KASP molecular marker related to corn kernel protein content, primer group, kit and application

Through the KASP molecular marker and fluorescence quantitative PCR amplification technology developed on chromosome 7 of corn B73RefGen_v4 reference genome, the accuracy and stability of corn kernel protein content detection were solved, and high-protein corn material identification in efficient screening and breeding were achieved.

CN120350167AActive Publication Date: 2025-07-22JIANGSU ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510846174.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-24
Publication Date
2025-07-22
Estimated Expiration
2045-06-24

AI Technical Summary

Technical Problem

In the prior art, few molecular markers related to corn kernel protein content, and complex repeat sequences in the corn genome make it difficult to guarantee the accuracy and stability of SNP marker identification and KASP detection results, which affects the screening and breeding effect of corn protein content.

Method used

A KASP molecular marker located in chromosome SYN21579_Chr7_5211731 of the reference genome of corn B73RefGen_v4 was developed, and fluorescence quantitative PCR amplification was performed using specific primer sets. The corn kernel protein content was judged by detecting the A/G base differences, and the FAM and HEX fluorescent linker sequence tags were designed to distinguish genotypes.

Benefits of technology

Fast and accurate corn kernel protein content detection is achieved, which can effectively screen and identify high-protein corn materials, and supports the prediction and improvement of grain protein content during breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350167A_ABST
    Figure CN120350167A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular genetics, in particular to a corn kernel protein content related KASP molecular marker, a primer group, a kit and application. The KASP molecular marker disclosed by the invention is positioned on a chromosome 7 SYN21579Chr75211731 of a corn B73RefGenv4 reference genome; according to the method, to-be-detected corn DNA is taken as a template, the primer group or the kit is used for performing fluorescent quantitative PCR amplification, and the genetic typing and protein content conditions of the corn kernels are judged according to the amplified fluorescent detection result, so that the evaluation of the protein content of the corn kernels is realized; and a new way is provided for predicting, identifying or assisting in identifying the grain protein content or breeding a new corn variety with high grain protein content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetics, and particularly relates to a KASP molecular marker related to corn kernel protein content, a primer set, a kit and applications thereof. Background Art

[0002] Corn is mainly used as feed (ingredients for pigs, chickens, cows, and sheep) to produce meat, eggs, and milk. However, the protein content in corn kernels is only about 8%, and soybean meal needs to be added to the feed to supplement protein. Therefore, increasing the protein content of corn can alleviate the shortage of feed protein and reduce the feed cost. However, there are not many molecular markers available for increasing the protein content of corn.

[0003] The protein content of corn is a complex trait controlled by multiple genes. The protein content is negatively correlated with grain yield, and no directional selection has been carried out on the protein content during modern breeding with yield as the main goal. By measuring the protein content of corn germplasm resources and conducting genome-wide association analysis in combination with genotype data, molecular markers for corn kernel protein can be discovered and identified, which can quickly identify materials with high corn kernel protein content and contribute to the screening of high-protein corn materials and the breeding of new varieties. KASP (Kompetitive Allele Specific PCR) genotyping detection is a fluorescence-based detection marker used to identify single nucleotide polymorphism (SNP) variant sites. It is a new generation of SNP genotyping marker and has been applied to various crops.

[0004] Compared with the fact that the repetitive sequences in the rice genome only account for about 30.68%, up to about 85% of the sequences in the corn genome are complex and highly repetitive sequences. This brings great challenges to the identification of SNP markers related to protein content and the development of KASP markers. On the one hand, due to the existence of repetitive sequences, SNP sites may have multiple homologous copies, which easily leads to false positive association signals, thus increasing the difficulty of screening SNP markers truly related to grain protein content. On the other hand, KASP markers rely on designing specific primers upstream and downstream of SNP sites. However, in repetitive sequence regions, primer binding sites may exist in multiple positions in the genome, thus causing non-specific amplification. Therefore, SNP sites with repetitive flanking sequences must be strictly excluded. However, since the flanking sequences of the vast majority of SNPs are not unique, primer design faces great difficulties. In addition, repetitive sequences will also increase the technical error rate during KASP detection and affect the accuracy and stability of the results. Summary of the Invention

[0005] In view of the deficiencies of the above-mentioned prior art, the present invention aims to provide a KASP molecular marker related to the protein content of maize kernels, a primer set, a kit and an application, which can be used for rapid batch screening of high-protein maize materials and varieties in the field of maize molecular genetics.

[0006] To solve the above problems, the present invention adopts the following technical solutions: In the first aspect, the present invention provides a KASP molecular marker related to the protein content of maize kernels, and the KASP molecular marker is located at SYN21579_Chr7_5211731 on chromosome 7 of the maize B73RefGen_v4 reference genome.

[0007] Furthermore, the base difference of the KASP molecular marker is A / G, which is located on the 9th intron of the gene Zm00001d018787.

[0008] Furthermore, when the KASP molecular marker is A, the protein content of maize kernels is lower, and when the KASP molecular marker is G, the protein content of maize kernels is higher.

[0009] In the second aspect, the present invention provides a primer set for detecting the KASP molecular marker related to the protein content of maize kernels, and the primer set includes a forward primer with the nucleotide sequence shown in SEQ ID NO.1 and SEQ ID NO.2 and a reverse primer with the nucleotide sequence shown in SEQ ID NO.3.

[0010] Furthermore, the forward primer includes a FAM fluorescent linker sequence universal tag and a HEX fluorescent linker sequence universal tag.

[0011] In the third aspect, the present invention provides a kit for detecting the KASP molecular marker related to the protein content of maize kernels, including the primer set.

[0012] In the fourth aspect, the present invention provides a method for detecting the KASP molecular marker related to the protein content of maize kernels, including: using the DNA of the maize to be detected as a template, performing fluorescence quantitative PCR amplification with the primer set or the kit, and judging the gene typing and protein content of maize kernels according to the fluorescence detection result after amplification.

[0013] Furthermore, the amplification program of the fluorescence quantitative PCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 60 s, cycling 10 times, and the annealing and extension temperature is reduced by 0.6°C each time; denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, cycling 30 times; fluorescence quantitative PCR for 60 s at 37°C to collect fluorescence signals.

[0014] Furthermore, the determination of the genotyping and protein content of maize kernels based on the amplified fluorescence detection results includes: if the universal tag FAM fluorescence adapter sequence is detected, the genotype is AA, and the protein content of the kernels of the corresponding maize material is relatively low; if the universal tag HEX fluorescence adapter sequence is detected, the genotype is GG, and the protein content of the kernels of the corresponding maize material is relatively high; if the fluorescence adapter sequences of both the universal tags FAM and HEX are detected, the genotype is AG, and the protein content of the corresponding maize kernels is at an intermediate level.

[0015] Fifthly, the present invention provides the application of the KASP molecular marker, the primer set or the kit as described above, including any one of the following applications: Application in identifying or screening varieties with high protein content in maize kernels; Application in maize molecular marker-assisted breeding; Application in improving maize germplasm resources; Application in detecting and predicting the protein content of maize kernels.

[0016] The beneficial effects of the present invention are as follows: Through genome-wide association analysis, the present invention obtained a polymorphic SNP marker locus related to the protein content trait of maize kernels. The SNP marker locus refers to the position of 5211731 on chromosome 7 of the maize B73 Ref_Gen_V4 genome, with nucleotide polymorphism A / G, and G is the dominant trait.

[0017] The present invention developed a new molecular marker for the protein content of maize kernels. Using the KASP genotyping technology, gene typing can be carried out quickly, the detection is accurate and efficient, the amplification is convenient and stable, and it can be used for molecular marker-assisted selection, which plays a very important role in predicting, identifying or assisting in identifying the protein content or breeding new maize varieties with high protein content. Description of the Drawings

[0018] Figure 1 Results of genome-wide association analysis of the protein content of maize kernels, Manhattan plot and QQ plot based on the BLINK model analysis.

[0019] Figure 2 Box plot of the protein content analysis of maize kernels corresponding to different genotypes at the locus SYN21579_Chr7_5211731 of 273 maize inbred lines.

[0020] Figure 3 Results of KASP genotyping of the protein content of 93 maize materials; where the abscissa FAM fluorescence represents the genotype AA; the ordinate HEX fluorescence represents the genotype GG, and NTC is represented by a gray square. Detailed Embodiments

[0021] The present invention will be further described in detail below in conjunction with specific embodiments.

[0022] It should be noted that these embodiments are only used to illustrate the present invention, rather than limiting the present invention. Any simple improvement of this method under the premise of the concept of the present invention falls within the scope of protection required by the present invention.

[0023] Unless otherwise specified, the technical means used in the embodiments are all conventional methods. The reagents used in the embodiments can be obtained from commercial channels without special instructions.

[0024] Example 1 GWAS Analysis and Haplotype Analysis of Maize Kernel Protein Content 1.1 Field Experiment Design The 273 inbred line populations used in the present invention were introduced from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, with rich genetic backgrounds and wide sources. They were planted in the Sanya Southern Crop Breeding Base of the Jiangsu Academy of Agricultural Sciences in 2015. Each material was planted in a single row plot, 3 meters in length, 0.6 meters in row spacing, 0.25 meters in plant spacing, with two replicates. Field management referred to that of large fields.

[0025] 1.2 Phenotypic Data For the maize kernel protein content selected in the present invention, 5 ears were continuously harvested from the middle of each plot. After each ear was threshed separately, the kernel protein content was measured. The average value of the protein content of the 5 ears was used as the protein content of this replicate of the material, and the two replicates were used as the protein content of the material.

[0026] 1.3 GWAS Analysis and Determination of SNP Loci Using the genotype data of 273 inbred line materials with Illumina MaizeSNP50 BeadChip, combined with the phenotypic values of the maize kernel protein content measured above, the BLINK model of the R package GAPIT3 was used for GWAS analysis. The threshold was corrected by Bonfereoni, and -LOG10(P-value) = 6 was used as the threshold to determine significantly associated SNPs. The results obtained a significant locus SYN21579_Chr7_5211731 on chromosome 7 (see the specific results in Figure 1 ). This locus was significantly correlated with the kernel protein content of maize. Its nucleotide showed A / G, its -LOG10(P-value) value was 8.3, the phenotypic variation explained was 16.65%, and the minor allele genotype frequency was 0.4396. The information of this SNP is shown in Table 1. Table 1 Information of SNP Loci Significantly Correlated with Maize Kernel Protein Content

[0027] 1.4 Haplotype analysis Haplotype analysis combining SNP variant sites with the grain protein content of 273 tested maize materials ( Figure 2 ). Among them, the SNP site variant typing was divided into two categories. The specific combined bases were the difference between A / G. There were 153 materials with the genotype GG, and the average grain protein content was 12.54%. There were 120 materials with the genotype AA, and the average grain protein content was 11.95%. The difference analysis between the two haplotypes and the maize grain protein content was 2.45E-5, reaching a highly significant difference (P < 0.01). The protein content of the GG genotype was extremely significantly higher than that of the AA genotype maize materials.

[0028] Example 2 Development and application of KASP molecular markers related to maize grain protein content 2.1 Test materials Ninety-three materials with different grain protein contents were screened, and the developed KASP molecular markers were used for accuracy verification. At the same time, two of each of the AA and GG genotypes were selected for sequencing verification. The sequencing results of the SNP sites were consistent with the KASP detection results, and there were extremely significant differences in the protein contents of the AA and GG genotypes at the SNP sites.

[0029] 2.2 Development of KASP markers According to the above SNP site information, there was an SNP variation at position 5211731 on chromosome 7 of the reference genome B73 Ref_Gen_v4, and the polymorphism was A / G. The 100 bp flanking sequences before and after this site were extracted and primers were designed. This KASP marker consisted of three primers. Among them, there were 2 specific forward primers SEQ ID NO.1 and SEQ ID NO.2, and 1 common reverse primer SEQ ID NO.3. The primers were commissioned to be synthesized by Sangon Biotech (Shanghai). The primer sequences are as follows: SYN21579_Chr7_5211731_F(SEQ ID NO.1): 5’-GAAGGTGACCAAGTTCATGCTACTCACACTGGATCCAAGAATTAGTA-3’; SYN21579_Chr7_5211731_H(SEQ ID NO.2): 5’-GAAGGTCGGAGTCAACGGATTACTCACACTGGATCCAAGAATTAGTG-3’; SYN21579_Chr7_5211731_R(SEQ ID NO.3): TCTGTTATTGCGTCCCCTTCAATA; Among them, GAAGGTGACCAAGTTCATGCT is the universal tag of the FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT is the universal tag of the HEX fluorescent linker sequence.

[0030] 2.3 DNA Extraction Using 93 corn leaves as materials, DNA was extracted by the CATB method. The detailed steps are as follows: (1) Take about 5 g of leaves, place them in a 2-ml centrifuge tube, add 2 sterilized steel beads, quickly freeze them in liquid nitrogen and then put them into an automatic sample grinder, and shake for 30 s; (2) Add 800 μL of heated CTAB buffer (mercaptoethanol has been added), stir gently and mix well; (3) Place it in a water bath at 65 °C, invert the sample and mix it once every 10 min, and take it out after 30 min; (4) After taking it out and waiting for the sample to cool to room temperature, add 800 μL of chloroform:isoamyl alcohol (24:1), shake well and centrifuge at 12000 rpm for 15 min; (5) Pipette the supernatant into a 2-ml centrifuge tube, add 600 μl of isopropanol, mix well, place it at -20 °C for 20 min, centrifuge at 4 °C and 12000 rpm for 15 min; (6) Add 800 μl of 70% ethanol to suspend the precipitate; centrifuge at room temperature at 12000 rpm for 10 min; (7) Discard the supernatant, add 1 ml of absolute ethanol to suspend the precipitate; centrifuge at 12000 rpm for 10 min, open the lid at room temperature, wait for the residual ethanol to volatilize, and add 50 μL of ddH2O to dissolve the DNA; (8) Detect by agarose power supply, detect the integrity of DNA with 1% agarose gel (60V power supply for 35 min), and measure the concentration of all DNA samples with NanoDrop and evaluate to determine that the OD value 260 / 280 ratio is between 1.8 and 2.0.

[0031] 2.4 KASP Genotyping Dilute the DNA concentration of the samples to be tested to 30 ng / μl on average and perform KASP analysis. KASP molecular marker PCR amplification reaction system: 5 μL of KASP 2X PCR mix, 0.5 μL of primer premix (mix the primers SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 with a concentration of 10 μM in a volume ratio of 2:2:5), 4.5 μL of template DNA, and the total reaction volume is 10 μL; The PCR amplification procedure was as follows: pre-denaturation at 95°C for 10 min; the first-step amplification reaction, denaturation at 95°C for 15 s, annealing and extension at 61°C for 60 s, with 10 cycles, and the annealing and extension temperature decreased by 0.6°C each time; the second-step amplification reaction, denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, with 30 cycles.

[0032] After the reaction, the PCR product was obtained. Fluorescence collection was carried out at 37°C using a QuantStudioTM Design Analysis Software v1.5.2 real-time quantitative PCR instrument, and the PCR product was genotyped. The genotyping results were compared with the sequencing results of SYN21579_Chr7_5211731 for variation. It was found that the locus variation detected by the KASP molecular marker was consistent with the sequencing result variation, indicating that the KASP marker for this SNP locus was successfully developed ( Figure 3 ).

[0033] According to the color classification shown by the fluorescence quantitative PCR instrument, the samples aggregated close to the X-axis were FAM fluorescent tag sequences linked to the AA genotype, showing red circles; the samples aggregated close to the Y-axis were HEX fluorescent tag sequences linked to the GG genotype, showing yellow circles, and the control NTX was represented by gray squares.

[0034] The actual situation was consistent with the expectation. Therefore, the KASP molecular marker of the present invention can effectively identify the grain protein content of maize and can be used for the prediction and screening of the grain protein content of maize.

[0035] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described by referring to the preferred embodiments of the present invention, those of ordinary skill in the art should understand that various changes can be made in form and details without departing from the spirit and scope of the present invention defined by the appended claims.

Claims

1. A primer set for KASP molecular markers related to detecting the protein content of corn kernels, characterized in that, The primer set includes a forward primer with the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and a reverse primer with the nucleotide sequence shown in SEQ ID NO.3; the KASP molecular marker is located at SYN21579_Chr7_5211731 on chromosome 7 of the maize B73RefGen_v4 reference genome.

2. The primer set according to claim 1, wherein The base difference of the KASP molecular marker is A / G, which is located in the 9th intron of the gene Zm00001d018787.

3. The primer set according to claim 2, characterized in that, Maize kernels with the KASP molecular marker being A have a lower protein content, while maize kernels with the KASP molecular marker being G have a higher protein content.

4. The primer set according to claim 3, characterized in that The forward primer includes a FAM fluorescence adapter sequence universal tag and a HEX fluorescence adapter sequence universal tag.

5. A kit for detecting KASP molecular markers related to the protein content of corn kernels, characterized in that, It includes the primer set according to any one of claims 1-4.

6. A method for detecting KASP molecular markers related to the protein content of maize kernels, characterized in that, It includes: Using the maize DNA to be detected as a template, performing fluorescence quantitative PCR amplification with the primer set according to any one of claims 1-4 or the kit according to claim 5, and judging the genotype and protein content of maize kernels based on the fluorescence detection results after amplification.

7. The method according to claim 6, wherein The amplification program of the fluorescence quantitative PCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 60 s, cycling 10 times, with the annealing and extension temperature decreasing by 0.6°C each time; denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, cycling 30 times; fluorescence quantitative PCR for 60 s at 37°C to collect fluorescence signals.

8. The method according to claim 7, wherein Judging the genotype and protein content of maize kernels based on the fluorescence detection results after amplification includes: if the FAM fluorescence adapter sequence of the universal tag is detected, the genotype is AA, and the protein content of the corresponding maize material kernels is lower; if the HEX fluorescence adapter sequence of the universal tag is detected, the genotype is GG, and the protein content of the corresponding maize material kernels is higher; if the fluorescence adapter sequences of both the FAM and HEX universal tags are detected, the genotype is AG, and the protein content of the corresponding maize kernels is at an intermediate level.

9. Use of the primer set according to any one of claims 1 to 4 or the kit according to claim 5, characterized in that It includes any one of the following applications: Application in identifying or screening varieties with high maize kernel protein content; Application in maize molecular marker-assisted breeding; Application in improving maize germplasm resources; Application in detecting and predicting maize kernel protein content.

Citation Information

Patent Citations

  • Molecular marker primer group for detecting protein content of wheat grains and application of molecular marker primer group

    CN115029472A

  • SNP (Single Nucleotide Polymorphism) molecular marker combination related to corn kernel traits and application thereof

    CN119193901A