Inhibitory nucleic acids and methods of use thereof

Abstract

The present disclosure provides inhibitory nucleic acids, compositions comprising the inhibitory nucleic acids, and methods of using the inhibitory nucleic acids to treat various diseases.

Description

[0001] Cross-referencing

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 427,254, filed November 22, 2022, the entire contents of which are incorporated herein by reference.

[0003] Statement on Federally Funded Research

[0004] This invention was completed with government support under license number DK114277 granted by the National Institutes of Health (NIH). The government holds certain rights to this invention.

[0005] Citations of electronically submitted materials are incorporated

[0006] The sequence list is provided here as a sequence list XML file named "BERK478WO_SEQ_LIST", created on November 10, 2023, and is 11,512 bytes in size. The contents of this sequence list XML file are incorporated herein by reference in their entirety.

[0007] introduction

[0008] Metabolic disorders, such as insulin resistance, hyperglycemia, type 2 diabetes, obesity, fatty liver, glucose intolerance, hyperinsulinemia, metabolic syndrome, and hypertension, are major health problems.

[0009] Overview

[0010] This disclosure provides inhibitory nucleic acids, compositions comprising said inhibitory nucleic acids, and methods of using said inhibitory nucleic acids to treat various diseases. Brief description of the attached diagram

[0012] Figures 1A-1B provide the nucleotide sequences of exemplary antisense oligonucleotides (ASOs) (Figure 1A; the nucleotide sequences of NRC0090, NRC0091, and NRC0119 are SEQ ID NOs: 1, 2, and 3, respectively) and the base pairing positions of these ASOs within the target microRNA (miR-128-3p). Figure 1B ;SEQ ID NO: 7).

[0013] Figure 2 The effects of dystrophin loss in Duchenne muscular dystrophy (DMD) are illustrated schematically.

[0014] Figures 3A-3H The in vivo effects of locked nucleic acid (LNA) antisense oligonucleotides (ASOs) targeting miR-128-3p are described.

[0015] Figure 4A-4IThe effects of LNA ASO targeting miR-128-3p on miR-128-3p levels in different tissues in vivo were depicted.

[0016] Figures 5A-5F The effects of LNA ASO targeting miR-128-3p on weight, body mass, and blood glucose levels were depicted.

[0017] Figures 6A-6D We depicted elevated circulating mature miR-128(3p) in mouse and canine models of DMD and the genetic linkage between miR-128-1 and weak grip strength and weak lungs.

[0018] Figures 7A-7E Depicting MDX 5cv Systemic or muscle-specific miR-128-3p knockout response in mice.

[0019] Figures 8A-8C Depicting MDX 5cv In vivo ASO dose response in mice.

[0020] Figure 9A-9N The study described the effects of miR-128-1LNA ASO (“anti-miR-128-1ASO”) on 6-week-old or 9-week-old mdx cells. 5cv The effects of miR-128-1LNA ASO on myofiber size, necrosis, and fibrosis were investigated in a DMD mouse model.

[0021] Figures 10A-10F The effects of ASO administration on liver and kidney function indicators were described.

[0022] Figure 11A-11K RNA-seq analyses were performed on WT mice and mdx5cv mice treated with control ASO and anti-miR-128-1ASO, and the effects of miR-128-1LNA ASO on mdx5cv mice were also depicted. 5cv The effects of malnutrition-induced muscle fiber type conversion in mice.

[0023] Figures 12A-12C Metabolic analyses were depicted in WT mice and mdx5cv mice treated with control ASO and anti-miR-128-1ASO.

[0024] Figures 13A-13F The miR-128-1LNA ASO was described for mdx 5cv The impact on mitochondrial health in mice.

[0025] Figures 14A-14E The effects of miR-128-1LNA ASO on inflammation, ferroptosis, and oxidative stress were described.

[0026] Figures 15A-15D The study depicted wild-type (WT) mdx and mdx treated with control ASO or anti-miR-128-1 ASO. 5cv Histology of small intestinal sections from mice.

[0027] Figures 16A-16B Depicting the 6-week-old MDX 5cv Evaluation of miR-128 expression and its downstream targets in mouse myocardium.

[0028] Figure 17A-17L The effects of anti-miR-128-1ASO in a mouse model of myocardial infarction (MI) and preclinical DMD were described. Y / - Its role in the pig model.

[0029] Figures 18A-18C The effects of anti-miR-128-1ASO on fibrosis in a mouse model of MI were described.

[0030] definition

[0031] The term "antisense oligonucleotide" as used in this article refers to a nucleic acid sequence that is complementary to a DNA or RNA sequence (e.g., a microRNA sequence).

[0032] “RNA” refers to a molecule containing at least one or more ribonucleotide residues. “Ribonucleotide” refers to a nucleotide having a hydroxyl group at the 2' position of the β-D-furanose moiety. As used herein, the term “RNA” includes double-stranded RNA, single-stranded RNA, isolated RNA (e.g., partially purified RNA), substantially pure RNA, synthetic RNA, recombinant RNA, and altered RNA that differs from naturally occurring RNA through the addition, deletion, substitution, and / or modification of one or more nucleotides. The nucleotides in an RNA molecule may also contain non-standard nucleotides, such as non-naturally occurring nucleotides, chemically synthesized nucleotides, or deoxynucleotides.

[0033] MicroRNAs (miRNAs) are single-stranded RNA molecules approximately 21-23 nt in length. Typically, miRNAs regulate gene expression. miRNAs are encoded by genes transcribed from their DNA, but they are not translated into proteins. Each primary miRNA transcript is processed into a short stem-loop structure before further processing into a functional miRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules, and their primary function is to downregulate gene expression.

[0034] As used in this article, “interfering RNA” refers to any double-stranded or single-stranded RNA sequence that can directly or indirectly (i.e., post-transformation) suppress or downregulate gene expression by mediating RNA interference. Interfering RNA includes, but is not limited to, nail interfering RNA (“siRNA”) and hairpin RNA (“shRNA”). “RNA interference” refers to the selective degradation of sequence-compatible messenger RNA transcripts.

[0035] The term "shRNA" as used in this article refers to an RNA molecule containing an antisense region, a loop portion, and a sense region, wherein the sense region has complementary nucleotides that pair with the bases in the antisense region to form a double-stranded stem. After post-transcriptional processing, shRNA is converted into small interfering RNA via a cleavage event mediated by Dicer enzymes, members of the ribonuclease III family.

[0036] As used in this article, “small interfering RNA” or “siRNA” refers to any small RNA molecule that can suppress or downregulate gene expression by mediating RNA interference in a sequence-specific manner. For example, small RNAs can be approximately 18 to 21 nucleotides in length.

[0037] The term "antagomir" as used in this article refers to a small synthetic RNA that is complementary to a specific microRNA target, and that has a mismatch at the cleavage site or has one or more base modifications to inhibit cleavage.

[0038] The phrase “post-transcriptional processing” as used in this article refers to mRNA processing that occurs after transcription, such as that mediated by the Dicer and / or Drosha enzymes.

[0039] "Effective dose" refers to the amount of a desired agent (e.g., the inhibitory nucleic acid of this disclosure) or a composition containing said agent (e.g., a composition containing the inhibitory nucleic acid of this disclosure) that improves disease symptoms relative to an untreated patient. The effective dose of an agent or composition used to implement therapeutic treatment for a disease or condition depends on the method of administration, the subject's age, weight, and overall health. Ultimately, the attending physician or veterinarian will determine the appropriate dosage and administration regimen. Such a dose is referred to as the "effective dose."

[0040] As used in this article, “cholesterol homeostasis” refers to the regulation of cholesterol absorption, cholesterol biosynthesis, cholesterol conversion to bile acids, and bile acid excretion—processes that occur in subjects with healthy levels of LDL, HDL, and cholesterol in their blood (e.g., such healthy levels are also referred to as “reference standards” in this article). Therefore, subjects requiring cholesterol homeostasis need improved regulation to restore LDL, HDL, and / or cholesterol in their blood to healthy levels.

[0041] The terms "diabetes" and "diabetic" refer to a progressive disease of carbohydrate metabolism involving insufficient insulin production or utilization, typically characterized by hyperglycemia and glycosuria. The terms "prediabetes" and "prediabetic" refer to a condition in which a subject does not possess the characteristics, symptoms, etc., usually observed in diabetes, but does have characteristics, symptoms, etc., that could potentially develop into diabetes if left untreated. The presence of these conditions can be determined, for example, by a fasting plasma glucose (FPG) test or an oral glucose tolerance test (OGTT). Both tests typically require the subject to fast for at least 8 hours before starting the test. In an FPG test, the subject's blood glucose is measured after fasting; typically, the subject fasts overnight and blood glucose is measured in the morning before the subject eats. FPG concentrations in healthy subjects are typically between approximately 90 and 100 mg / dL, in prediabetic subjects are typically between approximately 100 and 125 mg / dL, and in diabetic subjects are typically above approximately 126 mg / dL. In an OGTT, blood glucose is measured after fasting and again two hours after drinking a glucose-rich beverage. Two hours after consuming a glucose-rich beverage, blood glucose concentrations in healthy subjects were typically below approximately 140 mg / dL, in prediabetic subjects between approximately 140 and 199 mg / dL, and in diabetic subjects at approximately 200 mg / dL or higher. These blood glucose values ​​apply to human subjects; however, the scales for normal, moderately hyperglycemic, and significantly hyperglycemic blood glucose differ in mouse subjects. In healthy mice, FPG concentrations after a four-hour fast were typically between approximately 100 and 150 mg / dL; in prediabetic mice, FPG concentrations were typically between approximately 175 and 250 mg / dL; and in diabetic mice, FPG concentrations were typically above approximately 250 mg / dL.

[0042] As used in this article, "insulin resistance" refers to a condition in which normal amounts of insulin fail to produce a normal physiological or molecular response. In some cases, supraphysiological amounts of insulin (whether endogenously produced or exogenously administered) can overcome insulin resistance in whole or in part and produce a biological response.

[0043] The term "metabolic syndrome" refers to a group of associated characteristics, including but not limited to hyperinsulinemia, impaired glucose tolerance, obesity, redistribution of fat to the abdomen or upper body, hypertension, fibrinolytic disorders, and dyslipidemia characterized by high triglycerides, low high-density lipoprotein (HDL) cholesterol, and high levels of small, dense low-density lipoprotein (LDL) particles. Subjects with metabolic syndrome are at risk of developing type 2 diabetes and / or other conditions, such as atherosclerosis.

[0044] The term "glucose metabolism disorder" encompasses any condition characterized by clinical symptoms or combinations of clinical symptoms associated with elevated glucose and / or insulin levels in a subject relative to a healthy individual. Elevated glucose and / or insulin levels may manifest in diseases, conditions, and illnesses such as hyperglycemia, type 2 diabetes, gestational diabetes, type 1 diabetes, insulin resistance, impaired glucose tolerance, hyperinsulinemia, impaired glucose metabolism, prediabetes, other metabolic disorders (e.g., metabolic syndrome, also known as syndrome X), and obesity. The peptides and compositions thereof disclosed herein can be used, for example, to achieve and / or maintain glucose homeostasis, to, for example, reduce blood glucose levels and / or reduce insulin levels to those of a healthy subject.

[0045] As used herein, the term "hyperglycemia" refers to a condition in which the amount of circulating glucose in a subject's plasma is elevated relative to that of a healthy individual. Hyperglycemia can be diagnosed using methods known in the art, including the fasting blood glucose level measurements described herein.

[0046] As used in this article, "hyperinsulinemia" refers to a condition in which circulating insulin levels are elevated even when blood glucose levels are elevated or normal. Hyperinsulinemia can be caused by insulin resistance, which is associated with dyslipidemia, such as high triglycerides, high cholesterol, high low-density lipoprotein (LDL) and low high-density lipoprotein (HDL); high uric acid levels; polycystic ovary syndrome; type 2 diabetes; and obesity. Hyperinsulinemia can be diagnosed as having plasma insulin levels higher than approximately 2 μU / mL.

[0047] The phrase "weight imbalance" as used in this article refers to a condition associated with being overweight and / or having an increased appetite. Various parameters can be used to determine whether a subject is overweight compared to a healthy reference individual, including the subject's age, height, sex, and health status. For example, a subject's body mass index (BMI) can be used to determine whether they are overweight or obese. BMI is calculated by dividing the subject's weight (in kilograms) by the square of their height (in meters). A BMI of approximately 18.5 kg / m² is considered normal. 2 Approximately 24.9 kg / m 2 Adults within this range are considered to have normal weight; a BMI of approximately 25 kg / m² is considered normal. 2 Approximately 29.9 kg / m 2 Adults in this age range may be considered overweight (pre-obese); BMI is approximately 30 kg / m². 2 An appetite higher than normal may be considered obese. Increased appetite often leads to being overweight. Several conditions are associated with increased appetite, including, for example, nocturnal eating syndrome, characterized by loss of appetite in the morning and increased appetite in the evening, often accompanied by insomnia, but may also be related to hypothalamic damage.

[0048] As used herein, the terms “treatment,” “cure,” and similar terms refer to achieving the desired pharmacological and / or physiological effect. This effect may be preventative, i.e., complete or partial prevention of the disease or its symptoms, and / or therapeutic, i.e., partial or complete cure of the disease and / or adverse reactions caused by the disease. As used herein, “treatment” encompasses any treatment of a disease in mammals (e.g., humans), including: (a) preventing the occurrence of the disease in subjects who may be susceptible to the disease but have not yet been diagnosed; (b) suppressing the disease, i.e., halting its development; and (c) alleviating the disease, even if the disease subsides.

[0049] The terms “individual,” “subject,” “host,” and “patient” are used interchangeably in this document to refer to an individual organism, such as mammals, including but not limited to rodents, apes, humans, non-human primates, ungulates, felines, canines, bovines, sheep, farm mammals, locomotor mammals, and pet mammals. In some cases, “individual” refers to a human being.

[0050] Before further describing the invention, it should be understood that the invention is not limited to the specific embodiments described, as these embodiments can, of course, vary. It should also be understood that the terminology used herein is for describing specific embodiments only and is not intended to limit the invention, as the scope of the invention is limited only by the appended claims.

[0051] When numerical ranges are provided, it should be understood that, unless the context explicitly specifies otherwise, every intermediate value (accurate to one-tenth of the lower limit unit) between the upper and lower limits of the range, as well as any other specified value or intermediate value within the range, is covered by the invention. The upper and lower limits of these smaller ranges may be independently included within the smaller range and are also covered by the invention, provided that any explicitly excluded limits within the range are observed. When a range contains one or two limits, the range excluding the included one or two limits is also covered by the invention.

[0052] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may be used to practice or test the invention, only preferred methods and materials are described here. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials associated with the cited publications.

[0053] It must be noted that the singular forms “a,” “an,” “the,” and “the” used herein and in the appended claims include plural references unless the context clearly specifies otherwise. Thus, for example, “an antisense oligonucleotide” includes a plurality of such oligonucleotides, “the nucleic acid modification” includes one or more nucleic acid modifications and their equivalents known to those skilled in the art, and so on. It should also be noted that the drafting of the claims may exclude any optional elements. Therefore, this statement is intended as a prior basis for the use of exclusive terms such as “alone,” “only,” etc., or the use of “negative” restrictions when reciting elements of the claims.

[0054] In the context describing this disclosure (especially in the following claims), the terms “a,” “an,” “the,” “the,” “the,” and similar pronouns shall be construed as encompassing both singular and plural forms, unless otherwise stated herein or the context clearly contradicts it. The terms “comprising,” “having,” “including,” and “containing” shall be construed as open-ended terms (i.e., meaning “including but not limited to”). Unless otherwise stated herein, the enumeration of numerical ranges herein is intended only as a method of abbreviating each individual value within a separately referenced range, and each individual value is incorporated into the specification as if it were separately enumerated herein. For example, if ranges 10-15 are disclosed, then 11, 12, 13, and 14 are also disclosed. Unless otherwise stated herein or the context clearly contradicts it, all methods described herein may be performed in any suitable order. The use of any and all instances or exemplary language (e.g., “for example”) provided herein is intended only to better illustrate embodiments of this disclosure and does not constitute a limitation on the scope of this disclosure, unless otherwise stated. No language in the specification should be construed as indicating that any unstated element is essential to the practice of embodiments of this disclosure.

[0055] As used herein, the quantity-related term “about” indicates that the quantity can vary by 10% from the stated quantity. For example, “about 100” means a quantity of 90-110. When “about” is used in the context of a range, “about” referring to a lower quantity in the range means that the lower quantity includes quantities that are 10% lower than the lower quantity in the range, while “about” referring to a higher quantity in the range means that the higher quantity includes quantities that are 10% higher than the higher quantity in the range. For example, “about 100 to about 1000” means that the range extends from 90 to 1100.

[0056] The term "and / or" as used herein, such as "A and / or B", is intended to include A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" as used herein, such as "A, B and / or C", is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0057] It should be understood that the aspects and implementations of this disclosure described herein include “including the aspects and implementations”, “consisting of the aspects and implementations”, and “substantially consisting of the aspects and implementations”.

[0058] It should be understood that certain features of this disclosure, for clarity, are described in the context of individual embodiments, and may also be provided in combination within a single embodiment. Conversely, features of this disclosure, for brevity, are described in the context of individual embodiments, and may also be provided individually or in any suitable sub-combination. All combinations of embodiments covered by this disclosure are expressly included in this disclosure and disclosed herein as if each combination were disclosed individually and expressly. Furthermore, all sub-combinations of various embodiments and their elements are also expressly included in this disclosure and disclosed herein as if each such sub-combination were disclosed individually and expressly.

[0059] The publications discussed herein are provided only because they were disclosed prior to the filing date of this application. Nothing herein should be construed as an admission that the invention is not entitled to any prior invention prior to such publications. Furthermore, the publication dates provided may differ from the actual publication dates, which may require separate confirmation. Invention Details

[0061] This disclosure provides an inhibitory nucleic acid that reduces miR-128-1 levels in cells, and a composition comprising said inhibitory nucleic acid. This disclosure also provides methods for treating various diseases using the inhibitory nucleic acid of this disclosure.

[0062] Inhibitory nucleic acids

[0063] This disclosure provides repressive nucleic acids that reduce miR-128-1 levels in cells (e.g., cells in an individual). In some cases, the repressive nucleic acid is an antisense oligonucleotide (ASO). This disclosure provides ASOs that reduce miR-128-1 levels in cells (e.g., cells in an individual).

[0064] In some cases, miR-128 contains the nucleotide sequence: tgagctgttg gattcggggc cgtagcactgtctgagaggt ttacatttct cacagtgaac cggtctcttt ttcagctgct tc (SEQ ID NO:5). In some cases, miR-128 contains the nucleotide sequence: ugagcuguug gauucggggc cguagcacug ucugagagguuuacauuucu cacagugaac cggucucuuu uucagcugcu uc (SEQ ID NO:6). In some cases, miR-128 contains the nucleotide sequence: tcacagtgaa ccggtctctt t (SEQ ID NO:10). In some cases, miR-128 contains the nucleotide sequence: ucacagugaa ccggucucuu u (SEQ ID NO:11). In some cases, miR-128 contains the nucleotide sequence: tgtgcagtgg gaaggggggc cgatacactg tacgagagtg agtagcaggt ctcacagtgaaccggtctct ttccctactg tgtc (SEQ ID NO:12). In other cases, miR-128 contains the nucleotide sequence: ugugcagugg gaaggggggc cgauacacug uacgagagug aguagcaggu cucacaguga accgguguguuuggguacug ugcu (SEQ ID NO:13).

[0065] In some cases, the repressive nucleic acid (e.g., ASO) of this disclosure is more effective than repressive nucleic acids containing the nucleotide sequence 5'-TTCACTGTG-3' (e.g., ASO) in reducing miR-128-1 levels in cells. In some cases, the repressive nucleic acid (e.g., ASO) of this disclosure is at least 2-fold, at least 2.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, or at least 40-fold more effective than repressive nucleic acids containing the nucleotide sequence 5'-TTCACTGTG-3' (e.g., ASO). For example, in some cases, the inhibitory nucleic acid (e.g., ASO) of this disclosure reduces the level of miR-128-1 in cells by at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 90%, or more than 90% higher than the level of miR-128-1 reduced by an inhibitory nucleic acid (e.g., ASO) containing the nucleotide sequence 5'-TTCACTGTG-3' when applied in the same amount as the inhibitory nucleic acid (e.g., ASO) of this disclosure. In some cases, when the repressive nucleic acid (e.g., ASO) of this disclosure is administered to an individual in an amount at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 90%, or more than 90% lower than the amount of the repressive nucleic acid (e.g., ASO) containing the nucleotide sequence 5'-TTCACTGTG-3' required to achieve the same reduction in miR-128-1 levels, the repressive nucleic acid (e.g., ASO) of this disclosure reduces the miR-128-1 level in the individual's cells by at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90%.

[0066] In some cases, the repressive nucleic acid (e.g., ASO) of this disclosure is more effective than repressive nucleic acids (e.g., ASO) containing the nucleotide sequence 5'-GGTTCACTGTG-3' (SEQ ID NO: 14) in reducing miR-128-1 levels in cells. In some cases, the repressive nucleic acid (e.g., ASO) of this disclosure is at least 2-fold, at least 2.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, or at least 40-fold more effective than repressive nucleic acids (e.g., ASO) containing the nucleotide sequence 5'-GGTTCACTGTG-3' (SEQ ID NO: 14). For example, in some cases, the inhibitory nucleic acid (e.g., ASO) of this disclosure reduces the level of miR-128-1 in cells by at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 90%, or more than 90% higher than the level of miR-128-1 reduced by an inhibitory nucleic acid (e.g., ASO) containing the nucleotide sequence 5'-GGTTCACTGTG-3' (SEQ ID NO: 14) when applied in the same amount as the inhibitory nucleic acid (e.g., ASO) of this disclosure. In some cases, when the repressive nucleic acid (e.g., ASO) of this disclosure is administered to an individual in an amount at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 90%, or more than 90% lower than the amount required to achieve the same reduction in miR-128-1 levels, the repressive nucleic acid (e.g., ASO) of this disclosure reduces the miR-128-1 level in the individual's cells by at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90%.

[0067] The repressive nucleic acid used in the methods and compositions of the present invention includes antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single-stranded or double-stranded RNA interference (RNAi) compounds (e.g., siRNA compounds), modified base / locked nucleic acids (LNA), antagomir, peptide nucleic acids (PNA), and other oligomeric compounds or oligonucleotide mimics that hybridize with at least a portion of the target nucleic acid (i.e., miR-128) and modulate its function. In some embodiments, the repressive nucleic acid includes antisense RNA, antisense DNA, chimeric antisense oligonucleotides, containing modified linked antisense oligonucleotides, interfering RNA (RNAi), short interfering RNA (siRNA); micro-interfering RNA (miRNA); small transient RNA (stRNA); or short hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNA (saRNA), or combinations thereof. See, for example, WO2010040112. In some cases, the repressive nucleic acid of this disclosure is ASO.

[0068] In some cases, the length of the repressive nucleic acid is 10 to 50, 13 to 50, or 13 to 30 nucleotides. Those skilled in the art will understand that this includes oligonucleotides having an antisense portion of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides (or any length within the range thereof). In some cases, the length of the repressive nucleic acid of this disclosure is 15 nucleotides. In some cases, the length of the repressive nucleic acid of this disclosure is 12 to 30 nucleotides or 13 to 30 nucleotides. Those skilled in the art will understand that this includes repressive nucleic acids of length 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0069] In some cases, repressive nucleic acids are chimeric oligonucleotides comprising two or more chemically distinct regions, each consisting of at least one nucleotide. These oligonucleotides typically include at least one region of a modified nucleotide that imparts one or more beneficial properties (e.g., enhanced nuclease resistance, increased cellular uptake, increased target binding affinity) and serves as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. The chimeric repressive nucleic acids of this disclosure can be formed as complexes of two or more oligonucleotides, modified oligonucleotides, oligonucleotides, and / or oligonucleotide mimics as described above. Such compounds are also referred to in the art as hybrids or gapmers.

[0070] As a non-limiting example, in some cases, a suitable repressive nucleic acid comprises the following nucleotide sequence: 5'-ACCGGTTCACTGTG-3' (SEQ ID NO: 1), and its length is 14 to 20 nucleotides. In some cases, the repressive nucleic acid comprises the following nucleotide sequence: 5'-ACCGGTTCACTGTG-3' (SEQ ID NO: 1), and its length is 14 nucleotides. In some cases, the repressive nucleic acid comprises one or more of the following: i) a locked nucleic acid (LNA); ii) a modified backbone; and iii) 5-methyldeoxycytosine. In some cases, a suitable repressive nucleic acid comprises the nucleotide sequence shown in Figure 1A and named "NRC0090" and all its modifications. The ASO referred to as NRC0090 in Figure 1A is: +A*+C* / iMe-dC / *G*G*+T*+T*+C*A*C*+T*G*+T*+G, where “+” is before LNA; * is before the thiophosphoryl esterified base; and / iMe-dC / represents the internal 5-methyldeoxycytosine.

[0071] As another non-limiting example, in some cases, a suitable repressive nucleic acid comprises the following nucleotide sequence: 5'-GACCGGTTCACTGT-3' (SEQ ID NO: 2), and is 14 to 20 nucleotides in length. In some cases, the repressive nucleic acid comprises the following nucleotide sequence: 5'-GACCGGTTCACTGT-3' (SEQ ID NO: 2), and is 14 nucleotides in length. In some cases, the repressive nucleic acid comprises one or more of the following: i) a locked nucleic acid (LNA); ii) a modified backbone; and iii) 5-methyldeoxycytosine. In some cases, a suitable repressive nucleic acid comprises the nucleotide sequence shown in Figure 1A and named "NRC0091" and all its modifications. In Figure 1A, the ASO term NRC0091 is +G*+A*C* / iMe-dC / *+G*G*T*T*+C*+A*C*+T*+G*+T, where “+” precedes LNA; * precedes the thiophosphate base; and / iMe-dC / indicates the inner 5-methyldeoxycytosine.

[0072] As another non-limiting example, in some cases, a suitable repressive nucleic acid comprises the following nucleotide sequence: 5'-AGACCGGTTCACTGTG-3' (SEQ ID NO: 3) and is 14 to 20 nucleotides in length. In some cases, the repressive nucleic acid comprises the following nucleotide sequence: AGACCGGTTCACTGTG-3' (SEQ ID NO: 3) and is 14 nucleotides in length. In some cases, the repressive nucleic acid comprises one or more of the following: i) a locked nucleic acid (LNA); ii) a modified backbone; and iii) 5-methyldeoxycytosine. In some cases, a suitable repressive nucleic acid comprises the nucleotide sequence shown in Figure 1A and named "NRC0119" and all its modifications. In Figure 1A, the ASO term NRC0119 is +A*+G*A*+C* / iMe-dC / *+G*G*+T*T*+C*A*C*+T*G*+T*+G, where “+” precedes LNA; * precedes the thiophosphate base; and / iMe-dC / indicates the inner 5-methyldeoxycytosine.

[0073] In some embodiments, the repressive nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, such as a 2'-O-alkyl, 2'-O-alkyl-O-alkyl, or 2'-fluoro modified nucleotide. In other cases, RNA modifications include 2'-fluoro, 2'-amino, and 2'-O-methyl modifications on the ribose, debased residue, or inverted base of the pyrimidine at the 3' end of the RNA. Such modifications are often incorporated into oligonucleotides, and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) for specific targets than 2'-deoxy oligonucleotides.

[0074] Various nucleotide and nucleoside modifications have been shown to make the incorporated oligonucleotides more resistant to nuclease digestion than native oligodeoxynucleotides; these modified oligonucleotides retain their integrity for longer periods than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those containing a modified backbone (e.g., thiophosphates, triphosphates, methylphosphonates, short-chain alkyl or cycloalkyl sugar linkages, or short-chain heteroatom or heterocyclic sugar linkages). In some cases, repressive nucleic acids are oligonucleotides with a phosphate thioester backbone and oligonucleotides with a heteroatom backbone, particularly CH2--NH--O--CH3, CH3--N(CH3)--O--CH2 (known as a methylene (methylimino) or MMI backbone), CH2--O--N(CH3)--CH2, CH2--N(CH3)--N(CH3)--CH2 and O--N(CH3)--CH2--CH2 backbones, where the native phosphate diester backbone is represented as O--P--O--CH; amide backbones (see De Mesmaeker et al., Ace. Chem. Res. 1995, 28:366-374); morpholino backbone structure (see Summerton and Weller, U.S. Patent No. 5,034,506); peptide nucleic acid (PNA) backbone (in which the phosphodiester backbone of the oligonucleotide is replaced by a polyamide backbone, and the nucleotide is directly or indirectly bound to the aza-nitrogen atom of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, thiophosphates, chiral thiophosphates, dithiophosphates, and phosphate triesters; aminoalkyl phosphate triesters, methylphosphonates, and other alkylphosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphonates, aminophosphates including 3'-aminoaminophosphates and aminoalkylaminophosphates, thiocarbonylaminophosphates, thiocarbonylalkylphosphonates, thiocarbonylalkyl phosphate triesters, and borane phosphates having normal 3'-5' linkages, analogs of these compounds with 2'-5' linkages, and those with opposite polarities, wherein adjacent nucleoside unit pairs are linked in a 3'-5' manner to 5'-3' or in a 2'-5' manner to 5'-2'.

[0075] The phosphorus-free modified oligonucleotide backbone has a backbone formed by short-chain alkyl or cycloalkyl nucleosides, mixed heteroatoms and alkyl or cycloalkyl nucleosides, or one or more short-chain heteroatoms or heterocyclic nucleosides. These backbones include backbones with morpholino linkages (partially formed from the sugar moieties of the nucleosides); siloxane backbones; sulfide backbones; sulfoxide backbones and sulfone backbones; formyl and thioformyl backbones; methyleneformyl and thioformyl backbones; olefin-containing backbones; aminosulfonate backbones; methyleneimino and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and other backbones with mixed N, O, S, and CH2 components.

[0076] It may also include one or more substituted sugar moieties, for example at the 2' position of one of the following: OH, SH, SCH3, F, OCN, OCH3OCH3, OCH3, O(CH2)nCH3, O(CH2)nNH2 or O(CH2)nCH3, where n is 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkylaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O--, S-- or N-alkyl; O--, S-- or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocyclic alkyl; heterocyclic alkylaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleaving group; reporter group; intercalator; group for improving the pharmacokinetic properties of oligonucleotides; or group for improving the pharmacodynamic properties of oligonucleotides and other substituents with similar properties. Suitable modifications include 2'-methoxyethoxy [2'--O—CH2CH2OCH3, also known as: 2'-O-(2-methoxyethyl)] (Martin et al., Helv. Chim. Acta, 1995, 78, 486). Other modifications include 2'-methoxy (2'-O--CH3), 2'-propoxy (2'-OCH2CH2CH3), and 2'-fluorine (2'-F). Similar modifications can also be made at other positions on the oligonucleotide, particularly at the 3' position of the sugar at the 3' end of the nucleotide and the 5' position of the 5' end of the nucleotide. Oligonucleotides may also contain sugar mimics, such as replacing the pentofuranose with a cyclobutyl group.

[0077] Repressive nucleic acids may also additionally or alternatively contain nucleobase modifications or substitutions (generally referred to in the art simply as "bases"). "Unmodified" or "natural" nucleobases as used herein include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include those occasionally or temporarily found only in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-Me pyrimidine, especially 5-methylcytosine (also known as 5-methyl-2'-deoxycytosine, and frequently referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, and gentiobiose HMC, as well as synthetic nucleobases such as 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolidinyl)adenine, 2-(aminoalkylamino)adenine, or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymidine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazoguanine, N6(6-aminohexyl)adenine, and 2,6-diaminopurine. "Universal" bases known in the art, such as inosine, may also be included. 5-Me-C substitution has been shown to improve the stability of nucleic acid duplexes by 0.6–12 °C. In some cases, the inhibitory nucleic acids of this disclosure contain one or more 5-Me-C molecules.

[0078] It is not necessary to uniformly modify all positions in a given oligonucleotide. In fact, multiple of the above modifications can be introduced into a single oligonucleotide, or even into a single nucleoside within an oligonucleotide.

[0079] In some embodiments, both the sugar and nucleoside links (i.e., the backbone) of the nucleotide unit are replaced with novel groups. The base units are retained for hybridization with suitable nucleic acid target compounds. One such oligomeric compound, an oligonucleotide mimic, has been shown to exhibit excellent hybridization properties and is known as peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the oligonucleotide is replaced with an amide-containing backbone (e.g., an aminoethylglycine backbone). The nucleobases are retained and are directly or indirectly bound to the aza-nitrogen atoms of the amide moiety of the backbone. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262, each of which is incorporated herein by reference. Further teachings on PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0080] Repressive nucleic acids may also contain modifications or substitutions of one or more nucleobases (generally referred to in the art simply as "bases"). "Unmodified" or "natural" nucleobases as used herein include purine bases adenine (A) and guanine (G), and pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and Thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-deadenine, and 3-deadenine and 3-deadenine.

[0081] In addition, the nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in "The Concise Encyclopedia of Polymer Science and Engineering", pages 858-859, Kroschwitz, JI, ed. John Wiley & Sons, 1990, those disclosed in English et al., Angewandle Chemie, International Edition, 1991, 30, page 613, and those disclosed in Sanghvi, YS, Chapter 15, "Antisense Research and Applications", pages 289-302, Crooke, Stan Lebleu, B.ea., CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of inhibitory nucleic acids. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propargyluracil, and 5-propargylcytosine. 5-methylcytosine substitution has been shown to improve the stability of nucleic acid double strands by 0.6–1.2 °C (Sanghvi, YS, Crooke, STand Lebleu, B., eds, “Antisense Research and Applications”, CRC Press, Boca Raton, 1993, pp. 276–278), and are suitable for inclusion in repressive nucleic acids, either alone or with 2'-O-methoxyethyl sugar modifications.

[0082] In some cases, the inhibitory nucleic acid is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include, but are not limited to, lipid moieties, such as cholesterol moieties; bile acids; thioethers, such as hexyl-S-triphenylmethylthiol; thiocholesterol; aliphatic chains, such as dodecyl glycol or undecyl residues; phospholipids; such as bis-hexadecyl-racemic-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate; polyamines or polyethylene glycol chains; adamantaneacetic acid; palmityl moieties; octadecylamine moieties; or hexylamino-carbonyl-β-hydroxycholesterol moieties.

[0083] These moieties or conjugates may include conjugated groups covalently bonded to functional groups (e.g., primary or secondary hydroxyl groups). Suitable conjugated groups include intercalators, delivery molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacokinetic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugated groups include cholesterol, lipids, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinones, acridine, fluorescein, rhodamine, coumarin, and dyes. Groups that enhance pharmacokinetic properties include those that improve absorption, enhance resistance to degradation, and / or enhance sequence-specific hybridization with target nucleic acids. Groups that enhance pharmacokinetic properties include those that improve the absorption, distribution, metabolism, or excretion of inhibitory nucleic acids. Representative conjugated groups are disclosed in International Patent Application No. PCT / US92 / 09196, filed October 23, 1992, and U.S. Patent No. 6,287,860, which are incorporated herein by reference. The conjugated portion includes, but is not limited to, lipid portions, such as cholesterol portions, bile acids, thioethers (e.g., hexyl-5-triphenylmethylthiol), thiocholesterol, aliphatic chains (e.g., dodecyl glycol or undecyl residues), phospholipids (e.g., dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-H-phosphonate), polyamines or polyethylene glycol chains, or adamantaneacetic acid, palmityl portions, or octadecylamine or hexylamino-carbonyl-oxycholesterol portions.

[0084] The repressive nucleic acid used in the method of this invention is fully or partially complementary to miR-128, meaning that the hybridization is good enough and specific enough to produce the desired effect. "Complementarity" refers to the ability of two sequences containing natural or non-natural bases or their analogues to pair via hydrogen bonds. For example, if a base at a certain position in the repressive nucleic acid can form a hydrogen bond with a base at a corresponding position in the miR-128 sequence, then the two bases are considered complementary at that position. 100% complementarity is not required.

[0085] In the context of this disclosure, hybridization refers to hydrogen bonding between complementary nucleosides or nucleotide bases, which can be Watson-Crick hydrogen bonding, Hoogsteen hydrogen bonding, or reverse Hoogsteen hydrogen bonding. For example, adenine and thymine are complementary nucleobases that pair by forming hydrogen bonds. As used herein, “complementarity” refers to the ability of two nucleotides to pair precisely. Repressive nucleic acids and miR-128 molecules are complementary when a sufficient number of corresponding positions in each molecule are occupied by nucleotides capable of hydrogen bonding with each other. Therefore, “specific hybridization” and “complementarity” refer to a sufficient degree of complementarity or precise pairing that results in stable and specific binding between the repressive nucleic acid and the miR-128 target sequence. For example, if a base at a position in a repressive nucleic acid can hydrogen bond with a base at a corresponding position in a miR-128 molecule, the bases at that position are considered complementary.

[0086] While 100% complementarity is ideal in some embodiments, it should be understood in the art that complementary nucleic acid sequences do not need to be 100% complementary to their target nucleic acid sequences to specifically hybridize. A complementary nucleic acid sequence is specifically hybridizable when the binding of a complementary nucleic acid sequence used for the purposes of the methods of the present invention to a target miR-128 molecule interferes with the normal function of the target miR-128 and leads to its loss of activity, and when the degree of complementarity is sufficient to prevent non-specific binding of the sequence to a non-target miR-128 sequence under conditions requiring specific binding (e.g., physiological conditions in in vivo assays or therapeutic treatments, and assay conditions performed under suitable stringent conditions in in vitro assays). For example, stringent salt concentrations are typically below about 750 mM NaCl and 75 mM trisodium citrate, below about 500 mM NaCl and 50 mM trisodium citrate, or below about 250 mM NaCl and 25 mM trisodium citrate. Low-strict hybridization can be performed in the absence of organic solvents (e.g., formamide), while high-strict hybridization can be performed in the presence of at least about 35% or at least about 50% formamide. Strict temperature conditions typically include at least 30°C, at least about 37°C, or at least about 42°C. Other parameters, such as hybridization time, detergent concentration (e.g., sodium dodecyl sulfate (SDS)), and the addition or exclusion of vector DNA, are well known to those skilled in the art. Different degrees of strict hybridization can be achieved by combining these different conditions as needed. As a non-limiting example, in some cases, hybridization will be performed at 30°C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. As another non-limiting example, in some cases, hybridization will be performed at 37°C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg / ml denatured salmon sperm DNA (ssDNA). As another non-limiting example, in some cases, hybridization will be carried out at 42 degrees Celsius in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg / ml ssDNA. Useful variations of these conditions will readily be understood by those skilled in the art.

[0087] Generally, the repressive nucleic acid used in the methods described herein has at least 80% sequence complementarity with the target region within the target nucleic acid, for example, 90%, 95%, or 100% sequence complementarity with the target region within miR-128 (e.g., the target region containing the seed sequence). For example, an antisense compound in which 18 of the 20 nucleotides of the antisense oligonucleotide are complementary to the target region and thus can specifically hybridize exhibits 90% complementarity. The percentage of complementarity between the repressive nucleic acid and the target nucleic acid region can be routinely determined using basic local alignment search tools (BLAST procedures) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Repressive nucleic acids (e.g., ASO) that hybridize with the miR-128 target sequence can be identified by routine experiments. Typically, inhibitory nucleic acids must retain their specificity for their targets, meaning they must not directly bind to transcripts other than the intended target or significantly affect their expression levels.

[0088] antisense oligonucleotides

[0089] As described above, in some cases, the repressive nucleic acid of this disclosure is an oligonucleotide oligonucleotide (ASO). ASOs are typically designed to block the expression of DNA or RNA targets by binding to them and stopping expression at the transcriptional, translational, or splicing levels. The ASO of this disclosure is a complementary nucleic acid sequence designed to hybridize with the miR-128 target sequence under stringent conditions. Therefore, oligonucleotides that are sufficiently complementary to the target, i.e., hybridize well enough and have sufficient specificity, are selected to produce the desired effect.

[0090] Modified bases / locked nucleic acids (LNA)

[0091] In some cases, the repressive nucleic acids of this disclosure contain one or more modified bonds or bases. Modified bases include phosphate thioesters, methylphosphonates, peptide nucleic acids, or locked nucleic acid (LNA) molecules. For example, in some cases, the modified nucleotides are locked nucleic acid molecules, including [alpha]-L-LNA. LNAs contain ribonucleic acid analogs in which the ribose ring is “locked” by a methylene bridge between the 2'-oxygen and 4'-carbon, i.e., oligonucleotides containing at least one LNA monomer, i.e., a 2'-O,4'-C-methylene-β-D-furanonucleotide. LNA bases form standard Watson-Crick base pairs, but the locked conformation increases the rate and stability of base pairing reactions (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)). Compared to DNA, LNAs also have increased affinity for base pairing with RNA. These properties make LNAs particularly suitable as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides targeting mRNAs or other RNAs.

[0092] LNA molecules may comprise molecules containing 10-30 nucleotides per chain, such as 12-24 nucleotides, for example 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, wherein one chain is substantially identical to the miR-128 target sequence, for example at least 80% (or more, such as 85%, 90%, 95%, or 100%), for example having 3, 2, 1, or 0 mismatched nucleotides. LNA molecules may be chemically synthesized using methods known in the art.

[0093] antagomir

[0094] In some cases, the inhibitory nucleic acid is antagomir. Antagomir is a chemically modified antisense oligonucleotide that targets the miR-128 target sequence. For example, the antagonist used in the methods described herein may comprise a nucleotide sequence of about 12 to 25 nucleotides or about 15 to 23 nucleotides that are sufficiently complementary to hybridize with the miR-128 target sequence.

[0095] Typically, antagomir contains a cholesterol moiety, for example, at the 3' end. In some embodiments, antagomir has various modifications for RNase protection and pharmacological properties, such as enhanced tissue and cellular uptake. For example, in addition to the antisense oligonucleotide modifications discussed above, antagomir may also have one or more of complete or partial 2'-O-methylation of a sugar and / or phosphate thioester backbone. Phosphothioester modifications provide protection against RNase activity, and their lipophilicity contributes to enhanced tissue uptake. In some embodiments, antagomir may contain six phosphate thioester backbone modifications; two phosphate thioesters at the 5' end and four at the 3' end. Antagomir used in the methods of the present invention may also be modified in terms of its length or the number of nucleotides that otherwise constitute the antagomir. Antagomir must retain its specificity to its target, i.e., it must not directly bind to transcripts other than the intended target or directly and significantly affect their expression levels. In some embodiments, the repressive nucleic acid is locked and contains a cholesterol moiety (e.g., a locked antagomir).

[0096] siRNA / shRNA

[0097] In some cases, the repressive nucleic acid of this disclosure is interfering RNA, including but not limited to small interfering RNA (“siRNA”) or small hairpin RNA (“shRNA”). Methods for constructing interfering RNA are well known in the art. For example, interfering RNA can be assembled from two separate oligonucleotides, one strand being the sense strand and the other the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand contains a nucleotide sequence complementary to a nucleotide sequence in the other strand; for example, the antisense and sense strands form a duplex or double-stranded structure); the antisense strand contains a nucleotide sequence complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene), while the sense strand contains a nucleotide sequence corresponding to a target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA can be assembled from a single oligonucleotide, wherein the self-complementary sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker. Interfering RNA (siRNA) can be a polynucleotide with a double-stranded, asymmetric double-stranded, hairpin, or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions. The antisense region contains a nucleotide sequence complementary to the nucleotide sequence of a single target nucleic acid molecule or a portion thereof, while the sense region contains a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Interfering RNA can also be a circular single-stranded polynucleotide with two or more circular structures and a stem containing self-complementary sense and antisense regions. The antisense region contains a nucleotide sequence complementary to the nucleotide sequence in the target nucleic acid molecule or a portion thereof, while the sense region contains a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Furthermore, the circular polynucleotide can be processed in vivo or in vitro to produce an active siRNA molecule capable of mediating RNA interference.

[0098] In some cases, the interfering RNA coding region encodes a self-complementary RNA molecule with a sense region, an antisense region, and a loop region. Such RNA molecules are expected to form a “hairpin” structure upon expression and are referred to herein as “shRNA”. The loop region is typically about 2 to about 10 nucleotides in length. In some embodiments, the loop region is about 6 to about 9 nucleotides in length. In some embodiments, the sense and antisense regions are about 15 to 20 nucleotides in length. Following posttranscriptional processing, the small hairpin RNA is converted to siRNA via a cleavage event mediated by the Dicer enzyme, a member of the ribonuclease III family. The siRNA is then able to repress the expression of genes homologous to it.

[0099] siRNA-guided target RNA cleavage responses exhibit high sequence specificity. Typically, siRNAs containing a portion of the same nucleotide sequence as the target nucleic acid are used for repression. However, 100% sequence identity between the siRNA and the target gene is not required. Therefore, the advantage of this disclosure lies in its tolerance for sequence variations that may result from gene mutations, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single-point mutations relative to the target sequence have been found to be effective for repression. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can also be effective for repression. Generally, the siRNA must retain its target specificity, i.e., it must not directly bind to transcripts other than the intended target or directly and significantly affect their expression levels.

[0100] Preparation of inhibitory nucleic acids

[0101] Inhibitory nucleic acids can be synthesized in vitro using well-known chemical synthesis techniques, as described in, for example, Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68:109; Beaucage (1981) Tetra. Lett. 22:1859; US Patent No. 4,458,066.

[0102] Pharmaceutical Composition

[0103] This disclosure provides compositions of inhibitory nucleic acids comprising the present disclosure, including pharmaceutical compositions. The inhibitory nucleic acids of this disclosure may be referred to hereinafter as "pharmaceuticals" or "active agents".

[0104] In some cases, the composition is formulated with a pharmaceutically acceptable carrier. Pharmaceutical compositions and formulations can be administered parenterally, topically, orally, or by topical application (e.g., via aerosol or transdermal administration). Pharmaceutical compositions can be formulated in any manner and can be administered in various unit dosage forms, depending on the condition or disease and its severity, the patient's general medical condition, the ultimately preferred method of administration, etc. Details of the techniques for formulating and administering pharmaceuticals are described in detail in scientific and patent literature; see, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

[0105] Inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). Inhibitory nucleic acids can be formulated for administration in any convenient manner for human or veterinary use. The composition may also contain wetting agents, emulsifiers, and lubricants, such as sodium dodecyl sulfate and magnesium stearate, as well as colorants, release agents, coating agents, sweeteners, flavorings and aromas, preservatives, and antioxidants.

[0106] The inhibitory nucleic acid formulations of this disclosure include formulations suitable for intradermal, inhalation, oral / nasal, topical, parenteral, rectal, and / or vaginal administration. The formulations can conveniently exist in unit dosage forms and can be prepared by any method known in the pharmaceutical field. The amount of active ingredient (e.g., the inhibitory nucleic acid of this disclosure) that can be combined with a carrier material to produce a single dosage form will vary depending on the host being treated and the specific route of administration (e.g., intradermal or inhalation). The amount of active ingredient that can be combined with a carrier material to produce a single dosage form is typically the amount of a compound that produces a therapeutic effect (e.g., an antigen-specific T-cell or humoral response).

[0107] Pharmaceutical formulations can be prepared according to any pharmaceutical manufacturing method known in the art. Such pharmaceuticals may contain sweeteners, flavoring agents, coloring agents, and preservatives. Formulations may be mixed with suitable, non-toxic, pharmaceutically acceptable excipients. Formulations may contain one or more diluents, emulsifiers, preservatives, buffers, excipients, etc., and may be provided in the form of liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled-release formulations, tablets, pills, gels, patches, implants, etc.

[0108] Pharmaceutical formulations intended for oral administration can be formulated in appropriate and suitable doses using pharmaceutically acceptable carriers known in the art. Such carriers enable the formulation of drugs into unit dosage forms suitable for patient swallowing, such as tablets, pills, powders, sugar-coated pills, capsules, liquid formulations, lozenges, gels, syrups, pastes, suspensions, etc. Pharmaceutical formulations intended for oral administration can be formulated as solid excipients, optionally by grinding the resulting mixture and, if necessary, processing the granular mixture to obtain tablets or sugar-coated pill cores. Suitable solid excipients are carbohydrate or protein fillers, such as sugars including lactose, sucrose, mannitol, or sorbitol; starches from corn, wheat, rice, potatoes, or other plants; cellulose, such as methylcellulose, hydroxypropyl methylcellulose, or sodium carboxymethylcellulose; and gums including gum arabic and tragacanth; and proteins such as gelatin and collagen. Disintegrants or solubilizers, such as cross-linked polyvinylpyrrolidone, agar, alginate, or salts thereof (e.g., sodium alginate), can be added. Push-in capsules may contain an active ingredient mixed with a filler or binder (such as lactose or starch), a lubricant (such as talc or magnesium stearate), and optionally a stabilizer. In soft capsules, the active ingredient may be dissolved or suspended in a suitable liquid, such as fatty oil, liquid paraffin, or liquid polyethylene glycol, with or without a stabilizer.

[0109] Aqueous suspensions may contain an active agent (e.g., the inhibitory nucleic acid of this disclosure) mixed with excipients suitable for manufacturing aqueous suspensions (e.g., for aqueous intradermal injection). Such excipients include suspending agents such as sodium carboxymethyl cellulose, methylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinylpyrrolidone, tragacanth gum, and gum arabic, and dispersing or wetting agents such as naturally occurring phospholipids (e.g., lecithin), condensation products of alkyl esters and fatty acids (e.g., polyoxyethylene stearate), condensation products of ethylene oxide and long-chain fatty alcohols (e.g., heptadecanethoxycetyl alcohol), condensation products of ethylene oxide and fatty acids and hexitol-derived esters (e.g., polyoxyethylene sorbitan monooleate), or condensation products of ethylene oxide and fatty acids and hexitol-derived esters (e.g., polyoxyethylene dehydrated sorbitan monooleate). Aqueous suspensions may also contain one or more preservatives, such as ethylparaben or n-propylparaben, one or more colorants, one or more flavoring agents, and one or more sweeteners, such as sucrose, aspartame, or saccharin. The osmotic pressure of the formulation can be adjusted.

[0110] In some cases, oil-based pharmaceuticals are used to administer inhibitory nucleic acids. Oil-based suspensions can be formulated by suspending the active agent in a vegetable oil (e.g., peanut oil, olive oil, sesame oil, or coconut oil) or a mineral oil (e.g., liquid paraffin) or a mixture thereof. See, for example, U.S. Patent No. 5,716,928, which describes the use of essential oils or essential oil components to improve the bioavailability of orally administered hydrophobic pharmaceutical compounds and reduce inter- and intra-individual variability (see also U.S. Patent No. 5,858,401). Oily suspensions may contain thickeners such as beeswax, hard paraffin, or cetyl alcohol. To provide palatable oral formulations, sweeteners such as glycerin, sorbitol, or sucrose may be added. These formulations may be preserved by adding antioxidants such as ascorbic acid. For examples of injectable oily mediators, see Minto (1997) J. Pharmacol. Exp. Ther. 281:93-102.

[0111] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oil phase can be vegetable or mineral oils as described above, or mixtures thereof. Suitable emulsifiers include naturally occurring gums, such as gum arabic and tragacanth; naturally occurring phospholipids, such as soybean lecithin; fatty acid and hexitan-derived esters or metaesters, such as sorbitan monooleate; and condensation products of these metaesters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. Emulsions may also contain sweeteners and flavoring agents, as in the formulations of syrups and elixirs. Such formulations may also contain lubricants, preservatives, or colorants. In alternative embodiments, injectable oil-in-water emulsions contain paraffin oil, sorbitan monooleate, ethoxylated sorbitan monooleate, and / or ethoxylated sorbitan trioleate.

[0112] Pharmaceutical compositions can be administered via the nasal, intraocular, and vaginal routes, including suppositories, inhalers, powders, and aerosol formulations (for examples of steroid inhalers, see, for instance, Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75:107-111). Suppository formulations can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at room temperature but liquid at body temperature, thus melting and releasing the drug in the body. Such materials include cocoa butter and polyethylene glycol.

[0113] In some cases, pharmaceutical compositions can be delivered transdermally via a local route and formulated as applicators, solutions, suspensions, emulsions, gels, creams, ointments, pastes, gels, ointments, powders, and aerosols.

[0114] In some cases, pharmaceutical compositions can be delivered in the form of microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of a drug that releases slowly under the skin; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as a biodegradable and injectable gel formulation, see, for example, Gao (1995) Pharm. Res. 12:857-863 (1995); or as microspheres for oral administration, see, for example, Eyles (1997) J. Pharm. Pharmacol. 49:669-674.

[0115] In some cases, pharmaceutical compositions may be administered parenterally, such as via intravenous (IV) administration or into body cavities or organ cavities. These formulations may contain a solution of the active agent (e.g., the inhibitory nucleic acid of this disclosure) in a pharmaceutically acceptable carrier. Acceptable carriers and solvents that can be used are water and Ringer's solution (an isotonic sodium chloride). Additionally, sterile fixative oils may be used as solvents or suspension media. For this purpose, any mild fixative oil may be used, including synthetic monoglycerides or diglycerides. Furthermore, fatty acids (e.g., oleic acid) may also be used in the preparation of injectable formulations. These solutions are sterile and generally free of harmful substances. These formulations may be sterilized using conventional, well-known sterilization techniques. The formulations may contain pharmaceutically acceptable excipients to approximate physiological states, such as pH adjusters and buffers, toxicity modifiers, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The concentration of the active agent in these formulations can vary considerably and will be selected primarily based on liquid volume, viscosity, body weight, etc., and according to the specific route of administration and patient needs. For intravenous administration, the formulation may be a sterile injectable, such as a sterile aqueous or oily suspension for injection. This suspension may be formulated using suitable dispersants or wetting agents and suspending agents. The sterile injectable may also be a suspension in a non-toxic, parenteral diluent or solvent (e.g., a solution of 1,3-butanediol). Administration may be by bolus injection or continuous infusion (e.g., injection into a blood vessel substantially uninterrupted for a specified time).

[0116] In some cases, the pharmaceutical composition may be lyophilized. Stable lyophilized compositions containing inhibitory nucleic acids can be prepared by lyophilizing a solution containing the pharmaceutical composition of this disclosure and a filler (e.g., mannitol, trehalose, raffinose, and sucrose, or mixtures thereof). Methods for preparing stable lyophilized formulations may include lyophilizing a solution of about 2.5 mg / mL nucleic acid, about 15 mg / mL sucrose, about 19 mg / mL sodium chloride, and a sodium citrate buffer solution with a pH greater than 5.5 but less than 6.5. See, for example, U.S. Patent 20040028670.

[0117] Compositions and formulations can be delivered using liposomes. By using liposomes, especially when the surface of the liposomes carries target cell-specific ligands or otherwise preferentially targets a specific organ, active agents (e.g., the inhibitory nucleic acids of this disclosure) can be delivered in vivo to target cells in a concentrated manner. See, for example, U.S. Patent Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46:1576-1587. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in one or more bilayers. Liposomes are monolayered or multilayered vesicles having a membrane formed of lipophilic material and an aqueous interior containing the composition to be delivered. Cationic liposomes are positively charged liposomes, believed to interact with negatively charged DNA molecules to form stable complexes. pH-sensitive or negatively charged liposomes are thought to encapsulate DNA rather than form complexes with it. Both cationic and non-cationic liposomes have been used to deliver DNA into cells.

[0118] Liposomes can also include "sterically stable" liposomes, i.e., liposomes containing one or more specific lipids. When these specific lipids are incorporated into liposomes, they result in liposomes with a longer cycle life compared to liposomes lacking such specific lipids. Examples of sterically stable liposomes include those in which a portion of the lipid portion forming the vesicles comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) portions. U.S. Patent No. 6,287,860 further describes liposomes and their uses.

[0119] The formulations disclosed herein may be administered for preventive and / or therapeutic treatment. In some cases, for therapeutic application, the composition is administered to a subject in need (e.g., an individual at risk of having the disease described herein (e.g., at a higher risk than the general population) or who has the disease described herein) in an amount sufficient to cure, alleviate, or partially suppress the clinical manifestations of the condition or its complications; this may be referred to as a therapeutically effective amount.

[0120] The amount of pharmaceutical composition sufficient to achieve this purpose is the therapeutically effective dose. The effective dosage regimen and amount for this use, i.e., the administration regimen, will depend on a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the patient's overall health status, the patient's physical condition, age, etc. The method of administration is also taken into account when calculating the patient's dosage regimen.

[0121] Dosing regimens also take into account pharmacokinetic parameters well-known in the art, such as the absorption rate, bioavailability, metabolism, and clearance of the active agent (see, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The prior art allows clinicians to determine dosing regimens for each individual patient, the active agent (e.g., an inhibitory nucleic acid), and the disease or condition being treated. Guidelines provided for similar compositions used as pharmaceuticals can be used to guide the determination of dosing regimens (i.e., dosing schedules and dose levels).

[0122] The formulation may be administered once or multiple times depending on factors such as the patient's required and tolerable dose and frequency, the extent and amount of therapeutic effect produced after each administration (e.g., effect on blood glucose levels), etc. The formulation should provide an adequate amount of the active agent (e.g., an inhibitory nucleic acid) to effectively treat, prevent, or improve a condition, disease, or symptom.

[0123] In alternative embodiments, the daily dose of the pharmaceutical formulation for oral administration is approximately 1 μg to approximately 100 mg of nucleic acid per kilogram of body weight / day. Lower doses can be used for injection into the bloodstream, body cavities, or organ cavities compared to oral administration. Significantly higher doses can be used for topical or oral administration, or administration via powder, spray, or inhalation. Practical methods for preparing parenteral or non-parenteral administration formulations are known or apparent to those skilled in the art and are described in more detail in publications such as Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

[0124] In some embodiments, the methods described herein may include co-administration with other drugs or pharmaceuticals (e.g., compositions for lowering blood glucose levels). For example, inhibitory nucleic acids may be co-administered with drugs used to treat or reduce the risk of the conditions described herein.

[0125] Treatment methods - metabolic disorders

[0126] This disclosure provides methods for using the inhibitory nucleic acid of this disclosure, for example, for subjects suffering from metabolic syndrome (e.g., high LDL, low HDL, high triglycerides, obesity, non-alcoholic fatty liver disease, insulin resistance, and / or hypertension), type 2 diabetes, and / or cardiovascular disease (CVD). The treatment methods of this disclosure provide one or more of the following: a) lowering circulating LDL; b) increasing HDL; c) lowering triglycerides; d) reducing obesity; e) reducing insulin resistance and type 2 diabetes; f) improving non-alcoholic fatty liver disease; and g) reducing atherosclerosis / CVD. The method includes administering an effective amount of the inhibitory nucleic acid of this disclosure or a composition comprising it (e.g., a pharmaceutical composition) to an individual in need. In some cases, the inhibitory nucleic acid of this disclosure is administered in the form of lipid nanoparticles. In some cases, the inhibitory nucleic acid of this disclosure is administered in the form of liposomes.

[0127] "Therapeutic effective dose" refers to an amount of a drug (e.g., an inhibitory nucleic acid), alone or as part of a pharmaceutical composition, administered to a subject as a single dose or as part of a series of doses, such that it produces any detectable positive effect on any symptom, aspect, or characteristic of a disease, symptom, or condition when administered to a patient. Therapeutic effective doses can be determined by measuring the associated physiological effects. In some cases, such as in the case of hyperglycemia, a decrease or reduction in blood glucose or an improvement in glucose tolerance testing can be used to determine whether the amount of drug is effective in treating hyperglycemia. Therapeutic effective doses can be adjusted based on the dosing regimen and diagnostic analysis of the subject's condition, etc.

[0128] In some cases, the therapeutically effective amount of the inhibitory nucleic acid of this disclosure is an amount sufficient to reduce or decrease any level (e.g., baseline level) of fasting plasma glucose (FPG) when administered at one or more doses, wherein, for example, the amount is sufficient to reduce an FPG level greater than 200 mg / dL to less than 200 mg / dL, wherein the amount is sufficient to reduce an FPG level between 175 mg / dL and 200 mg / dL to below the starting level, wherein the amount is sufficient to reduce an FPG level between 150 mg / dL and 175 mg / dL to below the starting level, wherein the amount is sufficient to reduce an FPG level between 125 mg / dL and 150 mg / dL to below the starting level, and so on (e.g., reducing FPG levels to below 125 mg / dL, below 120 mg / dL, below 115 mg / dL, below 110 mg / dL, etc.).

[0129] In some cases, the therapeutically effective amount of the inhibitory nucleic acid of this disclosure is an amount sufficient, when administered in one or more doses, to reduce or decrease glycated hemoglobin A1c (HbA1c) levels by more than about 10% to 9%, more than about 9% to 8%, more than about 8% to 7%, more than about 7% to 6%, more than about 6% to 5%, etc. In some cases, the therapeutically effective amount of the inhibitory nucleic acid of this disclosure is an amount sufficient to reduce or decrease HbA1c levels by about 0.1%, 0.25%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 33%, 35%, 40%, 45%, 50%, or more.

[0130] In some cases, the therapeutically effective amount of the inhibitory nucleic acid of this disclosure is such that, when administered in one or more doses, it is sufficient to result in insulin levels within the normal range.

[0131] In some cases, the therapeutically effective amount of the inhibitory nucleic acid of this disclosure is an amount sufficient, when administered in one or more doses, to result in serum alanine aminotransferase (ALT) levels within the normal range. In some cases, the therapeutically effective amount of the inhibitory nucleic acid of this disclosure is an amount sufficient, when administered in one or more doses, to reduce serum ALT levels by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, or more than 50% compared to pre-treatment serum ALT levels. In some cases, the therapeutically effective amount of the inhibitory nucleic acid of this disclosure is an amount sufficient, when administered in one or more doses, to result in serum aspartate aminotransferase (AST) levels within the normal range. In some cases, the therapeutically effective amount of the inhibitory nucleic acid of this disclosure is an amount that, when administered in one or more doses, is sufficient to reduce serum AST levels by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, or more than 50% compared to pre-treatment serum AST levels.

[0132] In some cases, the effective amount of the inhibitory nucleic acid in this disclosure refers to the amount that produces the desired result relative to a healthy subject when administered to a subject at one or more doses. For example, an effective dose may be a dose that, when administered to a subject with elevated blood glucose and / or plasma insulin, achieves a desired reduction of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or more than 80% relative to a healthy subject.

[0133] In some cases, the effective amount of inhibitory nucleic acid in this disclosure refers to the amount that reduces BMI to the normal range when administered to a subject at one or more doses, for example, to 18.5 kg / m². 2 Approximately 24.9 kg / m 2 Within. In some cases, the effective amount of the inhibitory nucleic acid in this disclosure refers to the amount that, when administered to a subject in one or more doses, reduces BMI by at least 5%, at least 10%, or at least 15%, wherein the initial BMI is greater than 30 kg / m². 2 .

[0134] Application route

[0135] Suitable routes of administration include oral, rectal, nasal, pulmonary, local, subcutaneous, intramuscular, intraperitoneal, intravenous, intradermal, intrathecal, and epidural. In some cases, the route of administration is intramuscular. In some cases, the route of administration is intravenous.

[0136] Combination therapy

[0137] This disclosure contemplates the use of the inhibitory nucleic acid of this disclosure in combination with one or more other agents (e.g., one or more other active therapeutic agents) or other preventive or therapeutic modalities. In such combination therapies, the various active agents typically have different mechanisms of action. Such combination therapies are particularly advantageous in reducing the dosage of one or more agents, thereby reducing or eliminating adverse reactions associated with one or more agents; furthermore, such combination therapies may have synergistic therapeutic or preventive effects on underlying diseases, symptoms, or conditions.

[0138] As used in this article, “combination” refers to a therapy that can be administered alone, such as a therapy formulated for individual administration (e.g., available as a kit), and a therapy that can be administered together as a single formulation (i.e., “combination formulation”).

[0139] In some cases, the inhibitory nucleic acid of this disclosure and the at least one other agent are administered or applied sequentially, for example, one agent is administered before one or more other agents. In other cases, the inhibitory nucleic acid of this disclosure is administered simultaneously with at least one other agent, for example, two or more agents are administered simultaneously or approximately simultaneously; the two or more agents may be present in two or more separate formulations, or may be combined into a single formulation (i.e., a combination formulation). Whether the two or more agents are administered sequentially or simultaneously, for the purposes of this disclosure, they are considered to be administered in combination.

[0140] The inhibitory nucleic acid disclosed herein may be used in combination with other agents used to treat the conditions or illnesses described herein, including agents commonly administered to subjects with obesity, eating disorders, hyperglycemia, hyperinsulinemia, glucose intolerance, and other glucose metabolism disorders.

[0141] This disclosure considers combination therapy with a variety of pharmaceutical agents (and classes thereof), including 1) insulin, insulin analogs, and agents that require stimulation of insulin secretion, including sulfonylureas (e.g., chlorpropamide, tolasulfonylurea, hexyl acetate, tolbutamide, glibenclamide, glimepiride, glipizide) and chloropicrins (e.g., miglitol, repaglinide, and nateglinide); 2) biguanides (e.g., metformin and its pharmaceutically acceptable salts, particularly metformin hydrochloride, and its extended-release formulations, such as Glumetza). TM Fortamet TM and GlucophageXR TM) and other agents that act by promoting glucose utilization, reducing hepatic glucose production and / or reducing intestinal glucose output; 3) α-glucosidase inhibitors (e.g., acarbose, voglibose and miglitol) and other drugs that slow carbohydrate digestion, thereby slowing intestinal absorption and reducing postprandial hyperglycemia; 4) thiazolidinediones (e.g., rosiglitazone, troglitazone, pioglitazone, glipizide, balaglitazone, linaglitazone, naphaglitazone, AMG131, MBX2044, miglitazone, loglitazone, IDR-105, troglitazone, empaglitazone, cycloglitazone, adaglitazone, dapaglitazone, which enhance the effects of insulin (e.g., through insulin sensitization), including insulin and insulin analogs. (e.g., insulin degludec, insulin glargine, insulin lispro, insulin detemir, insulin glutares, and their respective inhaled formulations), thereby promoting glucose utilization in peripheral tissues; 5) glucagon-like peptides, including DPP-IV inhibitors (e.g., alogliptin, octagliptin, liraliptin, vedagliptin, and sitagliptin) and glucagon-like peptide-1 (GLP-1) and GLP-1 agonists and analogues (e.g., exenatide (BYETTA and ITCA650 (a subcutaneous osmotic pump for delivering exenatide analogues over 12 months; Intarcia, Boston, Mass.)) and GLP-1 receptor agonists (e.g., dulaglutide, smegglutide, abiglutide, exenatide, etc.). Peptides, liraglutide, liximab, tasigglutide, CJC-1131, and BIM-51077 (including their intranasal, transdermal, and once-weekly formulations); and 6) and DPP-IV resistance analogs (incretin analogs), PPARγ agonists, PPARα agonists, such as fenofibrate derivatives (e.g., gemfibrozil, clofibrate, ciprofibrate, fenofibrate, bezafibrate), dual-action PPAR agonists (e.g., ZYH2, ZYH1, GFT505, ciglitazone, mogglitazone, agglitazone, sodegglitazone, and navigagglitazone), pan-targeting PPAR agonists, PTP1B inhibitors (e.g., ISIS-113715 and TTP814), SGLT inhibitors Insulin secretagogues (e.g., ASP1941, SGLT-3, empagliflozin, dapagliflozin, canagliflozin, BI-10773, PF-04971729, repaggliflozin, TS-071, toggliflozin, ioggliflozin, and LX-4211), angiotensin-converting enzyme inhibitors (e.g., alapril, benazepril, captopril, siropril, cilazapril, delapril, enalapril, enalapril, fosinopril, imidapril, lisinopril, movipril, perindopril, quinapril, ramipril, spiropril, temocarpril, or qundolipril), angiotensin II receptor antagonists (e.g., losartan, valsartan, candesartan, olmesartan, temesartan); and so on.

[0142] Subjects

[0143] Subjects suitable for treatment using the methods described in this disclosure include individuals with metabolic disorders. Subjects suitable for treatment using the methods described in this disclosure include obese individuals. Subjects suitable for treatment using the methods described in this disclosure include individuals with type 2 diabetes. Subjects suitable for treatment using the methods described in this disclosure include individuals with diabetic retinopathy. Subjects suitable for treatment using the methods described in this disclosure include individuals with non-alcoholic fatty liver disease (NAFLD). Subjects suitable for treatment using the methods described in this disclosure include individuals with non-alcoholic steatohepatitis (NASH).

[0144] Treatment methods for muscular dystrophy

[0145] This disclosure provides a method for treating muscular dystrophy. The method includes administering an effective amount of the inhibitory nucleic acid of this disclosure, or a composition comprising the nucleic acid (e.g., a pharmaceutical composition), to an individual in need. In some cases, the inhibitory nucleic acid of this disclosure is administered in the form of lipid nanoparticles. In some cases, the inhibitory nucleic acid of this disclosure is administered in the form of liposomes.

[0146] Muscular dystrophy that can be treated using the methods disclosed herein includes, for example, Duchenne muscular dystrophy (DMD), Becker's muscular dystrophy, myotonic muscular dystrophy, facioscapulohumeral muscular dystrophy, and limb-girdle muscular dystrophy.

[0147] In some cases, the effective amount of the inhibitory nucleic acid of this disclosure is an amount that, when administered to a subject at one or more doses, results in one or both of the following: i) improved overall metabolic characteristics, including mitochondrial homeostasis; and ii) reduced oxidative stress.

[0148] In some cases, the effective amount of the inhibitory nucleic acid of this disclosure refers to the amount that provides an increase in muscle strength in a subject when administered to a subject at one or more doses. For example, in some cases, the effective amount of the inhibitory nucleic acid of this disclosure refers to an amount that, when administered to a subject at one or more doses, increases muscle strength in the subject by at least 10%, at least 25%, at least 50%, at least 2 times, or more than 2 times compared to the muscle strength level in the subject before treatment with the inhibitory nucleic acid.

[0149] In some cases, the effective amount of the inhibitory nucleic acid of this disclosure refers to the amount that provides a reduction in skeletal muscle fibrosis and necrosis when administered to a subject at one or more doses. For example, in some cases, the effective amount of the inhibitory nucleic acid of this disclosure refers to the amount that, when administered to a subject at one or more doses, reduces skeletal muscle fibrosis and necrosis by at least 10%, at least 25%, at least 50%, at least 60%, at least 70%, or more than 70% compared to the level of skeletal muscle fibrosis and necrosis in the subject prior to treatment with the inhibitory nucleic acid.

[0150] Application route

[0151] Suitable routes of administration include oral, rectal, nasal, pulmonary, local, subcutaneous, intramuscular, intraperitoneal, intravenous, intradermal, intrathecal, and epidural. In some cases, the route of administration is intramuscular. In some cases, the route of administration is intravenous.

[0152] Suitable subjects for treatment

[0153] Subjects suitable for treatment using the methods disclosed herein include individuals with Duchenne muscular dystrophy (DMD), Becker's muscular dystrophy, myotonic dystrophy, facioscapulohumeral muscular dystrophy, or limb-girdle muscular dystrophy.

[0154] Examples of non-limiting aspects of this disclosure

[0155] The aspects of the subject matter of this invention described above (including embodiments) are advantageous whether used alone or in combination with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of this disclosure are provided below. It will be apparent to those skilled in the art upon reading this disclosure that each individually numbered aspect may be used in combination with any of the foregoing or subsequently individually numbered aspects. This is intended to support all such combinations of aspects, and not be limited to the combinations of aspects explicitly provided below:

[0156] Aspect 1. An inhibitory nucleic acid comprising the following nucleotide sequence:

[0157] a) 5'-ACCGGTTCACTGTG-3' (SEQ ID NO: 1); or

[0158] b) 5'-GACCGGTTCACTGT-3' (SEQ ID NO: 2); or

[0159] c) 5'-AGACCGGTTCACTGTG-3' (SEQ ID NO: 3),

[0160] The inhibitory nucleic acid mentioned therein comprises one or more locked nucleic acids (LNAs).

[0161] Aspect 2. The inhibitory nucleic acid according to aspect 1, wherein the inhibitory nucleic acid comprises: i) a modified backbone; and / or ii) one or more 5-methyldeoxycytosine residues.

[0162] Aspect 3. The inhibitory nucleic acid according to aspect 1 or aspect 2, wherein the length of the inhibitory nucleic acid is 14 to 20 nucleotides.

[0163] Aspect 4. The inhibitory nucleic acid according to any one of Aspects 1-3, wherein the inhibitory nucleic acid comprises the nucleotide sequence (including modifications) shown in FIG1A and named “NRC0090”.

[0164] Aspect 5. The inhibitory nucleic acid according to any one of Aspects 1-3, wherein the inhibitory nucleic acid comprises the nucleotide sequence (including modifications) shown in FIG1A and named “NRC-0091”.

[0165] Aspect 6. The inhibitory nucleic acid according to any one of Aspects 1-3, wherein the inhibitory nucleic acid comprises the nucleotide sequence (including modifications) shown in FIG1A and named “NRC-0119”.

[0166] Aspect 7. A pharmaceutical composition comprising:

[0167] a) the inhibitory nucleic acid according to any one of aspects 1-6; and

[0168] b) Pharmaceutically acceptable excipients.

[0169] Aspect 8. The pharmaceutical composition according to aspect 7, wherein the pharmaceutically acceptable excipient comprises one or more lipids.

[0170] Aspect 9. The pharmaceutical composition according to aspect 7, wherein the pharmaceutically acceptable excipient comprises poly(amidoamine), poly(propyleneimine), or poly(L-lysine).

[0171] Aspect 10. A lipid nanoparticle comprising: a) an inhibitory nucleic acid according to any one of Aspects 1-6; and b) a pharmaceutically acceptable excipient.

[0172] Aspect 11. A treatment method comprising administering to an individual in need an effective amount of an inhibitory nucleic acid according to any one of Aspects 1-6, a pharmaceutical composition according to any one of Aspects 7-9, or lipid nanoparticles according to Aspect 10.

[0173] Aspect 12. A method for treating an individual's metabolic disorder, the method comprising administering to the individual an effective amount of an inhibitory nucleic acid according to any one of Aspects 1-6, a pharmaceutical composition according to any one of Aspects 7-9, or lipid nanoparticles according to Aspect 10.

[0174] Aspect 13. The method according to aspect 12, wherein the metabolic disorder is insulin resistance, hyperglycemia, type 2 diabetes, obesity, fatty liver disease, glucose intolerance, hyperinsulinemia, metabolic syndrome, or hypertension.

[0175] Aspect 14. The method according to aspect 12, wherein the metabolic disorder includes insulin resistance.

[0176] Aspect 15. The method according to aspect 12, wherein the metabolic disorder includes metabolic syndrome.

[0177] Aspect 16. The method according to aspect 12, wherein the metabolic disorder includes type 2 diabetes.

[0178] Aspect 17. The method according to any one of Aspects 12-16, wherein the body mass index of the individual is >30.0.

[0179] Aspect 18. The method according to any one of Aspects 12-17, wherein the administration results in serum insulin levels within the normal range.

[0180] Aspect 19. The method according to any one of Aspects 12-17, wherein the administration results in a blood glucose level within the normal range.

[0181] Aspect 20. The method according to any one of aspects 12-19, further comprising administering at least one other therapeutic agent.

[0182] Aspect 21. The method according to aspect 20, wherein the at least one other therapeutic agent is insulin, an insulin analog, biguanide, or thiazolidinedione.

[0183] Aspect 22. The method according to any one of aspects 11-20, wherein the administration is by oral administration.

[0184] Aspect 23. A method for treating muscular dystrophy in an individual, the method comprising administering to the individual an effective amount of an inhibitory nucleic acid according to any one of Aspects 1-6, a pharmaceutical composition according to any one of Aspects 7-9, or lipid nanoparticles according to Aspect 10.

[0185] Aspect 24. The method according to aspect 23, wherein the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy. Example

[0186] The following embodiments are provided to provide a complete disclosure and description of how to make and use the invention to those skilled in the art, but are not intended to limit the scope of what the inventors consider their invention, nor are they intended to represent all or only the experiments conducted. Every effort has been made to ensure the accuracy of the figures used (e.g., quantities, temperatures, etc.), but some experimental errors and biases should still be considered. Unless otherwise stated, parts are parts by weight, molecular weights are weight-average molecular weights, temperatures are degrees Celsius, and pressures are atmospheric pressure or near atmospheric pressure. Standard abbreviations may be used, such as: bp, base pair; kb, kilobase; pl, picoliter; s or sec, second; min, minute; h or hr, hour; aa, amino acid; kb, kilobase; bp, base pair; nt, nucleotide; im, intramuscular; ip, intraperitoneal; sc, subcutaneous; etc.

[0187] Example 1

[0188] Figure 1A depicts the sequence information of three ASOs. ID represents the drug name, OLIGO represents the nucleotide sequence (uppercase letters indicate locked nucleic acid (LNA), lowercase letters indicate standard bases), STRING indicates modifications (+ sign before LNA, * before thiophosphate bases, / iMe-dC / indicates internal 5-methyldeoxycytosine, Length indicates the number of nucleotides, and #LNAs indicates the number of standard bases replaced by LNAs). Figure 1B A schematic LNA / DNA composition for each ASO and its base pairing positions within the target miRNA (miR-128-3p) are provided. The seed sequence of miR-128-3p is shown in red.

[0189] This disclosure shows that miR-128-1 miRNA represents an interesting therapeutic target for DuDMD due to its regulation of skeletal muscle mitochondrial metabolism and direct targeting of several key modifying factors downstream of dystrophin loss. Figure 2 To investigate the therapeutic potential and mechanism of action of miR-128-1 in DMD, a locked-nucleic acid antisense oligonucleotide (LNA ASO) targeting miR-128-1 was developed. Efficient consumption of miR-128-1 in skeletal muscle was achieved through weekly subcutaneous injection. Furthermore, miR-128-1 was identified as involved in regulating multiple genes that have been shown to act as modifiers of the DMD phenotype, including PGC-1α, AMPKα2, SIRT1, JAG1, and Wnt7A, as well as other metabolic regulators such as PPARα, PPARγ, ULK1, and CPT1β.

[0190] Figure 2The loss of dystrophin in myocytes of patients with DMD leads to mitochondrial dysfunction, and various regulators of mitochondrial biology and autophagy, as well as certain developmental regulators such as Notch and Wnt signaling components, can at least partially rescue DMD pathology. Interestingly, many of these regulators are predicted or validated targets of miR-128-1 miRNA.

[0191] A new generation of anti-miR-128-3p ASOs with significantly enhanced efficacy has been developed. The ASO design algorithm modifies the sequence, length, and LNA position to maximize binding efficacy and accessibility to the miR-128-3p seed region. The process also optimizes the melting temperature and binding energy while minimizing self-complementarity and off-target binding. NRC0090, NRC0091, and NRC0119 scored highest in a rigorous screening process, and in vitro testing demonstrated that these ASOs are superior to previous antimiR-128-3p ASO prototypes. 1,2 The efficacy is 20 to 50 times higher (Figure 3). Importantly, the novel ASO appears to be well tolerated and non-toxic when administered in high doses to mice (Figure 3), and short-term treatment in mice resulted in successful and effective inhibition of miR-128-3p levels in liver, muscle, eWAT, and BAT tissues. Figure 2 ).

[0192] Figure 3. The novel LNA ASO targeting miR-128-3p is up to 50 times more effective than the original LNA ASO prototype, demonstrating on-target efficacy in vivo and no toxicity. (AC) Dose-response curves of the candidate ASO and the originally reported ASO. Huh-7 hepatocellular carcinoma cells were transfected with anti-miR-128-3p LNA ASO or a randomized control, and miR-128-3p levels were measured by RT-qPCR at (A) 72 hours or (BC) 24 hours. miR-128-3p in the treatment group was normalized to U6 reference RNA and then normalized to the randomized control. (DG) In vivo LNA ASO tolerability. Nine-week-old male C57BL / 6 mice (n=5) were subcutaneously injected with repeated 20 mg / kg doses of NRC0090, randomized control ASO, or saline on days 0, 2, 4, and 6. Body weight gain was monitored, and terminal blood samples were drawn on day 8 to measure liver (AST / ALT) and kidney (BUN) toxicity markers. (H) In vivo animiR-128-3p LNA ASO targeting study. Seven-week-old male C57BL / 6 mice (n=5) were fed a high-fat diet and subcutaneously injected with 10 mg / kg animiR-128-3p LNA ASO or a scrambled control. Treatment was administered on days 0 and 7, and designated tissues were collected on day 10 for miR-128-3p quantification by RT-qPCR. miR-128-3p in the treatment group was normalized to U6 reference RNA and then normalized to the scrambled control. Data are presented as mean and SEM.

[0193] The chemical properties of LNA provide significantly increased target affinity and specificity, and when combined with the thiophosphate backbone of ASO, they enhance in vivo stability and pharmacokinetics. This is based on multiple studies using LNA ASOs targeting miR-33 in mice and non-human primates. 18 In mammals, the terminal circulating half-life of LNA ASO is typically 2–3 weeks, and LNA ASO can remain detectable in tissues for up to 7 weeks after a single injection. Dosing studies in mice showed that target inhibition lasted for 28 days after a single injection, allowing for weekly and potentially monthly dosing (Figure 4). Furthermore, dose-response studies demonstrated strong target binding in all major metabolic tissues, including skeletal muscle, liver, subcutaneous and visceral WAT, and BAT (Figure 4).

[0194] Figure 4. Dosage optimization study in mice. (AD) Time-course study. Eight-week-old C57BL / 6 mice (n=5) on a standard diet were subcutaneously injected on day 0 with 10 mg / kg NRC0090 animiR-128-3p or a randomized control ASO. Tissue samples were collected from each group on days 3, 7, 14, and 28 for miR-128-3p quantification by RT-qPCR. miR-128-3p in the treatment group was normalized to U6 reference RNA and then normalized to the randomized control. Data are presented as mean and SEM. (EI) Dosage-response study in mice. Seven-week-old C57BL / 6 mice (n=5) on a high-fat diet were subcutaneously injected on day 0 with an indicated dose of NRC0090 animiR-128-3p or a randomized control ASO. Tissue samples were collected on day 28 for miR-128-3p quantification by RT-qPCR. miR-128-3p in the treatment group was normalized to U6 reference RNA and then normalized to a scrambled control. Data are presented as mean and SEM.

[0195] Example 2: Metabolic syndrome.

[0196] NRC0090, NRC0091, and NRC0119 have been tested in diet-induced obese mice and have shown protective effects against MetS-related conditions, including weight gain, fat accumulation, and glucose intolerance (Figure 5).

[0197] Figure 5. (AB) Seven-week-old male C57BL / 6 mice (n=3) were fed a 60% high-fat diet and subcutaneously injected with 10 mg / kg / week of designated antimiR-128-3p LNA ASO or a randomized control, with body weight monitored over time. (CD) Three-week-old male C57BL / 6 mice (n=5) were fed a 60% high-fat diet and subcutaneously injected with 10 mg / kg / week of NRC0090 antimiR-128-3p LNA ASO or a randomized control. Body weight was monitored weekly (C), and fat mass and lean mass were measured by EchoMRI at the end of the study (D). (EF) Six-week-old male C57BL / 6 mice (n=10) were fed a 60% high-fat diet and subcutaneously injected with 5 mg / kg / month of NRC0090 antimiR-128-3p LNA ASO or a randomized control. After 15 weeks of treatment, mice were fasted for 6 hours and then injected intraperitoneally with 1 g / kg D-glucose, and blood glucose levels were monitored over time (E). The area under the curve was calculated using GraphPad with a baseline of Y=0, and the data were analyzed by one-way ANOVA (F).

[0198] Example 3: Duchenne Muscular Dystrophy

[0199] Duchenne muscular dystrophy (DMD) is caused by mutations in the dystrophin gene, leading to progressive muscle degeneration and weakness, ultimately resulting in premature death from respiratory and cardiac failure. To date, there is no cure for DMD. Steroids are only intended to control symptoms and come with numerous serious adverse effects. Newly developed approaches focused on restoring partially functional dystrophin (e.g., exon-skipping antisense oligonucleotides (ASO) and AAV-micro-dystrophin) have shown limited efficacy in a relatively small number of patients, and the duration of their effects is uncertain. Therefore, additional efforts have been made to mitigate the disease by improving the detrimental effects downstream of dystrophin loss, including metabolic abnormalities associated with mitochondrial dysfunction, elevated reactive oxygen species (ROS), fatty infiltration, inflammation, and fibrosis.

[0200] miRNAs are short (18-24 nucleotides) regulatory non-coding RNAs that function in development, metabolism, and disease by epigenetically regulating specific target genes through their 3' untranslated region (3'UTR). Many miRNAs have been shown to be upregulated in DMD muscle and are therefore referred to as "dystro-miRs"; however, there is currently a lack of convincing data to suggest that therapeutic targeting of dystro-miRs can improve the DMD phenotype in animal models.

[0201] Mature miR-128-3p miRNAs (derived from miR-128-1 locus on human chromosome 2 and miR-128-2 locus on chromosome 3; also known as miR-128a and miR-128b, respectively) have been identified as major regulators of metabolic homeostasis. Specifically, miR-128-3p expression negatively regulates mitochondrial respiration and biosynthesis and inhibits the expression of key genes related to mitochondrial function and homeostasis.

[0202] To block the action of miR-128-3p, state-of-the-art locked nucleic acid antisense oligonucleotides (LNAASOs) were engineered. The miR-128-3p LNA ASO was modified to enable subcutaneous delivery and potent targeting of miR-128-3p in skeletal and cardiac muscle. In this study, the effects of anti-miR-128-3p LNA ASO on mdx were examined. 5cv Mice and DMD Y / - The effects of treatment were observed in pig models. Results showed near-complete recovery of skeletal muscle and cardiac dysfunction in these models. Furthermore, well-established metabolic disorders associated with DMD, including glucose intolerance, mitochondrial dysfunction, and oxidative stress, were significantly improved to near-wild-type levels after treatment.

[0203] In Duchenne muscular dystrophy (MDD) 5cvIn a mouse model, anti-miR-128-1 treatment significantly improved muscle strength and endurance while reducing skeletal muscle fibrosis and necrosis, exhibiting excellent overall safety. This therapeutic effect was achieved through improved overall metabolic status, including reduced mitochondrial homeostasis, oxidative stress, and lipid peroxidation. Notably, ASO has an effect on mdx 5cv The effects on the small intestine of mice were also confirmed.

[0204] Elevated miR-128-3p expression is associated with myasthenia gravis in human DMD patients and animal models of DMD.

[0205] Using human data from the UK Biobank (n>300,000), genetic associations were found between miR-128-1 and miR-128-2 loci encoding miR-128-3p and human grip strength and respiratory function (Figure 6A). The expression of miR-128-3p in a DMD animal model and this data suggest that miR-128-3p is involved in mdx. 5cv Elevated levels were observed in mouse models (Fig. 6B, C) and a DE50-MD canine model (Fig. 6D). This is consistent with literature on DMD patients, which shows elevated levels of miR-128-3p in patient plasma and skeletal muscle tissue.

[0206] Figure 6. The association of miR-128-3p expression with myasthenia gravis in human and DMD animal models. (A) The miR-128-3p locus is genetically associated with weak hand grip and weak lung function (UK Biobank; n>300,000), and miR-128-3p is elevated in DMD mouse and canine models. The miR-128-3p locus on human chromosome 2 is associated with weak left and right hand grip and impaired lung function (forced expiratory volume and forced vital capacity) (B, C). Wt and mdx were measured at different ages. 5cv The levels of miR-128-3p in skeletal muscle and serum of mice were measured. n = 5 per group. (D) The levels of miR-128-3p in DE50-MD1 canine models of DMD aged 3 to 18 months were measured.

[0207] In mdx 5cv In the DMD mouse model, LNA ASO treatment targeting miR-128-3p improved all pathological phenotypes.

[0208] To assess whether miR-128-3p is a pathological modifying factor in DMD, mdx 5cv Mice were crossed with either systemic miR-128-3p knockout mice or muscle-specific miR-128-3p knockout mice. It was hypothesized that knockdown of miR-128-3p expression would improve mdx. 5cvSkeletal muscle function in mice. These results indicate that, compared to wild-type mice, miR-128-3p expression was downregulated by 36.6% and 22.9% in systemic miR-128-3p knockout mice and muscle-specific miR-128-3p knockout mice, respectively (Figure 7A). (Compared to mdx) 5cv Compared to mice, muscle grip strength was significantly increased in both mouse models (Fig. 7B). Exercise endurance was tested by running on a treadmill to exhaustion, and the data showed that knockout of miR-128-3p in skeletal muscle significantly improved endurance (Fig. 7C, D) and reduced circulating creatine kinase levels (a marker of muscle damage; Fig. 7E). In summary, this indicates that miR-128-3p expression contributes to mdx 5cv Pathology of DMD in mice.

[0209] Figure 7. Systemic or muscle-specific miR-128-3p knockout improves mdx 5cv Muscle function in mice. (A) miR-128-3p levels in GA muscle were measured. (B) Passive lanyard test for muscle grip strength was measured. (C,D) Exercise endurance was measured by running on a treadmill to exhaustion. Time and distance were plotted separately. (E) Serum creatine kinase was measured to examine muscle damage.

[0210] To determine whether inhibiting miR-128-3p using an LNA ASO could be used as a therapy for DMD, a state-of-the-art LNA ASO capable of targeting miR-128-3p and potently downregulating its expression was constructed. First, dose-response studies were conducted to evaluate the efficacy of this LNA ASO in mdx 5cv Knockdown efficiency in mouse tissues. Seven days after a single subcutaneous injection of a series of doses, miR-128-3p expression levels were measured in skeletal muscle, diaphragm, and myocardium. This data showed significant inhibition of miR-128-3p in all these tissues (Figure 8). Based on this data, a dose of 10 mg / kg delivered subcutaneously once weekly was selected for subsequent mouse studies.

[0211] Figure 8.mdx 5cv In vivo ASO dose-response in mice. Mice were injected with either 10 mg / kg of control ASO 406 or anti-miR-128-3p ASO 90 at doses ranging from 1.25 mg / kg to 10 mg / kg. TA, diaphragm, and heart were collected 7 days after a single injection. miR-128-3p expression levels in TA (A), diaphragm (B), and heart (C) were determined. Data were normalized to the control ASO 406 group.

[0212] Considering the early onset of DMD, in mdx 5cvIn mice, anti-miR-128-3p LNA ASO treatment began at 3 weeks of age and continued until 6 or 9 weeks of age (Fig. 9A). Analysis of miR-128-3p expression levels showed persistent and robust (>95%) knockdown during treatment (Fig. 9B). miR-128-3p knockdown significantly improved many pathological manifestations of dystrophin loss. First, the data showed a sharp decrease in circulating creatine kinase (Fig. 9C), a significant recovery in muscle grip strength (Fig. 9D), and a significant improvement in endurance exercise capacity (Fig. 9E, F). Histological examination of muscle showed increased muscle fiber diameter, reduced muscle fiber necrosis, and reduced muscle fibrosis (Fig. 9G-L). Furthermore, anti-miR-128-3p LNA ASO was well tolerated in these mice and showed no significant hepatotoxicity or nephrotoxicity. Figures 10A-10F ).

[0213] Figure 9. Anti-miR-128-3p LNA ASO improves mdx 5cv Pathological phenotypes in the DMD mouse model. (A) Schematic diagram of experimental design. (B) WT and mdx treated with control ASO and therapeutic ASO. 5cv (C) Expression level of miR-128-3p in GA muscle of mice. (D) Measurement of circulating creatine kinase activity, a marker of muscle injury. (E, F) Measurement of bilimb cage top sling test for muscle grip strength. Exercise endurance was measured by running on a treadmill to exhaustion. Plots were drawn for time and distance, respectively. (G) H&E images of TA muscle histology at 40X and 100X. (H) Quantification of TA muscle fiber size in all three experimental groups. (I) Detection of necrosis by staining with IgG antibody and quantification of fluorescence intensity, as shown in Figure (J). (K) Detection of fibrosis by staining frozen sections of TA muscle with Sirius red. (L) Quantification of fibrotic areas in the three experimental groups. n = 3–5 per group. (M) Measurement of bilimb cage top sling test in all three groups. (N) H&E images of TA muscle histology at 100X.

[0214] Figure 10. ASO injection is safe and has no toxicity in the liver and kidneys. (A, B) WT mice and mdx mice treated with control ASO and anti-miR-128-3p ASO. 5cv H&E images of the liver and kidneys of mice. (C,D) WT and mdx treated with control ASO and anti-miR-128-3pASO. 5cv Serum ALT and AST levels in the liver of mice. (E,F) Serum blood urea nitrogen (BUN) and creatinine were measured as indicators of renal function.

[0215] AntimiR-128-3p LNA ASO therapy improves metabolic dysfunction in DMD

[0216] DMD patients and animal models exhibit significant metabolic dysfunction, such as glucose intolerance, decreased expression of glycolytic and oxidative enzymes, impaired mitochondrial homeostasis and function, increased oxidative stress, and abnormal intrafibrotic and plasma lipid levels. To elucidate the mechanistic role of miR-128-3 in DMD pathology, mdx patients receiving anti-miR-128-3p or disordered control LNA ASO therapy were compared. 5cv RNA sequencing (RNA-seq) was performed on the gastrocnemius muscle of mice and compared with that of wild-type mice. These studies revealed that, compared with wild-type controls, mdx 5cv The disease model identified 3,142 differentially expressed genes, of which 473 showed altered expression in response to anti-miR-128-3p treatment. Figure 11A B). The most significantly upregulated pathways include oxidative phosphorylation, the TCA cycle, pyruvate metabolism, fatty acid metabolism, adipogenesis, and muscle formation. Figure 11C Significantly downregulated pathways include the interferon response, IL6-JAK-STAT3 signaling, and the inflammatory response. Figure 11D RNA sequencing data highlighted numerous changes in metabolic pathways. To examine the effects of anti-miR-128-3p LNA ASO treatment on metabolites in malnourished muscle tissue, a metabolomics analysis was performed. Several metabolite classes were altered under LNA ASO treatment, with lipids representing the most significant category. Figure 12A The clustering of these metabolites demonstrates an increase in the types of toxic lipids in malnourished states, which is improved in the context of LNAASO treatment. Figure 11E These include ceramides, which are known to cause insulin resistance in skeletal muscle when elevated. To further investigate this, mdx patients receiving antimiR-128-3p LNA ASO therapy... 5cv Intraperitoneal glucose tolerance tests were performed in mice. Results showed a significant improvement in glucose clearance under LNA ASO treatment. Figure 12B (C).

[0217] Mitochondrial dysfunction is also a well-established metabolic abnormality in DMD pathology. This RNA sequencing analysis showed that LNAASO treatment increased the expression of several mitochondrial-related pathways. To further investigate mitochondrial homeostasis, the expression of key regulators of mitochondrial function, biosynthesis, and dynamics was examined. The results showed that several regulators, including AMPKα2, PGC-1α, and PPARα, were significantly de-inhibited under anti-miR-128-3p LNAASO treatment. Figure 11G , Figure 13DFollowing anti-miR-128-3p LNA ASO treatment, mitochondrial DNA copy number significantly increased, indicating increased mitochondrial biosynthesis. Figure 11H Electron microscopy analysis of mitochondrial ultrastructure showed that mdx treated with antimiR-128-3p LNA ASO... 5cv Abnormal mitochondrial integrity in mice was improved. Figure 11J Specifically, mdx 5cv The soleus muscle exhibits perinuclear mitochondrial localization, which is resolved in the presence of anti-miR-128-3p LNA ASO treatment. Figure 13A In addition, mdx 5cv Mitochondria in soleus muscle were irregularly arranged longitudinally, but correct mitochondrial arrangement was restored under anti-miR-128-3pLNA ASO treatment. Consistent with the finding of improved mitochondrial morphology, reduced hydrogen peroxide levels and lipid peroxidation were also observed under treatment, indicating that mdx treated with anti-miR-128-3pLNA ASO... 5cv Reduced oxidative stress in mice Figure 11I , Figure 13B Furthermore, the composition of muscle fibers shifted in favor of oxidative fiber types, with an increase in type IIa fibers and a decrease in type IIb fibers. Figure 11K , Figure 13F This shift in fiber type is consistent with the observed desuppression of PGC-1α expression. In summary, these data suggest an overall improvement in mitochondrial health.

[0218] Figure 11. AntimiR-128-3p LNA ASO treatment improves metabolic dysfunction in DMD. (AD) Wild-type mice and mdx mice treated with control ASO and antimiR-128-3p ASO. 5cv RNA-seq analysis in mice. (A, B) Venn diagrams and volcano diagrams showing differentially expressed genes. (C, D) Enrichment pathway analysis showing the signal transduction cascade of upregulated (C) and downregulated (D). (E, F) Wild-type (E) and mdx compared with control or anti-miR-128-3p LNA ASO treatment. 5cv Compared to mice (F), mdx 5cv Analysis of altered metabolites in the gastrocnemius muscle of a mouse model. (G) Desuppression of genes regulating mitochondrial homeostasis was measured by RT-qPCR. (H) Mitochondrial DNA copy number in soleus muscle at 6 weeks of age was measured. (I) Oxidative stress was quantified. (J) Longitudinal sections of soleus muscle under an electron microscope showed mitochondrial relocation and tissue loss at 9 weeks of age. (K) Immunofluorescence staining of three muscle fiber types.

[0219] Figure 12. Metabolomics analysis shows mdx 5cv Treatment with miR-128-3p LNA ASO in mice resulted in a reduction in the types of lipotoxic substances and improved glucose tolerance. (A)mdx 5cv Heatmap of fold changes in metabolite types in mice treated with miR-128-3p LNA ASO. (B, C) Intraperitoneal glucose tolerance test performed at 6 weeks of age. Area under the curve quantified in (C).

[0220] Figure 13. Anti-miR-128-3p LNA ASO treatment improves mitochondrial health in DMD. (A) Electron microscopy imaging of the soleus muscle in cross-section (top) and longitudinal section (bottom). (B, C) Measurement of lipid peroxidation in skeletal muscle and serum, expressed as MDA production. (D) Western blot to measure mitochondrial protein levels in TA muscle. (E) Quantification of mitochondrial protein levels. (F) Quantification of myofiber type (as shown in Figure 3K).

[0221] Figure 14. Effects of anti-miR-128-1ASO on inflammation, ferroptosis, and oxidative stress were examined. (A) Expression levels of TNFα, IL-1β, and IL-6 were measured by RT-qPCR. (B) Genes involved in ferroptosis were examined. (C and D) Lipid oxidation byproduct MDA was measured in TA skeletal muscle and serum in all three experimental groups. (E) H2O2 levels in TA muscle were measured.

[0222] Figure 15. WT and mdx treated with control ASO or anti-miR-128-3p ASO 5cv Histological examination of small intestinal sections from mice. (AC)WT, mdx 5cv Representative H&E images of the control and treatment ASO groups. Red lines represent intestinal wall thickness, black arrows represent small intestinal villus height, and blue arrows represent small intestinal crypt depth. (D) Quantitative plot of smooth muscle layer thickness.

[0223] Figure 16. Assessment of mdx at 6 weeks of age 5cv Expression of miR-128-3p in mouse myocardium and its downstream targets. (A) WT, mdx 5cv (A) Expression levels of miR-128-3p in the heart of the control group and the group treated with ASO. (B) Gene expression profiles of downstream targets of miR-128-3p.

[0224] Example 4: Myocardial infarction (MI) and heart failure

[0225] miR-128-3p is a key regulator of intrinsic cardiac fibrosis and regeneration after myocardial infarction (MI). It is hypothesized that miR-128-3p may represent a therapeutic target for combating myocardial fibrosis and promoting cardiac regeneration. To inhibit miR-128-3p, a state-of-the-art LNA ASO was used, which demonstrated significantly improved stability and safety, and high efficacy in several tissues, including skeletal muscle and the heart.

[0226] Anti-miR-128-3p LNA ASO therapy in rat and pig models of cardiac dysfunction.

[0227] Death in DMD patients ultimately results from heart and respiratory failure. Because anti-miR-128-3p LNA ASO treatment significantly improved skeletal muscle function, further investigation is being conducted to determine if this treatment can also salvage heart failure. (DMD mdx) 5cv The model failed to reproduce the cardiac dysfunction observed in human patients. Therefore, other heart failure models were investigated. Selective knockout and targeting of miR-128-3p in the heart via AAV decoys has been shown to improve cardiac function after myocardial infarction (MI) in mice. First, the efficacy of anti-miR-128-3p LNA ASO was examined in a permanent ligation-induced heart failure model. Permanent ligation of the left anterior descending coronary artery was performed, followed by immediate subcutaneous injection of 10 mg / kg LNA ASO into mice. Injections were repeated weekly, and tissues were collected 28 days after myocardial infarction. Anti-miR-128-3p LNA ASO treatment resulted in complete knockdown of miR-128-3p expression in the heart 28 days after myocardial infarction. Figure 17A The miR-128-3p level was significantly knocked down, indicating high efficiency in targeting cardiac tissue with weekly subcutaneous injections. Furthermore, fibrosis was reduced in the scar area in the treatment group (Figure 18).

[0228] Cardiac function was measured using echocardiography before and 28 days after MI. Results showed a significant improvement in ejection fraction and a significant decrease in end-systolic volume following anti-miR-128-3p LNAASO treatment, indicating a significant improvement in cardiac function. Figure 17B Furthermore, compared with mice injected with disordered control LNA ASO, mice treated with anti-miR-128-3p LNA ASO showed an increased survival rate. Figure 17D ).

[0229] Due to the significant improvement in cardiac function observed in a mouse MI model, the therapeutic potential of anti-miR-128-3p LNA ASO in a very severe porcine DMD model was further investigated. Pigs have more similar cardiac physiology to humans, and DMD...Y / - The pig model exhibited significant cardiac dysfunction. To examine the efficacy of anti-miR-128-3p LNA ASO treatment, six-week-old pigs were subcutaneously injected with 5 mg / kg body weight of LNA ASO weekly for two months. Figure 17E After LNA ASO treatment, these DMDs Y / - Cardiac dysfunction in pigs was significantly salvaged, as measured by LV ejection fraction and LV shortening fraction. Figure 17F Serum troponin I levels (a biomarker of myocardial infarction and cardiac cell death) were also salvaged by LNA ASO treatment. Figure 17J To further elucidate the mechanism of salvage in cardiac dysfunction, mass spectrometry-based quantitative proteomics analysis was performed on the myocardium. Principal component analysis showed that when DMD was treated with anti-miR-128-3p LNA ASO... Y / - In pigs, the proteomic profile shifts towards the wild type. Figure 17I Compared to wild-type pigs, 17 differentially regulated proteins were observed in DMD disease states. Figure 17H (K). However, DMD treated with anti-miR-128-3p LNA ASO Y / - In pigs, the expression patterns of 12 of the 17 proteins remained unchanged (Fig. 4h, k). Notably, compared to wild-type, DMD... Y / - Troponin I was elevated in pigs, but in DMD treated with anti-miR-128-3p LNA ASO. Y / - No increase was observed in pigs ( Figure 17K DMD compared to wild-type samples. Y / - The proteins with reduced moderate abundance belong to functional clusters: cell adhesion, regulation of the response to trauma, protein maturation, protein activation, and extracellular structural organization. In summary, these results suggest that anti-miR-128-3p LNA ASO is an effective treatment for mouse and pig models of cardiac dysfunction.

[0230] Figure 17. Anti-miR128-3p LNA ASO rescues mouse MI and preclinical DMD Y / - Cardiac dysfunction in a porcine model. (A) Measurement of miR-128-3p levels in a mouse MI model treated with LNA ASO. (B, C) Measurement of ejection fraction and end-systolic volume in a MI model. (D) Survival Kaplan-Meier estimator. (E) DMD in patients treated with anti-miR-128-3p or control ASO. Y / -Endpoint miR-128-3p expression was measured in porcine myocardium. (F, G) Left ventricular shortening fraction and ejection fraction were measured by echocardiography. (H) Volcano plot visualization of proteomic alterations: Proteins with significantly altered abundance in the DMD group (FDR < 0.05) are downregulated in blue and upregulated in red, respectively. (I) WT pigs, DMD Y / - Principal component analysis of the placebo group and the anti-miR-128-3pLNAASO experimental group in pigs. (J) Serum levels of troponin I were measured. (h) For the control and treatment groups, WT n=4; DMD Y / - n = 3. (K) shows pathway analysis of differentially abundant proteins (FDR < 0.05) under at least one condition. (L) Echocardiographic assessment of end-diastolic volume in the MI mouse model. n = 9 for control ASO; n = 11 for anti-miR-128-1 ASO.

[0231] Figure 18. Assessment of fibrosis in the MI mouse model. (A) Sirius red staining was used to quantify fibrotic tissue in the heart. Image J was used to quantify the area of ​​fibrosis. (B) Measurement of fibrosis in the scar area and interstitial fibrosis in the infarct boundary area. (C) Measurement and quantification of infarct area, fibrosis in the scar area, and interstitial fibrosis in the boundary area. For control ASO, n = 9; for anti-miR-128-1 ASO, n = 11.

[0232] method

[0233] Mouse husbandry and experiments. (Dmd) mdx-5Cv / J mice (hereinafter referred to as mdx) 5cv Purchased from Jackson Laboratory (strain #002379), and crossed with C57BL / 6J mice for at least 6 generations. Wild-type C57BL / 6J mice were purchased from Jackson Laboratory as controls. [The text abruptly ends here, likely due to an incomplete sentence or missing information.] f / f Mouse hybridization and with mdx 5cv MCK-Cre mice (Jackson Labs strain #006405) (MCK cre / miR-128) produced by mating with mice f / f / mdx 5cv Muscle-specific miR-128 knockout mice (MCK cre / miR-128) were generated. f / f / mdx 5cv MDX with systemic miR-128 knockout was generated using CMV-Cre mice (Jackson Labs strain #006054). 5cv Mice (CMV cre / miR-128) f / f / mdx 5cv Wild type and MDX5cv Mice were injected weekly with either a randomized control or anti-miR-128-3p ASO starting at 3 weeks of age. Behavioral testing was performed at 6 and 9 weeks of age. Tissue and blood samples were collected at the end of weeks 6 and 9. Blood samples were centrifuged at 2,000 rpm for 10 minutes to obtain serum. Skeletal muscle tissue was used for morphological and molecular analysis. All experimental procedures were performed in accordance with IACUC guidelines and approved by the University of California, Berkeley (IACUC) (AUP#2018-10-11513-1). All protocols complied with federal regulations, the National Research Council's guidelines for the care and use of laboratory animals, and the Public Health Service's Humane Care and Use of Laboratory Animals Policy.

[0234] Pig husbandry and analysis. All pig experiments were conducted in accordance with the German Animal Welfare Act and Directive 2010 / 63 / EU on the protection of animals for scientific purposes, and approved by the animal welfare authority (Upper Bavarian State Government; Permit No.: 55.2-1-54-2532-163-2014). All pigs were housed in a pathogen-free environment designated by Ludwig Maximilian University of Munich (Center for Innovative Medical Models). Free access to feed and water was provided. DMD and WT pigs were from the same litter. To standardize the experimental groups, all piglets in the placebo and treatment groups were raised by the same boar and heterozygous carrier sow (DMD). + / - It was bred from [various species].

[0235] The establishment of a pig model with DMD exon 52 deletion has been described in detail elsewhere (Stirm, Fonteyne et al. 2021).

[0236] The first echocardiogram and blood sampling were performed at 5 weeks of age (one week after weaning). The first injection was given one week later. Three DMD pigs were each randomly assigned to either the treatment group or the placebo group, receiving either 5 mg / kg body weight weekly of LNA ASO targeting miR-128-3p or a randomized LNA sequence for two months. The injection was administered subcutaneously into the skin fold behind the ear. Blood samples were collected two weeks and two months after the first injection, coinciding with the last echocardiogram, necropsy, and tissue sampling.

[0237] Locked Nucleic Acid Antisense Oligonucleotide (LNA ASO). The ASO targeting microRNA miR-128 was designed and modified to improve its stability and efficacy. The sequence is a 14-mer ACcggTTCacTgTG (SEQ ID NO: 1). The LNA ASO is 100% chemically synthesized from IDT DNA, and is harmless, non-toxic, and non-infectious. It is also pharmaceutical grade and does not contain endotoxins.

[0238] Behavioral tests of muscle function. All mice were exercised twice a week for three weeks, running on a treadmill for 30 minutes at 9 m / min (Kaczor et al., 2007; Hudecki et al., 1993). Behavioral tests of muscle function, including passive tethering, limb tethering, and treadmill fatigue tests, were performed according to the Treat NMD neuromuscular network standard operating procedure. For the treadmill fatigue test, mice were placed on the running belt of a six-lane electric treadmill (Exer 3 / 6 Treadmill; Columbus Instruments, Columbus, OH) equipped with an impact plate. The treadmill was run at 0° incline and 5 m / min for 5 minutes, after which the speed was increased by 1 m / min per minute. The test was stopped when the mouse remained on the impact plate for 20 seconds without attempting to re-engage the treadmill, and the fatigue time was determined. The running distance was then calculated based on the speed and running time.

[0239] Creatine kinase, alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and creatinine were measured. Serum creatine kinase, ALT, AST, BUN, and creatinine levels were measured using commercially available kits.

[0240] RT-qPCR. GA skeletal muscle was used for total RNA extraction. miR-128 levels were measured using a probe from Thermo Scientific. U6 was used as a housekeeping control.

[0241] cDNA was generated using a reverse transcriptase kit from BioRad, and gene expression was then measured by qPCR.

[0242] RNA-seq analysis. Total RNA was extracted using a Qiagen kit (product catalog). A cDNA library was constructed from 1 μg of total RNA from mouse GA muscle tissue using the Stranded mRNA-seq kit (KAPA) according to the manufacturer's protocol. The library was sequenced on a NovaSeq 6000 (Novogene) by targeting 40 million read pairs and extending paired-end reads for 150 cycles. Sequencing reads were mapped to transcripts in the mouse mm10 reference genome using STAR alignment software. Read counts of individual transcripts were generated using HTSeq-count, expression values ​​were estimated, and differentially expressed transcripts were detected using EdgeR. Differentially expressed genes were defined as at least a 2-fold change and an FDR of less than 0.01.

[0243] Immunohistochemistry and histology. TA muscle tissue was embedded in OCT and rapidly frozen in liquid nitrogen. Muscle sections were cut into 10 μM sections. Hematoxylin and eosin staining were performed. Myofiber size was measured from H&E sections using Image J. Sirius red staining was performed to stain fibrotic tissue. Necrotic cells were stained with IgG, IgM, and IgA. For quantitative analysis, three images were analyzed for each sample to generate a combined mean.

[0244] Blood collection and clinical chemistry. Using Serum. (Sarstedt, Nümbrecht, Germany) Blood was collected from the right jugular vein. Serum The serum was allowed to stand at room temperature for 30 minutes for coagulation, then centrifuged at 1800g for 20 minutes at 4°C. Serum was aliquoted and stored at -80°C until further processing (shelf life not exceeding 6 months). Creatine kinase levels were measured using the CKL CAN 057 kit on a Cobas 311 analyzer system (Sridhar, Roche et al.). Troponin I levels were measured by CMIA (Alinity, Abbott, Illinois, USA) in the laboratory of SYNLAB.vet GmbH Augsburg.

[0245] Echocardiography. To perform echocardiography, pigs were given 20 mg / kg ketamine (… Serumwerke Bernburg, Bernburg, Germany) and 2 mg / kg azapiridone ( Pigs were sedated (Serumwerke Bernburg) and then anesthetized with 4 mg / kg / h propofol (Propofol 2%, Fresenius Kabi, Bad Homburg, Germany). After achieving sufficient depth of anesthesia, the pigs were placed in the right lateral decubitus position, and cardiac function was measured by standard two-dimensional transthoracic echocardiography (Esaote MyLab X8). Left ventricular ejection fraction and fractional shortening were determined using the M-mode method. All measurements were performed by the same researcher. Due to significant differences, genotyping was not possible, but the measurements in the placebo and treatment groups were blinded to the researcher.

[0246] Sample preparation for proteomic analysis. Heart and skeletal muscle tissue samples were flash-frozen in liquid nitrogen and cryo-pulverized using a CP02 automated dry powder grinder (Covaris, Woburn, MA, USA) according to the manufacturer's instructions. The tissue powder was then sonicated in 8M urea / 0.5M NH4HCO3 using a Sonopuls HD3200 (Bandelin, Berlin, Germany) (18 cycles, 10 seconds per cycle). Protein quantification was performed using a Pierce 660nm protein quantification assay (Thermo Fisher Scientific, Rockford, IL, USA). 20 μg of protein was digested with Lys-C (FUJIFILM Wako Chemicals Europe GmbH, Neuss, Germany) for 4 hours, followed by digestion with modified porcine trypsin (Promega, Madison, WI, USA) at 37°C for 16 hours.

[0247] Nanoliter liquid chromatography-tandem mass spectrometry (MS) analysis and bioinformatics. 1 μg of digest was injected into an online-coupled UltiMate 3000 nanoliter LC system on a Q-Exactive HF-X instrument (Thermo Fisher Scientific). The sample was transferred to a PepMap 100C18 trap column (100 μm × 2 cm, 5 μM particles, Thermo Fisher Scientific) and separated at 250 nl / min on an analytical column (PepMap RSLC C18, 75 μm × 50 cm, 2 μm particles, Thermo Fisher Scientific) using a 5–20% gradient of solvent B over 80 min, followed by a 9 min ramp to 40%. Solvent A consisted of an aqueous solution of 0.1% formic acid, and solvent B consisted of an acetonitrile solution of 0.1% formic acid. MS spectra were acquired on the Q Exactive HF-X mass spectrometer using the first 15 data-dependent acquisition methods. The original files were processed using Maxquant (v.1.6.7.0)[1], with its built-in search engine Andromeda[2] and the NCBI RefSeq Sus scrofa database (v.7-5-2020). Protein strength was normalized using the MaxLFQ method[3]. Statistical analysis and visualization were performed using Perseus[4] and the R framework[5]. Proteins detected in all replicates under at least one condition were retained for quantitative analysis. Missing values ​​were imputed using the default parameters of Perseus. Volcano plots were generated using a two-tailed Student's t-test and a permutation-based FDR cutoff of 0.05, with an s0 parameter of 0.1 to account for fold changes[6].

[0248] References

[0249] 1Wagschal, A. et al. Genome-wide identification of microRNAs regulating cholesterol and triglyceride homeostasis. Nat Med 21, 1290-1297 (2015).

[0250] 2Wang, L. et al. A MicroRNA Linking Human Positive Selection and MetabolicDisorders. Cell 183, 684-701e614 (2020).

[0251] 3Kuno, A. & Horio, Y. SIRT1: A Novel Target for the Treatment of Muscular Dystrophies. Oxid Med Cell Longev 2016, 6714686 (2016).

[0252] 4Miura, P. et al. Pharmacological activation of PPARbeta / delta stimulates utrophin A expression in skeletal muscle fibers and restores sarcolemma integrity in mature mdx mice. Hum Mol Genet 18, 4640 - 4649 (2009).

[0253] 5Ljubicic, V. & Jasmin, B. J. AMP-activated protein kinase at the nexus of therapeutic skeletal muscle plasticity in Duchenne muscular dystrophy. Trends Mol Med 19, 614 - 624 (2013).

[0254] 6Pauly, M. et al. AMPK activation stimulates autophagy and ameliorates muscular dystrophy in the mdx mouse diaphragm. Am J Pathol 181, 583 - 592 (2012).

[0255] 7Vieira, N. M. et al. Jagged 1 Rescues the Duchenne Muscular Dystrophy Phenotype. Cell 163, 1204 - 1213 (2015).

[0256] 8von Maltzahn, J., Renaud, J. M., Parise, G. & Rudnicki, M. A. Wnt7a treatment ameliorates muscular dystrophy. Proc Natl Acad Sci U S A 109, 20614 - 20619 (2012).

[0257] 9Ambros,V.The functions of animal microRNAs.Nature 431,350-355(2004).

[0258] 10Bartel,D.P.MicroRNAs:target recognition and regulatory functions.Cell 136,215-233(2009).

[0259] 11Zaharieva,I.T. et al.Dystromirs as serum biomarkers for monitoring the disease severity in Duchenne muscular Dystrophy.PLoS One 8,e80263(2013).

[0260] 12Najafi-Shoushtari,S.H. et al.MicroRNA-33and the SREBP host genes cooperate to control cholesterol homeostasis.Science 328,1566-1569(2010).

[0261] 13Motohashi,N.,Alexander,M.S.,Casar,J.C.&Kunkel,L.M.Identification of a novel microRNA that regulates the proliferation and differentiation in muscle side population cells.Stem Cells Dev 21,3031-3043(2012).

[0262] 14Motohashi,N. et al.Regulation of IRS1 / Akt insulin signaling by microRNA-128a during myogenesis.J Cell Sci 126,2678-2691(2013).

[0263] 15Amor, F. et al. Cholesterol metabolism is a potential therapeutic target in Duchenne muscular dystrophy. J Cachexia Sarcopenia Muscle 12, 677 - 693 (2021).

[0264] 16Pambianco, S. et al. Reversal of Defective Mitochondrial Biogenesis in Limb - Girdle Muscular Dystrophy 2D by Independent Modulation of Histone and PGC - 1alpha Acetylation. Cell Rep 17, 3010 - 3023 (2016).

[0265] 17Maciotta, S. et al. Hmgb3 Is Regulated by MicroRNA - 206 during Muscle Regeneration. Plos One 7 (2012). e43464

[0266] 10.1371 / journal.pone.0043464

[0267] 18Rottiers, V. et al. Pharmacological inhibition of a microRNA family in nonhuman primates by a seed - targeting 8 - mer antimiR. Sci Transl Med 5, 212ra162 (2013).

[0268] 19Huang, W. et al. Loss of microRNA - 128 promotes cardiomyocyte proliferation and heart regeneration. Nat Commun 9, 700 (2018).

[0269] 20Ruiz-Velasco, A. et al. Targeting mir128-3p alleviates myocardialinsulin resistance and prevents ischemia-induced heart failure. Elife 9 (2020).

[0270] While the invention has been described in conjunction with its specific embodiments, those skilled in the art will understand that various modifications and substitutions can be made without departing from the true spirit and scope of the invention. Furthermore, numerous modifications can be made to adapt specific circumstances, materials, composition, processes, or one or more process steps to the purpose, spirit, and scope of the invention. All such modifications are intended to be included within the scope of the appended claims.

Claims

1. An inhibitory nucleic acid comprising the following nucleotide sequence: a) 5'-ACCGGTTCACTGTG-3' (SEQ ID NO: 1); or b) 5'-GACCGGTTCACTGTG-3' (SEQ ID NO: 2); or c) 5'-AGACCGGTTCACTGTG-3' (SEQ ID NO: 3), wherein the inhibitory nucleic acid comprises one or more locked nucleic acids (LNA).

2. The inhibitory nucleic acid of claim 1, wherein the inhibitory nucleic acid comprises: i) modified backbones; and / or ii) one or more 5-methyldeoxycytosine residues.

3. The inhibitory nucleic acid according to claim 1 or 2, wherein the inhibitory nucleic acid is 14 to 20 nucleotides in length.

4. The inhibitory nucleic acid of any one of claims 1-3, wherein the inhibitory nucleic acid comprises the nucleotide sequence shown in FIG1A and designated “NRC0090”.

5. The inhibitory nucleic acid of any one of claims 1-3, wherein the inhibitory nucleic acid comprises the nucleotide sequence shown in FIG1A and designated “NRC-0091”.

6. The inhibitory nucleic acid of any one of claims 1-3, wherein the inhibitory nucleic acid comprises the nucleotide sequence shown in FIG1A and designated “NRC-0119”.

7. A pharmaceutical composition comprising: a) an inhibitory nucleic acid according to any one of claims 1 to 6; and b) pharmaceutically acceptable excipients.

8. The pharmaceutical composition of claim 7, wherein the pharmaceutically acceptable excipient comprises one or more lipids.

9. The pharmaceutical composition of claim 7, wherein the pharmaceutically acceptable excipient comprises poly(amidoamine), poly(propyleneimine), or poly(L-lysine).

10. A lipid nanoparticle comprising: a) an inhibitory nucleic acid according to any one of claims 1 to 6; and b) pharmaceutically acceptable excipients.

11. A method of treatment, comprising administering to a subject in need thereof an effective amount of the inhibitory nucleic acid according to any one of claims 1-6, the pharmaceutical composition according to any one of claims 7-9, or the lipid nanoparticle according to claim 10.

12. A method of treating a metabolic disorder in a subject, comprising administering to the subject an effective amount of an inhibitory nucleic acid according to any one of claims 1-6, a pharmaceutical composition according to any one of claims 7-9, or a lipid nanoparticle according to claim 10.

13. The method of claim 12, wherein the metabolic disorder is insulin resistance, hyperglycemia, type 2 diabetes, obesity, fatty liver disease, glucose intolerance, hyperinsulinemia, metabolic syndrome, or hypertension.

14. The method of claim 12, wherein the metabolic disorder comprises insulin resistance.

15. The method of claim 12, wherein the metabolic disorder comprises metabolic syndrome.

16. The method of claim 12, wherein the metabolic disorder comprises type 2 diabetes.

17. The method of any one of claims 12-16, wherein the individual has a body mass index > 30.

0.

18. The method of any one of claims 12-17, wherein the administration results in serum insulin levels within the normal range.

19. The method of any one of claims 12-17, wherein the administration results in blood glucose levels within the normal range.

20. The method of any one of claims 12-19, further comprising administering at least one additional therapeutic agent.

21. The method of claim 20, wherein the at least one additional therapeutic agent is insulin, an insulin analog, a biguanide, or a thiazolidinedione.

22. The method of any one of claims 11-20, wherein the administration is by oral administration.

23. A method of treating muscular dystrophy in a subject, comprising administering to the subject an effective amount of the inhibitory nucleic acid of any one of claims 1-6, the pharmaceutical composition of any one of claims 7-9, or the lipid nanoparticle of claim 10.

24. The method of claim 23, wherein the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

Images