Primer pair for detecting mating type gene of morchella esculenta based on Indel molecular marker as well as detection method and application of primer pair

Abstract

The invention relates to a primer pair for detecting mating type genes of morchella based on Indel molecular markers as well as a detection method and application thereof, two mating type genes of morchella can be quickly, accurately and efficiently identified through a pair of detection primers, so that the risk that morchella is not fruiting in a large-scale planting process at present is solved and dealt with. According to the technical scheme, a primer pair for identifying or assisting in identifying the mating type genes MAT1-1-1 and MAT1-2-1 of the morchella esculenta is provided, and the primer pair is composed of a forward primer SPMAT1-F and a reverse primer SPMAT1-R. The two mating type genes of the morchella esculenta can be rapidly, accurately and efficiently identified through a pair of detection primers, the detection efficiency is improved, and the detection time is shortened. The operation process is simplified, and the experimental error is reduced, so that the risk of no fruiting in the current large-scale planting process of morchella esculenta is solved and dealt with.

Description

I. Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a primer pair for detecting the mating type genes of Morchella esculenta based on Indel molecular markers, and a detection method and application thereof. II. Background Art

[0002] Morchella esculenta is a rare edible and medicinal mushroom. The fruiting body contains rich amino acids, polysaccharides, minerals and other nutrients, and is deeply loved by consumers. With the success of the artificial cultivation technology of Morchella esculenta, in recent years, it has developed rapidly from south to north, quickly radiating across the country, and the cultivation scale has been expanding year by year. Driven by interests, a large number of mushroom species enterprises have emerged. The inflow of poor-quality mushroom species into the market often leads to the situation of no fruiting in production, causing huge economic losses.

[0003] The sexual reproduction mode of Morchella esculenta is heterothallic mating, which is controlled by a single mating locus MAT1, that is, it is necessary to have both MAT1-1-1 and MAT1-2-1 mating type genes fuse at the same time to complete sexual reproduction and form ascocarps (fruiting bodies).

[0004] The production of Morchella esculenta mushroom species mainly has three levels (mother spawn, original spawn and cultivated spawn). How to quickly detect the two mating type genes is an important guarantee to ensure that the mushroom species can fruit and select excellent strains, and is of great significance to the healthy and stable development of the Morchella esculenta industry.

[0005] With the rapid development of molecular marker technology, the detection method of Morchella esculenta mating type genes has evolved from single PCR using two pairs of primers to detect one mating type gene respectively to duplex PCR based on two pairs of primers. Although there has been a great improvement in detection efficiency and operation process, with the widespread application of Morchella esculenta cultivation technology across the country, in the process of large-scale production and commercial cultivation, there is an urgent need to establish a detection method for Morchella esculenta mating type genes that is simpler, faster and more accurate, so as to effectively reduce the risk of no fruiting in the Morchella esculenta industry. III. Summary of the Invention

[0006] In view of the above situation, to solve the defects of the prior art, the purpose of the present invention is to provide a primer pair for detecting the mating type genes of Morchella esculenta based on Indel molecular markers, and a detection method and application thereof. Through a pair of detection primers, the two mating type genes of Morchella esculenta can be quickly, accurately and efficiently identified, so as to solve and cope with the risk of no fruiting in the current large-scale cultivation process of Morchella esculenta.

[0007] One of the technical solutions provided by the present invention is to provide primer pairs for identifying or assisting in identifying the mating type genes MAT1-1-1 and MAT1-2-1 of Morchella. The primer pairs consist of a forward primer SPMAT1-F and a reverse primer SPMAT1-R. The nucleotide sequence of the forward primer SPMAT1-F is a single-stranded DNA molecule shown in SEQ ID NO.1; the nucleotide sequence of the reverse primer SPMAT1-R is a single-stranded DNA molecule shown in SEQ ID NO.2.

[0008] The second technical solution provided by the present invention is the application of the primer pairs of the present invention in identifying or assisting in identifying the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella.

[0009] The third technical solution provided by the present invention is the application of the primer pairs of the present invention in a detection kit for identifying or assisting in identifying the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella.

[0010] The fourth technical solution provided by the present invention is that the method for identifying or assisting in identifying the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella is as follows: using the primer pair composed of the forward primer SPMAT1-F and the reverse primer SPMAT1-R to perform PCR amplification on the Morchella DNA template to obtain a PCR amplification product. When the amplification product contains both the 262bp and 442bp target bands, it indicates that the test sample contains both the MAT1-1-1 and MAT1-2-1 mating type genes; when the amplification product has only the 262bp target band, it indicates that the test sample contains only the MAT1-1-1 mating type gene; when the amplification product has only the 442bp target band, it indicates that the test sample contains only the MAT1-2-1 mating type gene.

[0011] The PCR amplification system is 7μl of 2×T5 PCR mix, 1μl of each of the forward and reverse primers at 10μl / L, and the concentration of the DNA template is 1-100ng / μl.

[0012] Preferably, the concentration of the DNA template is 50ng / μl.

[0013] The reaction conditions for the PCR amplification are as follows: pre-denaturation at 98°C for 5 min; 98°C for 15 s, 68°C for 30 s, 72°C for 20 s, for a total of 25 cycles; extension at 72°C for 2 min.

[0014] The method for extracting the Morchella DNA template is as follows:

[0015] 1) Sample collection

[0016] The test strains were activated on PDA medium and cultured. The well - grown mycelia on the plate were scraped out with a blade. For stock or cultivated strains, the mycelia could be picked out with forceps and placed in a 1.5 - ml centrifuge tube, then quickly put into liquid nitrogen for 30 s, and rapidly taken out and stored at - 20 °C for later use.

[0017] 2) Extraction of Morchella DNA template

[0018] Take 0.1 g of fungal mycelia sample, grind it into a uniformly granular powder with liquid nitrogen, and extract gDNA using a fungal genomic DNA extraction kit. After the extraction, detect the DNA quality with a nucleic acid analyzer. When the A260 / 280 ratio is 1.8 - 2.0, the Morchella DNA template is obtained.

[0019] The composition of the PDA medium is as follows: 200 g of potato, 20 g of glucose, 2 g of MgSO4, 18 g of agar, prepared with 1000 mL of distilled water, natural pH value, sterilized at 121 °C for 20 min.

[0020] The beneficial effects of the present invention are as follows:

[0021] 1) Based on a pair of Indel molecular markers, the present invention can simultaneously detect two target fragments of MAT1 - 1 - 1 and MAT1 - 2 - 1 genes through one - step PCR reaction and one - step electrophoresis, which simplifies the operation steps, saves reagent costs, shortens the PCR reaction and electrophoresis time, and has very good specificity, applicability and practicability.

[0022] 2) Through a pair of detection primers, the present invention can quickly, accurately and efficiently identify two mating - type genes of Morchella, improve the detection efficiency, simplify the operation process, reduce experimental errors, and thus solve and cope with the risk of no fruiting during the large - scale cultivation of Morchella nowadays. IV. Description of the Drawings

[0023] Figure 1 It is the sequence alignment of mating - type genes MAT1 - 1 - 1 and MAT1 - 2 - 1 of the present invention.

[0024] Figure 2 It is the database alignment of mating - type gene MAT1 - 1 - 1 of the present invention.

[0025] Figure 3 It is the database alignment of mating - type gene MAT1 - 2 - 1 of the present invention.

[0026] Figure 4 It is the DNA electrophoresis pattern of different mating - type genes of Morchella of the present invention; where M: DNA Marker.

[0027] Figure 5Electrophoresis diagram of Morchella DNA detection at different concentrations of the present invention; where M: DNA Marker.

[0028] Figure 6 Electrophoresis diagram of PCR amplification results of mating type genes of different mother strains, original strains and cultivated strains of Morchella of the present invention; where M: DNA Marker; lanes 1-3 represent different mother strains; lanes 4-6 represent different original strains; lanes 7-9 represent different cultivated strains: CK1: positive control; CK2: negative control.

[0029] Figure 7 Electrophoresis diagram of PCR amplification results of mating type genes of different mother strains, original strains and cultivated strains of Morchella of the present invention. The mother strains, original strains and cultivated strains respectively contain two MAT1-1-1 and MAT1-2-1 genotype. CK1: positive control; CK2: negative control. V. Specific Embodiments

[0030] The following further elaborates on the specific embodiments of the present invention in conjunction with examples and drawings.

[0031] The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods used in the following examples are all conventional methods unless otherwise specified. All materials, reagents, etc. in the following examples can be obtained from commercial sources unless otherwise specified.

[0032] The present invention provides a primer pair for detecting the mating type of Morchella based on Indel molecular markers, which is a primer pair designed based on the mating type genes MAT1-1-1 and MAT1-2-1 of Morchella; it can be used to identify or assist in identifying the mating type gene MAT of Morchella, the mating type gene MAT1-1-1 of Morchella (the nucleotide sequence is shown in SEQ ID NO.3), and the mating type gene MAT1-2-1 of Morchella (the nucleotide sequence is shown in SEQ ID NO.4).

[0033] I: Primer Design

[0034] As Figure 1 shown, by aligning genomic sequences to find the genomic difference sites of MAT1-1-1 and MAT1-2-1, primers are designed, and at the same time, the amplified sequences of MAT1-1-1 and MAT1-2-1 are aligned with the NCBI database, as shown in Figure 2 and 3 shown respectively.

[0035] SPMAT1-F: 5’AGCTGCTAGTTGGGCCCATA 3’ (SEQ ID NO.1)

[0036] SPMAT1-R: 5’GATTCTTCATCGCCAACGCT3’ (SEQ ID NO.2)

[0037] II: Identification of Mating-Type Genes

[0038] 1. The gDNA separately containing MAT1-1-1 and MAT1-2-1 and the gDNA containing both MAT1-1-1 and MAT1-2-1, which were preserved in the laboratory, were used as templates. The primer pair composed of SPMAT1-F and SPMAT1-R was used for PCR amplification to obtain PCR amplification products. The PCR reaction system is as follows in the table:

[0039] Table 1 PCR Reaction System

[0040]

[0041] PCR reaction conditions: pre-denaturation at 98°C for 5 min, 98°C for 15 s, 68°C for 30 s, 72°C for 20 s, a total of 25 cycles; extension at 72°C for 2 min.

[0042] 2. The PCR amplification products were subjected to 2% agarose gel electrophoresis, stained with ethidium bromide, and observed under ultraviolet light. The experimental result judgment criteria refer to Table 2.

[0043] Table 2 Judgment Criteria for the Pseudomating-Type Genes MAT1-1-1 and MAT1-2-1 of Morchella

[0044]

[0045] Example 1

[0046] Optimization of PCR Mating-Type Gene Detection Technology for Morchella

[0047] 1. Sample collection: The test strains were activated on the Morchella culture medium and cultured. The well-grown mycelia on the plate were scraped out with a blade, and the mycelia of the original species or cultivated species were picked out with forceps and placed in a 1.5 ml centrifuge tube. They were quickly put into liquid nitrogen for 30 s, and then quickly taken out and stored at -20°C for later use.

[0048] 2. Extraction of total DNA of Morchella: Take 0.1 g of fungal mycelia sample, grind it into a uniformly granular powder with liquid nitrogen, and extract gDNA with a fungal genomic DNA extraction kit. After the extraction, the DNA quality was detected with a nucleic acid analyzer. When the A260 / 280 ratio was 1.8 - 2.0, PCR amplification was carried out. The PCR reaction system is as follows in the table:

[0049] Table 3 PCR Reaction System

[0050]

[0051]

[0052] PCR reaction conditions: pre-denaturation at 98°C for 5 min, 98°C for 15 s, 68°C for 30 s, 72°C for 20 s, a total of 25 cycles; extension at 72°C for 2 min.

[0053] 3. Perform 2% agarose gel electrophoresis on the PCR amplification products, observe under ultraviolet light after staining with ethidium bromide.

[0054] The results are as Figure 4 shown. When the target bands appear for both MAT1-1-1 and MAT1-2-1 in the positive control and there is no target band in the negative control, the test results meet the expectations, and the results are judged with reference to Table 2.

[0055] Using Morchella DNA at different concentrations as templates, setting different concentrations of 1 ng / μl, 5 ng / μl, 25 ng / μl, 50 ng / μl, and 100 ng / μl, perform PCR amplification with this primer pair (the PCR system and PCR reaction program conditions are the same as above) to obtain target bands of 262 bp and 442 bp.

[0056] Perform 2% agarose gel electrophoresis on the PCR amplification products, observe under ultraviolet light after staining with ethidium bromide. The results are as Figure 5 shown. When the DNA concentration is only 5 ng / μl, the amplified band is single, bright, and clear. There is a faint band at 1 ng / μl, indicating that this primer has high sensitivity and only a small amount of gDNA is required for effective amplification.

[0057] Example 2

[0058] Identification of MAT mating type genes of stock culture, spawn, and cultivated spawn that can produce fruiting bodies in the field

[0059] Use the optimized PCR system and method in Example 1 to identify different hierarchical strains that can produce fruiting bodies in the field in Baofeng County. Use the DNA containing both MAT1-1-1 and MAT1-2-1 mating type genes in the laboratory as the positive control, and the DNA without MAT1-1-1 and MAT1-2-1 genes as the negative control. The electrophoresis results are as Figure 6 shown. In stock culture, spawn, and cultivated spawn, two mating type genes of different Morchella can be effectively detected simultaneously, and it is consistent with the fruiting conditions in actual production.

[0060] Example 3

[0061] Identification of mating type genes of stock culture, spawn, and cultivated spawn that cannot produce fruiting bodies in the field

[0062] Using the optimized PCR system and procedure of Example 1 to detect the mating type genes of Morchella mycelium, spawn and cultivated strains from Baofeng County that are unable to fruit. Strains containing only MAT1-1-1 and MAT1-2-1 genes respectively were used as negative controls. The electrophoresis results are as Figure 7 shown. The mating genotypes that are unable to fruit can only randomly amplify a single mating genotype (amplification of no mating type gene is not shown), which is consistent with the production phenomenon of no fruiting in the field.

[0063] The molecular marker of the present invention is the first one that can simultaneously detect two mating type genes of Morchella with a pair of primers. Compared with detecting two mating type genes with two pairs of primers, it greatly reduces the expenditure of manpower, material resources and financial resources, is simpler in experimental operation, can effectively avoid experimental errors, can timely and accurately predict whether Morchella strains can fruit when selecting Morchella cultivated varieties, and at the same time helps to eliminate strains with defective mating types as early as possible in the stages of mycelium, spawn, cultivated variety and new variety breeding, avoid losses caused by blind production, and reduce contradictions between growers and spawn enterprises. Therefore, it has good application prospects in production.

[0064] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application is intended to cover any modification, use or improvement of the present invention, including changes made with conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. A primer pair for detecting the mating type gene of Morchella esculenta based on Indel molecular markers, characterized in that, The primer pair consists of a forward primer SPMAT1-F and a reverse primer SPMAT1-R. The nucleotide sequence of the forward primer SPMAT1-F is the single-stranded DNA molecule shown in SEQ ID NO.1; the nucleotide sequence of the reverse primer SPMAT1-R is the single-stranded DNA molecule shown in SEQ ID NO.

2.

2. Use of the primer pair according to claim 1 in identifying or assisting in the identification of the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella.

3. Use of the primer pair according to claim 1 in a detection kit for identifying or assisting in the identification of the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella.

4. The method for identifying or assisting in identifying the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 by the primer pair according to claim 1, characterized in that, PCR amplification is performed on the Morchella DNA template using a primer pair consisting of a forward primer SPMAT1-F and a reverse primer SPMAT1-R to obtain a PCR amplification product. When the amplification product contains both the 262bp and 442bp target bands, it indicates that the sample to be tested contains both the MAT1-1-1 and MAT1-2-1 mating type genes; when the amplification product only has the 262bp target band, it indicates that the sample to be tested only contains the MAT1-1-1 mating type gene; when the amplification product only has the 442bp target band, it indicates that the sample to be tested only contains the MAT1-2-1 mating type gene.

5. A method for identifying or assisting in the identification of the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella esculenta using the primer pair according to claim 4, characterized in that, The PCR amplification system is 7μl of 2×T5 PCR mix, 1μl each of the forward and reverse primers at 10μl / L, and the concentration of the DNA template is 1-100ng / μl.

6. The method for identifying or assisting in the identification of the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella esculenta using the primer pair according to claim 5, characterized in that, The concentration of the DNA template is 50ng / μl.

7. A method for identifying or assisting in the identification of the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella esculenta using the primer pair according to claim 4, characterized in that, The reaction conditions for the PCR amplification are as follows: pre-denaturation at 98°C for 5 min; 98°C for 15 s, 68°C for 30 s, 72°C for 20 s, for a total of 25 cycles; extension at 72°C for 2 min.

8. The method for identifying or assisting in the identification of the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1 and MAT1-2-1 of Morchella esculenta using the primer pair according to claim 4, characterized in that The method for extracting the Morchella DNA template is as follows: 1) Sample collection The test strains are activated on PDA medium and cultured. The well-grown mycelia on the plate are scraped out with a blade, and the mycelia of the original or cultivated species can be picked out with forceps and placed in a 1.5 ml centrifuge tube, quickly put into liquid nitrogen for 30 s, quickly taken out and stored at -20°C for later use; 2) Extraction of the Morchella DNA template Take 0.1 g of the fungal mycelia sample, grind it into a powdery state with uniform particles using liquid nitrogen, extract gDNA using a fungal genomic DNA extraction kit, and detect the DNA quality with a nucleic acid analyzer after extraction. When the A260 / 280 ratio is 1.8-2.0, the Morchella DNA template is obtained.

9. The method for identifying or assisting in the identification of the mating type genes MAT1-1-1, MAT1-2-1 or the combination of MAT1-1-1, MAT1-2-1 by the primer pair according to claim 8, characterized in that, The composition of the PDA medium is: 200 g of potato, 20 g of glucose, 2 g of MgSO4, 18 g of agar, prepared with distilled water to 1000 mL, natural pH value, sterilized at 121°C for 20 min.

Images