the experimental results are as Figure 2 shown.

[0070] Result analysis: As can be seen from Figure 2 it, when the template concentration is 1.86 ng / μL, the amplification band can be faintly seen; when the template concentration is 0.186 ng / μL, no amplification band appears. Therefore, the detection limit of this primer set is 1.86 ng / μL.

[0071] Example 5

[0072] Actual sample testing

[0073] Positive samples of D. pinodella from different sources (D. pinodella 2517-6, D. pinodella 2517-6-1, D. pinodella 9780, D. pinodella Australia, D. pinodella 38814-4) were selected for experiments to evaluate the detection effect of specific primers on actual samples. The experimental results are as follows Figure 3 shown.

[0074] Result analysis: As can be seen from Figure 3 the above, the detection primers of the present invention can successfully detect Phytophthora pinodes in actual positive samples and have practical application value.

[0075] In this specification, each embodiment is described in a progressive manner. The key point of each embodiment is to illustrate the differences from other embodiments. The same or similar parts among the embodiments can be referred to each other.

[0076] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Use of a gene of Phytophthora vignae as a target gene in the preparation of a product for detecting Phytophthora vignae; the nucleotide sequence of the target gene is as follows: A: As shown in SEQ ID NO.1; B: Or a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.1; C: Or a nucleotide sequence having more than 90% homology with the nucleotide sequence defined by A or B.

2. A primer set for detecting foot rot of peas, characterized in that, The primer set is designed according to the target gene described in claim 1, and the nucleotide sequences of the primer set are as shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. A kit for detecting foot rot of peas, characterized in that, Comprising the primer set described in claim 2.

4. Use of the primer set according to claim 2 or the kit according to claim 3, characterized in that The application is any one of the following directions: A: Application in pea disease-resistant breeding; B: Application in the analysis and identification of closely related species of Phytophthora vignae.

5. A PCR method for detecting foot rot of peas for non-disease diagnosis and treatment, characterized in that, Detection using the primer set described in claim 2 or the kit described in claim 3 includes the following steps: Extract the DNA of the sample to be tested as a template, and use the primer set described in claim 2 or the kit described in claim 3 for detection.

6. The PCR method for detecting pea foot rot disease for non-disease diagnosis and treatment according to claim 5, characterized in that, When an amplification band of 391 bp in size exists in the amplification band, it represents that the sample to be tested contains the pathogen of Phytophthora vignae.

7. The PCR method for detecting foot rot of peas for non-disease diagnosis and treatment according to claim 5, characterized in that, The amplification reaction system of the PCR method is as follows: 25 μL, including 2×Pro Taq Master Mix (dye plus) * 12.5 μL, 1 μL each of the upstream and downstream primers, 2 μL of DNA template, and add water to make up to 25 μL.

8. A PCR method for detecting pea foot rot for non-disease diagnosis and treatment according to claim 7, characterized in that, The concentrations of the upstream and downstream primers are both 10 μM / L.

9. A PCR method for detecting pea foot rot disease for non-disease diagnosis and treatment according to claim 5, characterized in that The amplification reaction program of the PCR method is as follows: 94 °C for 3 min; 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, 35 cycles; 72 °C for 5 min.

Citation Information

Patent Citations

  • Citrus colletotrichum gloeosporioide and citrus root rot pathogenic bacterium dual detection kit and application thereof

    CN106282398A

  • Primer probe group, kit and detection method for real-time fluorescent PCR (polymerase chain reaction) detection of grape stem blight bacteria

    CN113186336A

  • Method of diagnosing gummy stem blight in plants using a polymerase chain reaction assay

    US20010024785A1