Enterovirus 71 type nucleic acid colloidal gold detection system based on NISDA isothermal amplification and vacuum cup

Abstract

The invention provides an enterovirus 71 type nucleic acid colloidal gold detection system based on NISDA isothermal amplification and a vacuum cup, and belongs to the technical field of biological detection. The non-enzymatic isothermal strand displacement amplification (NISDA) technology is combined with colloidal gold detection, the dependence of traditional nucleic acid detection on DNA polymerase, helicase and other expensive enzyme preparations is thoroughly abandoned, meanwhile, complex instruments are not needed, isothermal amplification can be achieved only through a vacuum cup, and the detection cost and the operation threshold are remarkably reduced. The amplified product colloidal gold test strip can rapidly complete visual interpretation, and the sensitivity and the specificity both meet clinical requirements. The technology is especially suitable for resource-deficient areas, basic medical institutions and on-site rapid screening scenes, provides an efficient and economic solution for solving the problem of early diagnosis of enterovirus 71 (EV71) globally, and has important public health significance for suppressing hand-foot-and-mouth disease epidemic situation diffusion and reducing severe risks.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly to a colloidal gold detection system for Enterovirus 71 nucleic acid based on NISDA isothermal amplification and a thermos cup. Background Art

[0002] Enterovirus 71 (EV71) is one of the main pathogens causing Hand, Foot and Mouth Disease (HFMD). Its infection mostly occurs in children under 5 years old, and the clinical manifestations are fever, oral ulcers and limb herpes. Although most cases are mild, some patients may develop into severe cases, causing encephalitis, acute flaccid paralysis and even pulmonary edema, and the fatality rate can reach 10%-25%. Therefore, rapid and accurate EV71 detection technology is crucial for early diagnosis, isolation treatment and epidemic control.

[0003] Currently, the laboratory diagnosis of EV71 mainly relies on molecular biology and immunology methods: Reverse Transcription Polymerase Chain Reaction (RT-PCR): Detection is achieved by amplifying specific fragments of viral RNA. It has high sensitivity, but it requires a thermal cycler for temperature control (such as denaturation at 94°C and annealing at 60°C), with complex operation and expensive equipment, making it difficult to promote at the grass-roots level. Real-time Fluorescent Quantitative PCR (qPCR): It can quantitatively detect the viral load, but it requires fluorescent probes and precision optical instruments, further increasing the detection cost. Colloidal gold immunochromatography: A rapid detection technology based on antigen-antibody reactions. Although it is easy to operate, it relies on the efficient expression and purification of viral proteins and has low sensitivity (especially in the early stage of infection).

[0004] In addition, the above methods generally have the following bottlenecks:

[0005] Enzyme dependence: The PCR technology requires a high-temperature-resistant DNA polymerase (such as Taq enzyme), which has strict storage conditions (-20°C), high price, and fluctuations in the global supply chain may affect the popularization of detection.

[0006] Strong equipment dependence: Large instruments limit the flexibility of detection scenarios, and it is difficult to implement in remote areas or at the scene of sudden epidemics.

[0007] Time-consuming: RT-PCR usually takes 2-3 hours, and it takes even longer if the RNA extraction step is included, delaying the timely intervention of severe cases.

[0008] With the development of molecular diagnostic techniques, isothermal amplification techniques (such as LAMP, RPA) have attracted attention due to their characteristic of not requiring thermal cycling. However, they still rely on enzymes such as Bst DNA polymerase and have not completely solved the problems of cost and stability. Although colloidal gold technology has the advantages of rapidity and portability, its sensitivity is insufficient when used alone, making it difficult to meet the detection requirements of samples with low virus loads. Therefore, there is an urgent need for a detection scheme that does not require enzymes, has simple equipment, and combines sensitivity and speed to break through the bottlenecks of existing technologies and particularly adapt to the public health needs in resource-limited areas. Summary of the Invention

[0009] The object of the present invention is to provide a colloidal gold detection system for enterovirus 71 nucleic acid based on NISDA isothermal amplification and a thermos cup, constructing an EV71 detection system with low cost, enzyme-free throughout the process, and simplified equipment, providing a revolutionary tool for the prevention and control of hand, foot, and mouth disease.

[0010] To achieve the above object of the invention, the present invention provides the following technical solutions:

[0011] The present invention provides an enzyme-free isothermal strand displacement amplification detection method, comprising the following steps:

[0012] Specific primers are annealed to form double-stranded DNA fragments as initiators;

[0013] Circular probes labeled with different tags, initiators, and templates are mixed as a detection system. After isothermal reaction, it is dropped onto a colloidal gold detection test strip, and the antibodies in the colloidal gold detection test strip can bind to the probe tags to achieve the color development of the detection signal.

[0014] The present invention also provides a primer-probe set for detecting enterovirus 71, comprising the following primers and probes:

[0015] Primer A1 with the nucleotide sequence shown in SEQ ID NO.1;

[0016] Primer A2 with the nucleotide sequence shown in SEQ ID NO.2;

[0017] Probe P1 with the nucleotide sequence shown in SEQ ID NO.3

[0018] Probe P2 with the nucleotide sequence shown in SEQ ID NO.4.

[0019] Preferably, the probe P1 and the probe P2 are labeled with different tags, and the labeling can be at the 5' end or the 3' end.

[0020] Preferably, the tags include biotin, digoxin, or fluorescent groups.

[0021] Preferably, the fluorescent group is selected from FAM, Cy3, Cy5, Cy5.5, ROX, Texas Red, HEX, TET, JOE, FITC, Alexa Fluor series or DAPI.

[0022] The present invention also provides the application of the above-mentioned enterovirus 71 detection primer-probe set in the preparation of a kit for detecting or identifying enterovirus 71.

[0023] The present invention also provides a kit, comprising the above-mentioned enterovirus 71 detection primer-probe set and a colloidal gold immunochromatographic test strip.

[0024] Preferably, in the kit, the final concentration of the probe P1 or the probe P2 is independently selected from 20-100 ng / μL.

[0025] The present invention also provides a method for detecting enterovirus 71 for non-diagnostic purposes, comprising the following steps:

[0026] Extract the RNA in the sample to be tested as a template;

[0027] Use the above-mentioned enterovirus 71 detection primer-probe set to participate in the reaction, anneal the primer A1 and the primer A2 therein, and use the obtained double-stranded DNA fragment as an initiator, which is purified and then used to initiate the NISDA amplification reaction;

[0028] Cyclize the probe P1 and the probe P2, and then mix them with the initiator and the template to obtain a reaction system;

[0029] Transfer the reaction system into a portable heat-insulating container, put the reaction system in, add water at 40-44 °C, carry out the reaction, and use a colloidal gold immunochromatographic test strip to interpret the amplification result:

[0030] If both the quality control line and the test line are positive, the test sample contains enterovirus 71;

[0031] If the quality control line is positive and the test line is negative, the test sample does not contain enterovirus 71.

[0032] Preferably, the portable heat-insulating container is a thermos cup;

[0033] The water at 40-44 °C is obtained through the following steps: heat the water with a heating pack to obtain water at 50-100 °C, and mix it with cold water to adjust the temperature to 40-44 °C;

[0034] During the reaction process, the ambient temperature of the portable heat-insulating container is 10-30 °C.

[0035] The beneficial effects of the present invention:

[0036] By combining non - enzymatic isothermal strand displacement amplification (NISDA) technology with colloidal gold detection, the present invention completely abandons the dependence on expensive enzyme preparations such as DNA polymerase and helicase in traditional nucleic acid detection. At the same time, it does not require complex instruments and only needs a thermos cup to achieve constant - temperature amplification, significantly reducing the detection cost and operation threshold. The amplified product can be quickly visually interpreted by binding to a colloidal gold test strip, and both the sensitivity and specificity meet the clinical requirements. This technology is particularly suitable for resource - poor areas, primary medical institutions and on - site rapid screening scenarios, providing an efficient and economical solution to the problem of early diagnosis of enterovirus 71 (EV71) globally, and has important public health significance for curbing the spread of hand, foot and mouth disease and reducing the risk of severe cases. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is a detection result diagram of the present invention;

[0038] Figure 2 It is a constant - temperature control appliance adopted by the present invention;

[0039] Figure 3 It is a specific characterization result of the detection method of the present invention;

[0040] Figure 4 It is a sensitivity characterization result of the detection method of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0041] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0042] Example 1

[0043] This example provides the following primers and probes:

[0044] Primer A1: 5'CAGGTGAGCAGTCATCGACTGG 3', as shown in SEQ ID NO.1;

[0045] Primer A2: 5'CCAGTCGATGACTGCTCACCTGTGTGTTCT 3', as shown in SEQ ID NO.2;

[0046] Primer - probe P1: 5'CAGGTGAGCAGTCATAATGAGGACCAGTCGATGA CTGCTCACCTG 3', as shown in SEQID NO.3, with a biotin label modified at the 5' end;

[0047] Primer-probe P2: 5'AATGAGGACCAGTCGCAGGTGAGCAGTCATCGACTGGTCCTCATTATGACTGC3', as shown in SEQ ID NO.4, with a digoxigenin label modified at the 5' end.

[0048] Synthesis and purification of the initiator: The A1 primer (100 μM) and the A2 primer (100 μM) were annealed as a 1:1 mixture at 95 °C for 5 min and then gradually cooled to room temperature for 45 min. The resulting double-stranded DNA fragment was used as the initiator, which was purified and then used to initiate the NISDA amplification reaction. PAGE purification was performed using a high gel concentration (10% acrylamide). The initiator fragment was cut out under ultraviolet irradiation, then frozen overnight at -80 °C and crushed and soaked in nuclease-free water. It was incubated overnight at 37 °C and 500×g, and purified using an acrylamide gel (controlling the temperature below 37 °C).

[0049] Cyclization of probes P1 and P2: By annealing at 95 °C for 5 minutes and then gradually cooling to room temperature for 45 min.

[0050] 5 μl of the extracted RNA template was added to a 25 μl mixture consisting of probe P1 (10 μL; 25 ng / μL), probe P2 (10 μL; 80 ng / μL), and the initiator (5 μL; 300 ng / μL);

[0051] Put a food-specific heating pack in the thermos (as shown in the utensils) Figure 2 and pour in water. After the water temperature reaches 60 °C, take out the heating pack, adjust the water temperature to 42 °C with cold water, put in the detection system, and react for 30 minutes (room temperature 20 °C).

[0052] After the reaction, 20 μL of the reaction mixture was added to a centrifuge tube containing 150 μL of loading buffer, shaken well, and dropped into the detection sampling hole of the colloidal gold test strip (coating the digoxigenin antibody on the T line detection line and the biotin antibody on the gold-labeled particles using conventional methods in the art). Wait for 5 min and observe the quality control line and the detection line.

[0053] Interpret the results. If the quality control line is positive and the detection line is negative, the test sample is negative for enterovirus 71;

[0054] If the quality control line is positive and the detection lines are all positive, the test sample is positive for enterovirus 71;

[0055] If the quality control line is negative, the test result is not credible.

[0056] The detection method provided by the present invention was used to test 9 groups of samples (the RNA virus samples were from the Sixth People's Hospital of Hangzhou, and from left to right were Enterovirus 71 (EV71) virus, EV71 virus, EV71 virus, EV71 virus, EV71 virus, EV71 virus, non-EV71 virus, non-EV71 virus, non-EV71 virus), and the results are as Figure 1 shown.

[0057] The detection method provided by the present invention was used to test measles virus, rubella virus, Coxsackievirus 16, Rotavirus group B, Norovirus, and Sapovirus (shown from left to right in the figure), and the results are as Figure 3 shown. The results were all negative, indicating that the detection method of the present invention has high specificity and no cross-reaction occurred in the detection of six common pathogens such as measles virus and rubella virus, which confirmed the selective recognition ability of the detection system for the target virus and can effectively avoid false positive interference caused by similar pathogens in clinical samples.

[0058] The detection method provided by the present invention was used to detect the nucleic acid sensitivity of EV71 virus, and the detection concentrations were 10 copies / μL, 20 copies / μL, 50 copies / μL, 10^2 copies / μL, 10^3 copies / μL, 10^4 copies / μL, negative control, negative control (shown from left to right in the figure), and the results are as Figure 4 shown. All were positive except for the negative controls, indicating that the detection method of the present invention has excellent detection sensitivity, its lowest detection limit can reach 10 copies / μL, and it shows good detection ability in the range of 10 - 10^4 copies / μL. The stable detection performance of this method for EV71 virus nucleic acid indicates that it can meet the accurate detection requirements of trace virus nucleic acid in clinical samples.

[0059] Example 2

[0060] The difference from Example 1 is only that boiling hot water was poured into a thermos, the water temperature was adjusted to 42 °C with cold water, and the mixture was put in and reacted for 30 minutes.

[0061] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. An enzyme-free isothermal strand displacement amplification detection method, characterized in that, It includes the following steps: Specific primers are annealed to form double-stranded DNA fragments as initiators. Circular probes labeled with different tags, initiators, and templates are mixed as a detection system. After isothermal reaction, it is dropped onto a colloidal gold test strip, and the antibody in the colloidal gold test strip can bind to the probe tags to achieve detection signal color development.

2. A primer-probe set for detecting enterovirus 71, characterized in that, It includes the following primers and probes: Primer A1 with the nucleotide sequence shown in SEQ ID NO.1; Primer A2 with the nucleotide sequence shown in SEQ ID NO.2; Probe P1 with the nucleotide sequence shown in SEQ ID NO.3 Probe P2 with the nucleotide sequence shown in SEQ ID NO.

4.

3. The primer-probe set according to claim 2, wherein The probe P1 and probe P2 are labeled with different tags.

4. The primer-probe set according to claim 3, wherein The tags include biotin, digoxin, or fluorescent groups.

5. The primer-probe set according to claim 4, characterized in that, The fluorescent groups are selected from FAM, Cy3, Cy5, Cy5.5, ROX, Texas Red, HEX, TET, JOE, FITC, Alexa Fluor series, or DAPI.

6. Use of the enterovirus 71 detection primer-probe set according to any one of claims 2 to 5 in the preparation of a kit for the detection or identification of enterovirus 71.

7. A kit, characterized in that, It includes the enterovirus 71 detection primer-probe set according to any one of claims 2 to 5 and a colloidal gold immunochromatographic test strip.

8. The kit according to claim 7, characterized in that, In the kit, the final concentration of the probe P1 or probe P2 is independently selected from 20 to 100 ng / μL.

9. A method for detecting enterovirus 71 for non-diagnostic purposes, characterized in that, It includes the following steps: RNA in the test sample is extracted as a template. The enterovirus 71 detection primer-probe set according to claim 2 is used in the reaction. Primer A1 and primer A2 are annealed, and the obtained double-stranded DNA fragment is used as an initiator. After purification, it is used to initiate the NISDA amplification reaction. The probes P1 and P2 are circularized, and then mixed with the initiator and template to obtain a reaction system. The reaction system is transferred to a portable insulation container, the reaction system is placed in it, water at 40 - 44 °C is added, and the reaction is carried out. The amplification result is judged using a colloidal gold immunochromatographic test strip: If both the quality control line and the test line are positive, the test sample contains enterovirus 71. If the quality control line is positive and the test line is negative, the test sample does not contain enterovirus 71.

10. The enterovirus 71 detection method for non-diagnostic purposes according to claim 9, characterized in that, The portable insulation container is a thermos cup. The water at 40 - 44 °C is obtained through the following steps: The water is heated using a heating pack to obtain water at 50 - 100 °C, and then mixed with cold water to adjust the temperature to 40 - 44 °C. During the reaction process, the ambient temperature of the portable insulation container is 10 - 30 °C.

Images