Development and application of molecular markers for the waterlogging tolerance-related gene BnaERF3 in rapeseed
Through genome-wide correlation analysis, the BnaA06.ERF3 gene was screened out and related molecular markers were developed, which solved the problem of stain resistance detection of cabbage-type rapeseed, achieved efficient stain resistance identification and breeding, and quickly screened high stain resistance varieties.
Patent Information
- Application Number
- CN202510820685.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-19
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2045-06-19
AI Technical Summary
The lack of effective molecular markers in the prior art is used to detect stain resistance of cabbage-type rapeseed, resulting in slow breeding process and difficulty in selecting and breeding high stain-resistant varieties.
The candidate gene BnaA06.ERF3 was screened through genome-wide association analysis, and the molecular marker I and molecular marker II were developed related to it, primer pairs were designed for PCR amplification, and the stain resistance of rape was identified by electrophoretic band positions, providing kits and identification methods.
Accurate identification of stain resistance of cabbage-type rapeseed and efficient auxiliary breeding can be achieved, and high stain resistance varieties can be quickly screened, reducing environmental impact and cost.
Smart Images

Figure CN120350164B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular to the development and application of a molecular marker of rapeseed waterlogging tolerance-related gene BnaERF3. Background Art
[0002] Brassica napus L. is an important oil crop, accounting for 55% of the total domestic oil crops. It has the functions of producing oil, vegetables, flowers, honey, fertilizer, and feed. The annual planting area is more than 7 million hectares, and its oil production accounts for more than 50% of the total domestic oil crop production.
[0003] Waterlogging stress severely impairs the growth, development, and yield formation of Brassica napus, and its mechanisms involve multi-dimensional physiological damage. First, root hypoxia inhibits aerobic respiration and activates anaerobic metabolism, resulting in ethanol accumulation, which aggravates cytotoxicity, leading to mitochondrial disintegration and decreased root activity. Second, the leaf photosynthetic system is damaged, chlorophyll content decreases, the net photosynthetic rate and stomatal conductance decrease significantly, and photoinhibition is aggravated. In addition, a burst of reactive oxygen species triggers membrane lipid peroxidation, exacerbating membrane system damage. Ultimately, this leads to a decrease in the number of effective siliques per plant in rapeseed, a decrease in 1,000-grain weight, and a significant reduction in yield. Therefore, breeding rapeseed varieties that are tolerant to waterlogging is of great significance for ensuring the security of edible oil supply.
[0004] Molecular marker technology is an important tool for detecting genetic diversity. Its results are not limited by tissue specificity, environmental conditions, or gene expression. Its rich polymorphism and strong genetic stability make it widely applicable in plant genetic improvement research. This technology has been widely applied. In soybean, researchers have used markers to locate several new soybean mosaic virus resistance genes and discovered a number of molecular markers that are tightly linked or co-segregate with soybean mosaic virus resistance genes and can be used to assist in breeding. Breakthroughs in molecular marker-assisted selection (MAS) technology have provided efficient technical means for the selection of restorer lines in rice. Sequence alignment analysis of alleles in rice revealed a functional marker, YRf6, that targets sequence polymorphism at a specific site in the Rf6 gene. Its amplification product exhibits a characteristic 763 bp fragment in restorer materials and a 439 bp fragment in non-restorer materials, enabling precise screening of restorer lines. Furthermore, a study based on screening of 72 rice parents with different genotypes demonstrated that SSR markers RM10313 and RM6100 are tightly linked to the restorer genes Rf3 and Rf4, respectively, confirming that this marker combination can serve as an effective molecular detection system for identifying Rf3 / Rf4 genes in restorer lines. Therefore, screening for molecular markers tightly linked to target traits and then conducting molecular marker-assisted selection breeding is an effective means to accelerate the application of gene function. However, there are currently no reports on the development of molecular markers related to waterlogging tolerance in rapeseed for the BnaA06.ERF3 gene. Summary of the Invention
[0005] The purpose of the present invention is to provide the development and application of a molecular marker for the rapeseed waterlogging tolerance-related gene BnaERF3 to solve the problems existing in the above-mentioned prior art. The candidate gene BnaA06.ERF3 was obtained through whole-genome association analysis screening, and a molecular marker related to the waterlogging tolerance of Brassica napus was developed for this gene. The developed molecular marker can be used to detect the waterlogging tolerance of Brassica napus, thereby assisting the selection and breeding of varieties containing waterlogging tolerance genes, thereby accelerating the process of waterlogging tolerance breeding of Brassica napus.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a molecular marker related to waterlogging tolerance of Brassica napus. The molecular marker includes a molecular marker I and a molecular marker II. The nucleotide sequence of the molecular marker I is shown in SEQ ID NO.1, and the nucleotide sequence of the molecular marker II is shown in SEQ ID NO.2. The molecular marker I is related to low waterlogging tolerance of Brassica napus, and the molecular marker II is related to high waterlogging tolerance of Brassica napus.
[0008] The present invention also provides a primer pair for amplifying the molecular marker, and the nucleotide sequence of the primer pair is shown as SEQ ID NO.3-4.
[0009] The present invention also provides a kit comprising the primer pair.
[0010] The present invention also provides the use of the molecular marker, the primer pair or the kit in identifying waterlogging tolerance of Brassica napus.
[0011] The present invention also provides the use of the molecular marker, the primer pair or the kit in assisting the breeding of waterlogging-tolerant Brassica napus.
[0012] The present invention also provides the use of the molecular marker, the primer pair or the kit in screening Brassica napus varieties with high waterlogging tolerance.
[0013] The present invention also provides a method for identifying waterlogging tolerance of Brassica napus, comprising the steps of using the genomic DNA of the Brassica napus to be tested as a template, amplifying the molecular marker using a primer pair, and identifying the waterlogging tolerance of Brassica napus according to the electrophoresis band position of the amplified molecular marker, wherein the nucleotide sequence of the primer pair is as shown in SEQ ID NO.3-4.
[0014] Preferably, the identification method is: if only a 174 bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as a low waterlogging-tolerant rapeseed variety; if only a 133 bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as a high waterlogging-tolerant rapeseed variety.
[0015] Preferably, the amplification reaction system comprises: 5 μL of 2×Taq Plus Master Mix, 2 μL of DNA template, 0.25 μL of upstream primer, 0.25 μL of downstream primer and 2.5 μL of ultrapure water.
[0016] Preferably, the amplification reaction procedure is: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, a total of 34 cycles; extension at 72°C for 5 min, 1 cycle; and finally storage at 4°C.
[0017] The present invention discloses the following technical effects:
[0018] (1) The present invention located and screened a candidate gene, BnaA06.ERF3, associated with waterlogging tolerance in Brassica napus through genome-wide association analysis. The gene BnaA06.ERF3 significantly affects waterlogging tolerance in Brassica napus and plays a key regulatory role in improving its tolerance. It can be used for regulatory network construction and molecular marker-assisted breeding, and is suitable for large-scale promotion and application.
[0019] (2) The present invention conducted haplotype analysis based on the BnaA06.ERF3 gene and designed corresponding molecular markers. Experiments have shown that the molecular markers can detect the waterlogging tolerance of Brassica napus, assist in the selection and breeding of highly waterlogging-tolerant varieties, and accelerate the breeding process of Brassica napus with high waterlogging tolerance.
[0020] (3) The molecular marker designed for the BnaA06.ERF3 gene of the present invention is applied to the identification of waterlogging-tolerant varieties of Brassica napus, which has the advantages of accurate results, simplicity and speed, low cost, and no environmental influence. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0022] Figure 1This is a schematic diagram of the distribution results of the waterlogging tolerance coefficient of the number of siliques in the main inflorescence of the Brassica napus associated population;
[0023] Figure 2 Manhattan plot for genome-wide association analysis;
[0024] Figure 3 The results of the analysis of the waterlogging tolerance coefficient of the number of siliques in the main inflorescence of the two haplotypes HapA and HapB;
[0025] Figure 4 Gel electrophoresis test results of molecular markers amplified for different Brassica napus germplasms; 1-8 are Brassica napus germplasms with low waterlogging tolerance, and 9-16 are Brassica napus germplasms with high waterlogging tolerance. DETAILED DESCRIPTION
[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0027] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0031] This study selected 505 Brassica napus (Brassica napus) related populations and, through analysis, discovered a major QTL for waterlogging tolerance (qWL.A06) on linkage group A06. The BnaA06.ERF3 gene, a key gene within this QTL, is implicated in regulating waterlogging tolerance in Brassica napus. This suggests that the BnaA06.ERF3 gene has significant potential for application in Brassica napus breeding and is of great significance for developing waterlogging-tolerant Brassica napus varieties. Therefore, the present invention developed a molecular marker associated with waterlogging tolerance in Brassica napus targeting the BnaA06.ERF3 gene and verified its association with waterlogging tolerance in Brassica napus. The following examples further illustrate this approach.
[0032] Example 1: Development of molecular markers associated with waterlogging tolerance in rapeseed
[0033] 1. Associated Population Planting and SMI-WTC (Waterlogging Tolerance Coefficient of the Number of Siliques in the Main Inflorescence) Determination
[0034] A total of 505 Brassica napus accessions were planted at the Huazhong Agricultural University phenotyping platform in 2017-2018. Eight pots were planted for each accession. Six pots with relatively consistent growth were randomly divided into a control group and an 8-day flooding treatment group. The number of siliques per plant on the main inflorescence at maturity was measured, and the waterlogging tolerance coefficient was calculated using the following formula:
[0035] Waterlogging tolerance coefficient = number of siliques on the main inflorescence of the treatment group / number of siliques on the main inflorescence of the control group.
[0036] The results are as follows Figure 1 As shown, it shows the distribution of waterlogging tolerance coefficient of the number of siliques in the main inflorescence of 505 Brassica napus related populations.
[0037] 2. Genome Resequencing Data Analysis
[0038] The rapeseed reference genome (B. napus v4.1) was downloaded from the BnIR database (https: / / yanglab.hzau.edu.cn / ). Reads were aligned to the reference genome using the “mem -M -k 32 -t 4” code in the BWA software. Duplicates were removed using the SAM tool. Sequence variants in associated populations were identified using the Genome Analysis Toolkit (GATK v3.6). SNPs with an alignment quality less than 20 or a sequencing depth less than 50 were filtered out. A total of 11,700,689 SNPs were identified.
[0039] 3. Genome-wide association analysis
[0040] (1) In the genome-wide association analysis, the linear mixed model provided by the FaST-LMM software package was used to identify QTL loci related to waterlogging tolerance on a genome-wide scale using 11,700,689 SNPs markers and phenotypic values (i.e., the waterlogging tolerance coefficient of the number of siliques in the main inflorescence) (the results are shown in Figure 2). Figure 2 shown).
[0041] (2) A major QTL locus (qWL.A06) for the waterlogging tolerance coefficient of the number of siliques in the main inflorescence was identified on chromosome A06 of Brassica napus, and the 100 kb before and after the lead SNP was defined as the QTL interval.
[0042] (3) Combined with the transcriptome data of extreme waterlogging materials available in the laboratory, it was found that the BnaA06.ERF3 gene responded to waterlogging and other genes in the ERF family were reported to regulate plant waterlogging stress. Therefore, this gene was selected as the key candidate gene in this QTL interval for subsequent functional verification.
[0043] 4. Haplotype Identification and Molecular Marker Development of the Candidate Gene BnaA06.ERF3
[0044] (1) The promoter, 3'-UTR and coding region sequences of BnaA06.ERF3 were analyzed in the associated population, and two haplotypes (HapA and HapB) were identified. The average waterlogging tolerance coefficient of the number of siliques in the main inflorescence of the HapA haplotype was 45.3%±2.7%, and the average waterlogging tolerance coefficient of the number of siliques in the main inflorescence of the HapB haplotype was 52.2%±2.2%. The phenotypic difference in the waterlogging tolerance coefficient of the number of siliques in the main inflorescence between the two haplotypes was significant (e.g. Figure 3 shown).
[0045] (2) Based on the sequences of the two haplotypes of the BnaA06.ERF3 gene, a molecular marker related to waterlogging tolerance in rapeseed was developed. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1-2 below:
[0046] HapA (SEQ ID NO. 1):
[0047] GACGGATCCCTAGGAGAATC GCAGAGGTTTTGCCGGTTCGTGAGTCGACAGTGGTCGCTTTACTAGAGGACGGTGGAACAGTCGGAAACTGCAAGTCCACTATTGAAACCTCTAGGGTTTGTATCGATGAGGTGGGAAGTGTTCGTTTTGTCGG CGGATCTGGCTACTGAGATG.
[0048] HapB (SEQ ID NO. 2):
[0049] GACGGATCCCTAGGAGAATCGCAGAGGTCTTGCTGGTTAGTGAGTCGACATTGGTCGCTTTACTAGAGGACGGTGGAGCAGTCGGAAACTGCAAAAGGTGTTCGTTTTGTCGG CGGATCTGGCTACTGAGATG.
[0050] Note: In the above sequences, the underlined ones are the molecular marker primers designed and developed.
[0051] The primer pair 2670-L and 2670-R for amplifying molecular markers is as follows:
[0052] 2670-L (SEQ ID NO.3): 5'-GACGGATCCCTAGGAGAATC-3';
[0053] 2670-R (SEQ ID NO. 4): 5'-CATCTCAGTAGCCAGATCCG-3'.
[0054] Example 2: Identification of Brassica napus plant genotypes using molecular markers
[0055] The molecular markers of Example 1 were used to perform genotyping on the Brassica napus plants to be tested, wherein the Brassica napus plants to be tested were haplotype materials with extreme waterlogging-tolerant phenotypes screened out from 505 Brassica napus samples in Example 1, wherein the materials numbered 1-8 were Brassica napus materials with low waterlogging-tolerant properties, and the materials numbered 9-16 were Brassica napus materials with high waterlogging-tolerant properties.
[0056] The identification process is as follows:
[0057] (1) Extraction of rapeseed leaf DNA using the CTAB method
[0058] a. Take 1 cm thick young leaves from each plant 2 Place in a 2 mL centrifuge tube, add steel beads, add 250 μL of 2% CTAB, grind on a grinder for 5 min, and then add 500 μL of CTAB to the centrifuge tube;
[0059] b. Place in a 65°C water bath for 60 minutes, shaking every 15 minutes;
[0060] c. Cool the homogenate to room temperature after water bathing, and add a mixture of chloroform and isoamyl alcohol in a volume ratio of 24:1 to the centrifuge tube. Gently invert and mix for 15 minutes, and then centrifuge at 12,000 rpm for 10 minutes.
[0061] d. Place the centrifuged tubes in order on the operating plate and aspirate 500 μL of the supernatant into a new 1.5 mL centrifuge tube.
[0062] e. Add 50 μL of potassium acetate (KAc) solution to the supernatant, followed by 500 μL of ice-cold ethanol. Cover the centrifuge tube and gently shake it several times to thoroughly mix the ice-cold ethanol and supernatant. Place the tube in a -20°C refrigerator for 20-30 minutes to allow the genomic DNA to precipitate.
[0063] f. Centrifuge the tube at 12,000 rpm for 6 minutes, discard the supernatant, add 500 μL of 75% ethanol, let it stand for another 5 minutes, discard the supernatant, and repeat this process. The precipitate is genomic DNA.
[0064] g. The centrifuge tube containing the DNA was placed in a fume hood to dry, thereby obtaining genomic DNA from each plant;
[0065] h. Add 200 μL of ddH2O to the air-dried centrifuge tube containing DNA to dissolve the DNA. After dissolution, store at -20°C.
[0066] (2) PCR amplification of molecular markers
[0067] Using the genomic DNA of the Brassica napus plant to be tested, extracted using the CTAB method in the above steps, as a template, PCR amplification was performed using the molecular marker primer pairs designed in Example 1 (as shown in SEQ ID NOs. 3-4). The PCR amplification reaction system was 10 μL, and each reaction system specifically included: 5 μL of 2×Taq Plus Master Mix (Vazyme), 2 μL of DNA template, 0.25 μL of 2670-L (10 μM), 0.25 μL of 2670-R (10 μM), and 2.5 μL of ultrapure water.
[0068] The PCR reaction program was as follows: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 20 s, for a total of 34 cycles; extension at 72°C for 5 min, 1 cycle; and finally storage at 4°C.
[0069] (3) Amplification products and electrophoresis analysis
[0070] The amplified products of all the Brassica napus plants to be tested were electrophoresed on a 1.5% agarose gel, stained with the nucleic acid dye ethidium bromide, and imaged under ultraviolet light to obtain the genotype information of the tested samples. Figure 4As shown. Using primers SEQ ID NOs. 3-4 as DNA templates for all low-waterlogging-tolerance Brassica napus germplasms (waterlogging tolerance coefficient 28.48% ± 4.85%), a single band of approximately 174 bp (numbered 1-8) was amplified. Using primers SEQ ID NOs. 3-4 as DNA templates for high-waterlogging-tolerance Brassica napus germplasms (waterlogging tolerance coefficient 80.35% ± 2.68%), a single band of approximately 133 bp (numbered 9-16) was amplified. This indicates that the molecular marker developed in this invention can effectively distinguish between Brassica napus germplasms with low and high waterlogging tolerance.
[0071] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A molecular marker related to waterlogging tolerance in Brassica napus, characterized in that: The molecular markers include molecular marker I and molecular marker II, the nucleotide sequence of the molecular marker I is shown in SEQ ID NO.1, and the nucleotide sequence of the molecular marker II is shown in SEQ ID NO.2, wherein the molecular marker I is associated with low waterlogging tolerance of Brassica napus, and the molecular marker II is associated with high waterlogging tolerance of Brassica napus.
2. Use of a reagent for detecting the molecular marker according to claim 1 in identifying waterlogging tolerance in Brassica napus.
3. Use of a reagent for detecting the molecular marker according to claim 1 in assisting the breeding of waterlogging-tolerant Brassica napus.
4. Use of a reagent for detecting the molecular marker according to claim 1 in screening Brassica napus varieties with high waterlogging tolerance.
5. A method for identifying waterlogging tolerance of Brassica napus, characterized in that: The method comprises the steps of using genomic DNA of Brassica napus to be tested as a template, amplifying the molecular marker according to claim 1 using a primer pair, and identifying the waterlogging tolerance of Brassica napus according to the position of the electrophoresis band of the amplified molecular marker, wherein the nucleotide sequence of the primer pair is as shown in SEQ ID NO.3-4; The identification method is: if only a 174 bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as a low waterlogging-tolerant rapeseed variety; if only a 133 bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as a high waterlogging-tolerant rapeseed variety.
6. The method according to claim 5, wherein The amplification reaction system includes: 5 μL of 2×Taq Plus Master Mix, 2 μL of DNA template, 0.25 μL of upstream primer, 0.25 μL of downstream primer and 2.5 μL of ultrapure water.
7. The method according to claim 5, wherein The amplification reaction procedure was as follows: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 20 s, for a total of 34 cycles; extension at 72°C for 5 min, 1 cycle; and finally storage at 4°C.