Nanopore sequencing method and kit
Patent Information
- Application Number
- CN202280102552.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-16
- Publication Date
- 2025-07-22
AI Technical Summary
In nanopore sequencing technology, the construction process of sequencing adapter complexes is complex, the yield is low, and the storage conditions are strict. The nascent chains synthesized by polymerases easily form secondary structures and are difficult to be captured by nanopores. The sequencing system is highly complex.
It provides a double-stranded library of target polynucleotides and forms a sequencing complex through the guide sequence and primer pairing region. The polymerase with strand displacement activity is used to extend the guide sequence under the action of electric field force to achieve stable sequencing and avoid secondary strands caused by the continuous synthesis of nascent strands. level structure issues.
It simplifies the sequencing library construction process, improves the preservation and sequencing stability of the sequencing library, avoids complex secondary structures caused by nascent chain synthesis, and reduces the complexity of the sequencing system.
Smart Images

Figure CN120359304A_ABST
Abstract
Description
Nanopore sequencing methods and kits Technical Field
[0001] The present invention belongs to the field of biotechnology. Specifically, the present invention provides a nanopore sequencing method and a kit. Background Art
[0002] Nanopore sequencing is a single-molecule detection technology with advantages such as fast sequencing speed, long sequencing read length, direct sequencing, high throughput, low cost, small size, and portability. During nanopore sequencing, a single nanopore is embedded in an insulating, impermeable membrane, forming a stable ionic current channel. A voltage is applied to allow a single-stranded nucleic acid molecule to pass through the nanopore, thereby reducing the ionic current flowing through the nanopore. Due to the differences in molecular structure and size of the different bases on a single-stranded nucleic acid molecule, the current flowing through the nanopore exhibits differences corresponding to the base sequence. Using an algorithm to analyze the current change signal, the sequence of the perforated single-stranded nucleic acid can be read in real time. However, the rapid speed of uncontrolled single-stranded nucleic acid passing through the nanopore makes the generated electrical signal difficult to interpret. Furthermore, during the normal sequencing process, double-stranded nucleic acid must first be converted to single-stranded nucleic acid before it can pass through the nanopore and be sequenced.
[0003] Therefore, different strategies have been developed in the prior art to control the conversion of the target double-stranded nucleic acid to be detected into single-stranded nucleic acid at a relatively stable speed, thereby allowing the single-stranded nucleic acid to pass through the nanopore at a relatively stable speed to complete sequencing.
[0004] Patent publications CN105209634A and CN106460061A disclose the following sequencing technology routes. (1) A Y-type sequencing adapter complex is used, wherein the top chain of the adapter consists of a "guide sequence + helicase binding site + spacer sequence + sequence complementary to the bottom chain", and the bottom chain of the adapter consists of a "sequence complementary to the top chain + sequence complementary to the tether sequence". The top and bottom chains are annealed to form a sequencing adapter, and the helicase binds to the "helicase binding site" of the top chain in the adapter and stops at the spacer sequence; (2) The nucleic acid to be tested is connected to the Y-type sequencing adapter complex to obtain a sequencing library; (3) The sequencing library, the tether sequence and the sequencing buffer are added to a sequencing fluid tank embedded with a nanopore. In the cell, the constraint sequence binds the sequencing library to the polymer membrane embedded with nanopore protein; (4) when the sequencing library is not captured by the nanopore, the helicase cannot unwind the nucleic acid double strand due to the presence of the restriction sequence. When the sequencing library is captured by the nanopore, under the action of the electric field force, the helicase moves and passes through the restriction sequence, unwinding the nucleic acid double strand at a relatively stable speed to achieve sequencing. The disadvantages of this technical route are: (1) the Y-type sequencing adapter complex used is a helicase-nucleic acid complex, and the adapter complex construction process is complicated and the yield is low; (2) the sequencing library constructed using the Y-type sequencing adapter complex needs to maintain the biochemical activity of the helicase and the integrity of the nucleic acid at the same time. The storage conditions are strict and it is difficult to store it for a long time. Sequencing must be carried out as soon as possible.
[0005] The US patent US10480027B2 discloses the following sequencing technology route. (1) A polymerase-nucleic acid complex is provided, which contains a chain displacement polymerase and a circular nucleic acid template, and provides the components required for nucleic acid synthesis, thereby polymerizing to produce a newly synthesized chain. (2) As time goes by, the newly synthesized chain passes through the nanopore, and the sequence of the newly synthesized chain is determined by measuring the change in current. Patent publication CN113366120A also discloses a similar technical route. The disadvantage of this type of technical route is that before the newly synthesized DNA chain is captured by the nanopore, the synthesis of the newly synthesized chain is ongoing and uncontrolled. The newly synthesized chain is prone to form a complex secondary structure, which is difficult to be captured by the nanopore and complete sequencing.
[0006] Therefore, there is a need in the art for improved nanopore sequencing technology.
[0007] Summary of the Invention
[0008] The present invention aims to at least partially resolve or improve one or more of the following problems in nanopore sequencing technology: the complex construction process of sequencing adapter complexes, low yield, stringent storage conditions, and difficulty in long-term storage; the nascent chains synthesized using polymerases easily form secondary structures before passing through the nanopore; and the high complexity of the sequencing system.
[0009] Therefore, in a first aspect, the present invention provides a nanopore sequencing method, comprising:
[0010] 1) providing a sequencing library, wherein the sequencing library comprises a target polynucleotide duplex, wherein the target polynucleotide duplex comprises a first strand and a second strand, wherein the 5' end of the first strand and the 3' end of the second strand comprise an unpaired first single-stranded region, the 5' end of the first single-stranded region of the first strand comprises a guide sequence, and the 3' end of the first single-stranded region of the second strand comprises a second primer pairing region;
[0011] 2) incubating a first primer with the sequencing library to form a sequencing complex, wherein the first primer binds to the pairing region of the second primer through the principle of base complementary pairing, the first primer has a 3' free end, and the complex is attached to a membrane embedded with a nanopore through the 5' end of the first primer;
[0012] 3) allowing a polymerase with strand displacement activity to extend the first primer using the second strand as a template; under the action of an electric field, the guide sequence is captured by the nanopore on the membrane and passes through the nanopore; as the extension proceeds, the first strand is displaced and passes through the nanopore;
[0013] 4) detecting the change in the electrical signal generated when the first strand passes through the nanopore during the extension process, and determining the sequence information of the first strand of the target polynucleotide double strand.
[0014] In a preferred embodiment, in 1), the 3' end of the first chain and the 5' end of the second chain are completely complementary to each other to form a pairing region.
[0015] In a preferred embodiment, in 1), the target polynucleotide double strand further comprises: the 3' end of the first strand and the 5' end of the second strand comprise a non-paired second single-stranded region, and the 3' end of the second single-stranded region of the first strand comprises a first primer pairing region.
[0016] In a preferred embodiment, in 2), the first primer, the second primer and the sequencing library are incubated to form a sequencing complex, wherein the first primer and the second primer pairing region are bound by the base complementary pairing principle, the second primer and the first primer pairing region are bound by the base complementary pairing principle, and the complex is fixed on a membrane embedded with a nanopore through the 5' end of the first primer and / or the second primer.
[0017] In a preferred embodiment, the method further comprises: 5) polymerase extending the second primer using the first chain as a template, so that the first chain exits the nanopore on the membrane in the direction opposite to the electric field, detecting the change in the electrical signal generated when the first chain exits the nanopore, and re-determining the sequence information of the first chain of the target polynucleotide double chain.
[0018] In a preferred embodiment, the 5' end of the second strand contains a leader sequence.
[0019] In a preferred embodiment, in 1), the target polynucleotide duplex further comprises: the 3' end of the first strand and the 5' end of the second strand are connected, so that the target polynucleotide duplex has a hairpin structure at the end.
[0020] In a preferred embodiment, the method further includes 5) after extending to the hairpin structure, the polymerase continues to extend using the first chain as a template, so that the first chain exits the nanopore on the membrane in the direction opposite to the electric field, detecting the change in the electrical signal generated when the first chain exits the nanopore, and re-determining the sequence information of the first chain of the target polynucleotide double chain.
[0021] In certain embodiments, the polymerase having strand displacement activity is a polymerase having salt tolerance.
[0022] In certain embodiments, the polymerase having strand displacement activity is a DNA polymerase or an RNA polymerase, such as Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, E. coli RNA polymerase, or any combination thereof; or the polymerase is a polymerase having strand displacement activity after being modified from a polymerase without strand displacement activity, such as T4 DNA polymerase, T7 DNA polymerase, DNA polymerase I, or any combination thereof.
[0023] In one embodiment, a target polynucleotide double-stranded chain is prepared by connecting a Y-shaped linker to the polynucleotide double-stranded chain, wherein the Y-shaped linker includes a guide sequence and a primer pairing region. After connecting to the polynucleotide double-stranded chain, the 5' end of the first chain of the obtained target polynucleotide contains the guide sequence, and the 3' end of the second chain includes a second primer pairing region.
[0024] In one embodiment, the primer is a single-stranded nucleic acid, preferably less than 80 nucleotides in length, such as less than 70, 60 or 50 nucleotides in length.
[0025] In one embodiment, the 5' end of the primer is linked to a hydrophobic molecule, preferably selected from any one or more of the following: lipids, fatty acids, sterols, carbon nanotubes, polypeptides, proteins and / or amino acids, such as cholesterol, palmitate or tocopherol.
[0026] In one embodiment, the guide sequence comprises a polynucleotide or a plurality of iSpC3. Preferably, the polynucleotide is a homopolymeric polynucleotide.
[0027] In one embodiment, the guide sequence may be 10-50 nucleotides or iSpC3 in length, such as 20, 30 or 40 nucleotides or iSpC3 in length.
[0028] In certain embodiments, the nanopore is a transmembrane protein pore or a solid-state pore.
[0029] In certain embodiments, the transmembrane protein pore is selected from hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG, GspD, or any combination thereof.
[0030] In certain embodiments, the nanopore is further linked to an additional polypeptide, wherein the additional polypeptide is selected from a tag, an enzyme cleavage site, a signal peptide or a leader peptide, a detectable label, or any combination thereof.
[0031] In certain embodiments, the membrane is an amphiphilic membrane (eg, a phospholipid bilayer), a high molecular polymer membrane (eg, a di-block copolymer, a tri-block copolymer), or any combination thereof.
[0032] In certain embodiments, an inhibitory segment that inhibits polymerase chain displacement polymerization activity is linked to the 3' end of the leader sequence.
[0033] In certain embodiments, the inhibitory segment is a GC-rich motif, an artificially modified nucleotide, other inhibitory molecules, or any combination thereof.
[0034] In certain embodiments, the artificially modified nucleotide is LNA, PNA, BNA, or any combination thereof.
[0035] In certain embodiments, the artificially modified nucleotides are LNAs, and the number of the artificially modified nucleotides is 2-10, preferably 4-8.
[0036] In certain embodiments, the method is performed in the following buffer or sequencing buffer: dihydrogen phosphate-dihydrogen phosphate buffer system, carbonic acid-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, MOPS buffer system or any combination thereof.
[0037] In certain embodiments, the reaction buffer or sequencing buffer contains NTPs, dNTPs, ddNTPs, or any combination thereof.
[0038] In certain embodiments, the reaction buffer or sequencing buffer contains K+, Na+, or any combination thereof.
[0039] In certain embodiments, the reaction buffer or sequencing buffer contains Mg2+, Mo2+, Cu2+, Fe2+, Zn2+, Ca2+, Pb2+, Cd2+, or any combination thereof.
[0040] In certain embodiments, the reaction buffer or sequencing buffer contains additives or auxiliary reagents commonly used to enhance polymerase extension reactions, such as dimethyl sulfoxide (DMSO), glycerol, formamide, bovine serum albumin (BSA), ammonium sulfate ((NH4)2SO4), polyethylene glycol (PEG), gelatin, non-ionic detergents (such as Tween 20, Trtion X-100), N,N,N-trimethylglycine (betaine), single-stranded nucleic acid binding protein or any combination thereof.
[0041] In certain embodiments, a voltage is applied to both sides of the membrane to form an electric field force. In certain embodiments, the voltage is above 10 mV, preferably a voltage of 50 mV-250 mV.
[0042] In a second aspect, the present invention provides a kit comprising:
[0043] A Y-shaped linker for ligating to a double-stranded nucleotide, wherein the two chains of the Y-shaped linker respectively include a guide sequence and a primer pairing region, so that after ligation to the double-stranded nucleotide, the 5' end of the first chain of the obtained target polynucleotide contains the guide sequence, and the 3' end of the second chain includes the primer pairing region;
[0044] Nanopores;
[0045] membrane;
[0046] a primer, wherein the primer is complementary to the primer pairing region, and the 5' end of the primer has a fixing component for attaching to the membrane;
[0047] a polymerase with strand displacement activity;
[0048] Buffer system for polymerization reaction.
[0049] In certain embodiments, the nanopore is embedded in the membrane.
[0050] In certain embodiments, an inhibitory segment that inhibits polymerase chain displacement polymerization activity is linked to the 3' end of the leader sequence.
[0051] In certain embodiments, the inhibitory segment is a GC-rich motif or an artificially modified nucleotide.
[0052] In certain embodiments, the artificially modified nucleotide is LNA, PNA, BNA, or any combination thereof.
[0053] In certain embodiments, the artificially modified nucleotides are LNAs, and the number of the artificially modified nucleotides is 2-10, preferably 4-8.
[0054] In certain embodiments, the primer is a single-stranded nucleic acid, preferably less than 80 nucleotides in length, such as less than 70, 60, or 50 nucleotides in length.
[0055] In certain embodiments, the 5' end of the primer is linked to a hydrophobic molecule, preferably selected from any one or more of the following: lipids, fatty acids, sterols, carbon nanotubes, polypeptides, proteins and / or amino acids, such as cholesterol, palmitate or tocopherol.
[0056] In certain embodiments, the guide sequence comprises a polynucleotide or iSpC3.
[0057] In certain embodiments, the guide sequence may be 10-50, eg, 20, 30, or 40 nucleotides in length or iSpC3.
[0058] In certain embodiments, the polymerase having strand displacement activity is a DNA polymerase or an RNA polymerase.
[0059] In certain embodiments, the polymerase having strand displacement activity is a salt-tolerant polymerase.
[0060] In certain embodiments, the polymerase is a polymerase without strand displacement activity that has been modified to have strand displacement activity.
[0061] In certain embodiments, the polymerase having strand displacement activity is a DNA polymerase or an RNA polymerase, such as Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, E. coli RNA polymerase, or any combination thereof; or the polymerase is a polymerase having strand displacement activity after being modified from a polymerase without strand displacement activity, such as T4 DNA polymerase, T7 DNA polymerase, DNA polymerase I, or any combination thereof.
[0062] In certain embodiments, the nanopore is a transmembrane protein pore or a solid-state pore.
[0063] In certain embodiments, the transmembrane protein pore is selected from hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, Phi29 connector protein, InvG, GspD, or any combination thereof.
[0064] In certain embodiments, the nanopore is further linked to an additional polypeptide, wherein the additional polypeptide is selected from a tag, an enzyme cleavage site, a signal peptide or a leader peptide, a detectable label, or any combination thereof.
[0065] In certain embodiments, the membrane is an amphiphilic membrane, a high molecular polymer membrane, or any combination thereof.
[0066] In certain embodiments, the membrane is a phospholipid bilayer, a diblock copolymer, or a triblock copolymer.
[0067] In certain embodiments, the buffer system for performing the polymerization reaction is a dihydrogen phosphate-hydrogen phosphate buffer system, a carbonic acid-sodium bicarbonate buffer system, a Tris-HCl buffer system, a HEPES buffer system, a MOPS buffer system, or any combination thereof.
[0068] In certain embodiments, the buffer system for performing the polymerization reaction contains NTP, dNTP, ddNTP or any combination thereof.
[0069] In certain embodiments, the buffer system for the polymerization reaction contains additives or auxiliary reagents commonly used to enhance polymerase extension reactions, such as dimethyl sulfoxide (DMSO), glycerol, formamide, bovine serum albumin (BSA), ammonium sulfate ((NH4)2SO4), polyethylene glycol (PEG), gelatin, non-ionic detergents (such as Tween 20, Trtion X-100), N,N,N-trimethylglycine (betaine), single-stranded nucleic acid binding protein or any combination thereof.
[0070] In a third aspect, the present invention provides use of the kit of the second aspect of the present invention in high-throughput sequencing, wherein the high-throughput sequencing is preferably nanopore sequencing.
[0071] The advantages of the present invention include one or more of the following: the sequencing library and sequencing adapters of the present invention are simple in structure, the sequencing library construction process is simple, and the sequencing library can be stored for a long time. In the method of the present invention, a polymerase with strand displacement activity unwinds the double-stranded DNA and synthesizes nascent strands at a relatively stable rate, resulting in a relatively stable perforation rate for the sequencing strands. The method of the present invention only continues DNA synthesis and the generation of nascent strands after the sequencing library is captured by the nanopore. Therefore, the problem of "continuous synthesis of nascent strands before the sequencing library is captured by the nanopore, resulting in complex secondary structures and subsequent inability to perform normal sequencing" can be avoided. BRIEF DESCRIPTION OF THE DRAWINGS
[0072] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0073] FIG1 shows a schematic diagram of a nanopore sequencing method according to one embodiment of the present invention.
[0074] FIG2 shows a schematic diagram of a nanopore sequencing method according to another embodiment of the present invention.
[0075] FIG3 shows a schematic diagram of a nanopore sequencing method according to another embodiment of the present invention.
[0076] Figure 4 shows the experimental schematics of Example 1 and Example 2, (a) polynucleotide chains A and B anneal to form a Y-shaped nucleic acid duplex structure, (b) chain A contains 2 LNAs, 4 LNAs, and 8 LNAs (indicated by bold black lines).
[0077] Figure 5 shows the electrophoresis of the Y-shaped nucleic acid duplex annealing products of Examples 1 and 2. Lanes 1-4 are the annealing products of SEQ.1+SEQ.2 (Y-0LNA), SEQ.4+SEQ.2 (Y-2LNA), SEQ.5+SEQ.2 (Y-4LNA), and SEQ.6+SEQ.2 (Y-8LNA), respectively, with arrows indicating Y-shaped nucleic acid duplexes; lanes 5-9 are SEQ.1, SEQ.4, SEQ.5, SEQ.6, and SEQ.2, respectively; and lane 10 is a DNA molecular weight standard.
[0078] FIG6 shows the screening of polymerases having strand displacement activity and salt tolerance in Example 1.
[0079] Figure 7 shows the inhibition of polymerase chain displacement polymerization activity by modified nucleotides in the non-template strand detected in Example 2. The non-template strand of Y-0LNA contains 0 LNAs, the non-template strand of Y-2LNA contains 2 LNAs, the non-template strand of Y-4LNA contains 4 LNAs, and the non-template strand of Y-8LNA contains 8 LNAs.
[0080] FIG8 shows a schematic diagram of sequencing library construction in Example 3, (a) a schematic diagram of a sequencing adapter, and (b) a schematic diagram of a sequencing library.
[0081] FIG9 shows an electrophoresis gel image of the sequencing library in Example 3.
[0082] FIG10 shows a schematic diagram of the sequencing complex of Example 4.
[0083] FIG11 shows a typical current signal diagram of a target polynucleotide to be sequenced in nanopore sequencing in Example 4.
[0084] FIG12 shows the specific structure of iSp18 used in the embodiment.
[0085] FIG13 shows the specific structure of iSpC3 used in the examples. DETAILED DESCRIPTION
[0086] In order to make the above and other features and advantages of the present invention clearer, the present invention is further described below with reference to the accompanying drawings. It should be understood that the specific embodiments given herein are for the purpose of explaining to those skilled in the art and are merely exemplary and non-restrictive. For those of ordinary skill in the art, the specific meanings of terms in the present invention can be understood according to specific circumstances, unless otherwise clearly defined. In addition, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, unless otherwise contradictory.
[0087] Figure 1 shows an exemplary process of the nanopore sequencing method of the present invention. A Y-shaped double-stranded sequencing adapter (the structure circled by the hexagon in the figure) is formed by annealing the top chain and the bottom chain. The Y-shaped double-stranded sequencing adapter is connected to one end of the double-stranded target polynucleotide to construct a sequencing library. The constructed sequencing library can be stored for a long time according to the method of conventional double-stranded polynucleotides. The constructed sequencing library consists of chain A and chain B, wherein chain B is the sequencing chain and chain A is the complementary chain of the sequencing chain. The 3' end of chain A can be complementary to the primer chain C; the 5' end of chain B is the guide sequence (represented by a black dotted line in the figure, refer to patent publication CN 103733063A), and the inhibitory segment connected to the 3' end of the guide sequence is the inhibitory segment (represented by a bold black line in the figure). The inhibitory segment can inhibit the chain displacement polymerization activity of the polymerase. The specific form of the inhibitory segment is not limited, as long as it is a molecule that can inhibit the chain displacement polymerization activity of the polymerase. For example, the inhibitory segment can be a GC-rich motif with stronger binding force, artificially modified nucleotides (such as LNA, PNA, BNA) or other inhibitory molecules. The guide sequence and the inhibitory segment are both on the B chain. The entire sequencing process is as follows: (1) The sequencing library (A chain and B chain), primer (C chain), and polymerase with chain displacement activity (represented by an ellipse in the figure) are mixed and incubated; the C chain binds to the 3' end of the A chain, and the polymerase with chain displacement activity binds to the target polynucleotide, thereby forming a sequencing complex. (2) The polymerase with chain displacement activity uses the A chain as a template and the C chain as a primer, and uses the necessary components in the sequencing buffer, such as the pH buffer system, dNTP, Mg 2+ etc., to initiate the chain displacement polymerization reaction. With chain A as the template, chain B is displaced and chain C is extended until the chain displacement polymerization activity of the polymerase is inhibited by the inhibitory segment. Since the 5' end of chain C is connected to a hydrophobic molecule such as cholesterol (represented by a circle in the figure), the sequencing complex is bound to the membrane material near the nanopore under the action of hydrophobic molecules such as cholesterol (the membrane is represented by a square in the figure, and the middle channel represents the nanopore, refer to patent publication CN103733063A). The 5' end of the primer can also be connected to other hydrophobic molecules, such as lipids, fatty acids, sterols, carbon nanotubes, polypeptides, proteins and / or amino acids, such as palmitate and tocopherol. The primer can also contain a variety of natural or non-natural modified nucleotides. After the sequencing voltage is applied, under the action of the electric field force, the guide sequence at the 5' end of the sequencing chain B chain is captured by the nanopore and passes through the nanopore (represented by a downward arrow in the figure). (3) Under the action of the electric field force, the inhibitory segment passes through the nanopore. The polymerase with strand displacement activity uses strand A as a template, displacing strand B and extending strand C at a steady rate. (4) Strand B is displaced at a relatively steady rate and passes through the nanopore at a relatively steady rate, achieving stable sequencing. (5) Strand C extends to the end of strand A, forming a new duplex. The displaced strand B then passes completely through the nanopore, completing the sequencing.
[0088] Figure 2 shows another exemplary process of the nanopore sequencing method of the present invention. A Y-shaped double-stranded sequencing adapter is formed by annealing the top chain and the bottom chain, and the Y-shaped double-stranded sequencing adapter 1 is connected to one end of the target polynucleotide double chain, and the Y-shaped double-stranded sequencing adapter 2 is connected to the other end of the target polynucleotide double chain, thereby constructing a sequencing library. The specific sequences of Y adapter 1 and Y adapter 2 are not limited, and they can be the same or different. The constructed sequencing library can be stored for a long time with reference to the method of conventional double-stranded polynucleotides. The sequencing library consists of chain A and chain B, wherein chain B is the sequencing chain and chain A is the complementary chain of the sequencing chain. The 3' end of chain A can be complementary to the primer C chain, and the 5' end is the guide sequence 1 (represented by the black dotted line in the figure). Connected to the 3' end of the guide sequence 1 is the inhibitory segment 1 (represented by the bold black line segment in the figure), and the inhibitory segment 1 can inhibit the chain displacement polymerization activity of the polymerase. The specific form of the inhibitory segment 1 is not limited, as long as it is a molecule that can inhibit the chain displacement polymerization activity of the polymerase. For example, the inhibitory segment 1 can be a GC-rich motif with stronger binding ability, artificially modified nucleotides (such as LNA, PNA, BNA), or other inhibitory molecules. The guide sequence 1 and the inhibitory segment 1 are both on the A chain. Similarly, the 3' end of the B chain can be complementary to the primer C' chain, and the 5' end is the guide sequence 2. The inhibitory segment 2 is connected to the 3' end of the guide sequence 2 (represented by a bold black line segment in the figure). The inhibitory segment 2 can inhibit the strand displacement polymerization activity of the polymerase. The specific form of the inhibitory segment 2 is not limited, as long as it is a molecule that can inhibit the strand displacement polymerization activity of the polymerase. For example, the inhibitory segment 2 can be a GC-rich motif with stronger binding ability, artificially modified nucleotides (such as LNA, PNA, BNA), or other inhibitory molecules. The guide sequence 2 and the inhibitory segment 2 are both on the B chain. The entire sequencing process is as follows: (1) The sequencing library (chain A and chain B) is mixed with primers (chain C and chain C'), and a polymerase with strand displacement activity (indicated by an ellipse in the figure) and incubated; the C chain is complementary to the 3' end of the A chain, and the C' chain is complementary to the 3' end of the B chain; the polymerase with strand displacement activity binds to the target polynucleotide, thereby forming a sequencing complex. (2) At one end of the double-stranded target polynucleotide, the polymerase with strand displacement activity uses chain A as a template and chain C as a primer, and utilizes the necessary components in the sequencing buffer, such as the pH buffer system, dNTPs, and Mg2+, to initiate a strand displacement polymerization reaction, using chain A as a template, displacing chain B, and extending chain C until the strand displacement polymerization activity of the polymerase is inhibited by the inhibitory segment 2. Similarly, at the other end of the target polynucleotide double strand, a polymerase with chain displacement activity uses the B chain as a template and the C' chain as a primer, and utilizes the necessary components in the sequencing buffer, such as the pH buffer system, dNTPs, Mg2+, etc., to initiate a chain displacement polymerization reaction, using the B chain as a template, displacing the A chain, and extending the C' chain until the chain displacement polymerization activity of the polymerase is inhibited by the inhibitory segment 1.Since the 5' ends of the C chain and the C' chain are connected to hydrophobic molecules such as cholesterol (represented by circles in the figure), the sequencing complex is bound to the membrane material near the nanopore under the action of hydrophobic molecules such as cholesterol (the membrane is represented by squares in the figure, and the middle channel represents the nanopore). After the sequencing voltage is applied, under the action of the electric field force, the guide sequence 2 at the 5' end of the sequencing chain B chain is captured by the nanopore and passes through the nanopore (represented by a downward arrow in the figure). (3) Under the action of the electric field force, the inhibitory segment 2 of the B chain passes through the nanopore. The polymerase with chain displacement activity uses the A chain as a template, displaces the B chain, and extends the C chain at a stable rate. (4) The B chain is displaced at a relatively stable rate and passes through the nanopore at a relatively stable rate, achieving stable sequencing. (5) The C chain extends to the end of the A chain to form a new nucleic acid duplex, and the displaced B chain passes through the nanopore until it encounters the polymerase at the other end. The polymerase uses the necessary components in the sequencing buffer, such as the pH buffer system, dNTP, Mg2+, etc., to initiate the polymerization reaction, using the B chain as a template and extending the C' chain. (6) As the C' strand extends, strand B is pulled out of the nanopore at a relatively steady rate, in the opposite direction of the electric field (indicated by the upward arrow in the figure). (7) The C' strand extends to the 5' end of strand B, forming a new nucleic acid duplex, and strand B is completely pulled out of the nanopore. The entire process sequences the same strand B twice.
[0089] FIG3 shows another exemplary process of the nanopore sequencing method of the present invention. A Y-shaped double-stranded sequencing adapter is formed by annealing the top chain and the bottom chain, and a hairpin-type adapter is formed by annealing a single chain. One end of the double-stranded target polynucleotide is connected to the Y-shaped double-stranded sequencing adapter, and the other end is a hairpin structure. For example, a hairpin structure is formed by connecting the hairpin-type adapter to construct a sequencing library. The constructed sequencing library can be stored for a long time according to the method of conventional double-stranded polynucleotides. The constructed sequencing library consists of chain A and chain B, wherein chain B is the sequencing chain and chain A is the complementary chain of the sequencing chain. The 3' end of chain A is complementary to the primer chain C; the 5' end of chain B is a guide sequence (represented by a black dotted line in the figure), and connected to the 3' end of the guide sequence is an inhibitory segment (represented by a bold black line segment in the figure). The inhibitory segment can inhibit the chain displacement polymerization activity of the polymerase. The specific form of the inhibitory segment is not limited, as long as it is a molecule that can inhibit the chain displacement polymerization activity of the polymerase. For example, the inhibitory segment can be a GC-rich motif with stronger binding force, artificially modified nucleotides (such as LNA, PNA, BNA), or other inhibitory molecules. The guide sequence and the inhibitory segment are both on the B chain. The entire sequencing process is as follows: (1) The sequencing library (A chain and B chain), primer (C chain), and polymerase with chain displacement activity (represented by an ellipse in the figure) are mixed and incubated; the C chain binds to the 3' end of the A chain, and the polymerase with chain displacement activity binds to the target polynucleotide, thereby forming a complex to be sequenced. (2) The polymerase with chain displacement activity uses the A chain as a template and the C chain as a primer, and uses the necessary components in the sequencing buffer, such as the pH buffer system, dNTP, Mg2+, etc., to initiate the chain displacement polymerization reaction. Using the A chain as a template, it displaces the B chain and extends the C chain until the chain displacement polymerization activity of the polymerase is inhibited by the inhibitory segment. Since the 5' end of the C chain is connected to a hydrophobic molecule such as cholesterol (represented by a circle in the figure), the sequencing complex is bound to the membrane material near the nanopore under the action of hydrophobic molecules such as cholesterol (the membrane is represented by a square in the figure, and the middle channel represents the nanopore). After the sequencing voltage is applied, the guide sequence at the 5' end of the sequencing chain B chain is captured by the nanopore under the action of the electric field force and passes through the nanopore (represented by a downward arrow in the figure). (3) Under the action of the electric field force, the inhibition segment passes through the nanopore. The polymerase with chain displacement activity uses the A chain as a template to displace the B chain and extend the C chain at a stable speed. (4) The B chain is displaced at a relatively stable speed and passes through the nanopore at a relatively stable speed, achieving stable sequencing. (5) The C chain extends to the end of the A chain, the hairpin structure is opened, and the polymerase uses the original hairpin structure sequence and the B chain as a template to continue to extend the C chain. As the C chain extends, the B chain is pulled out of the nanopore at a relatively stable speed against the direction of the electric field force (represented by an upward arrow in the figure). (6) Chain C extends to the end of chain B, forming a new nucleic acid duplex, and chain B is completely pulled out of the nanopore. The entire process sequences the same chain B twice.
[0090] In the present invention, the polymerase having strand displacement activity can be selected from a DNA polymerase or an RNA polymerase, such as Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, E. coli RNA polymerase or any combination thereof; or the polymerase is a polymerase having strand displacement activity after being modified from a polymerase without strand displacement activity, such as T4 DNA polymerase, T7 DNA polymerase, DNA polymerase I or any combination thereof.
[0091] Example 1: Screening for a salt-tolerant polymerase with strand displacement activity.
[0092] FIG4 (a) shows a schematic diagram of the experiment of Example 1. Polynucleotides SEQ.1 (A chain) and SEQ.2 (B chain) anneal to form a Y-shaped nucleic acid duplex structure, named Y-OLNA; SEQ.3 (C chain) is 15 nt in length, with a CY3 fluorescent modification (indicated by a star symbol) at the 5' end, and is complementary to the 3' end of SEQ.2 (B chain); a polymerase (indicated by an ellipse symbol) binds to the nucleic acid complex. FIG13 shows the specific structure of iSpC3. In the reaction buffer, the polymerase uses the B chain as a template and extends the C chain; if the polymerase is inactive, the C chain cannot be extended and remains 15 nt; if the polymerase lacks strand displacement polymerization activity, the A chain cannot be displaced and can only extend the C chain to 21 nt; if the polymerase has strand displacement polymerization activity, the A chain can be completely displaced, extending the C chain to 48 nt; the length of the C chain is detected by electrophoresis.
[0093] 1. Annealing of Y-shaped nucleic acid duplexes.
[0094] 1) Dissolve SEQ.1, SEQ.2, and SEQ.3 in TE buffer (pH=8) according to the manufacturer's instructions to a final concentration of 100 μM stock solution.
[0095] 2) Anneal SEQ. 1 and SEQ. 2 to form a Y-shaped nucleic acid duplex, designated Y-OLNA. The annealing process consisted of incubating at 95°C for 5 minutes, cooling at a rate of 0.1°C / s to 25°C, and continuing to incubate for 30 minutes. The annealing reaction system is shown in Table 1.
[0096] Table 1 Y-shaped nucleic acid duplex annealing reaction system
[0097]
[0098]
[0099] 3) Polynucleotide SEQ.1, as strand A, was annealed with SEQ.2, as strand B. The polynucleotide and annealing product were subjected to 15% TBE native polyacrylamide gel electrophoresis at 200V for 1 hour. The electrophoresis results are shown in Figure 5. Lane 1 shows the annealing product of SEQ.1 + SEQ.2 (Y-OLNA), with the arrow indicating the Y-shaped nucleic acid duplex. Lane 5 shows SEQ.1, lane 9 shows SEQ.2, and lane 10 shows a DNA molecular weight standard (Thermo Scientific, SM1313). These results demonstrate that SEQ.1 and SEQ.2 can form a Y-shaped nucleic acid duplex as expected.
[0100] 2. Screening of salt-tolerant polymerases with strand displacement activity.
[0101] 1) As shown in Figure 4 (a), the annealed product of SEQ.1 and SEQ.2 (chain A + chain B), Y-OLNA, with SEQ.3 (chain C) having a CY3 fluorescent modification at the 5' end, a polymerase with strand displacement activity, and a reaction buffer containing a high concentration of salt ions were mixed and incubated at 30°C for 1 hour. The polymerases with strand displacement activity tested were: BST+ (ArcticZymes Technologies, 71502-201); SD+ (ArcticZymes Technologies, 71501-201); Klenow Fragment (NEB, M0212S); Bsu Large Fragment (NEB, M0330S); and phi29 (NEB, M0269S). The reaction buffers were: reaction buffer 1 (final concentration: 0.15 M KCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM dNTP, pH = 7.90); reaction buffer 2 (final concentration: 0.30 M KCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM dNTP, pH = 8.10). The polymerase reaction system is shown in Table 2.
[0102] Table 2 Polymerase reaction system
[0103]
[0104] 2) Mix 10 μL of the reaction product with 10 μL of 2× loading buffer (Invitrogen, AM8546G) and treat at 95°C for 10 minutes. The sample was subjected to 20% TBU denaturing polyacrylamide gel electrophoresis at 200V for 1 hour. CY3 fluorescence was detected after the electrophoresis. The electrophoresis results are shown in Figure 6. Lane 1 shows SEQ.3 with a CY3 fluorescent modification at the 5' end, serving as a negative control (NC). Lanes 2-3 show polymerase BST+, lanes 4-5 show polymerase SD+, lanes 6-7 show polymerase Klenow Fragment, lanes 8-9 show polymerase Bsu Large Fragment, and lanes 10-11 show polymerase phi29. These are strand displacement polymerization products obtained under 0.15M KCl and 0.30M KCl conditions. The electrophoresis position of the C chain extended to 48 nt is indicated by C-48nt, while the position of the unextended C chain is indicated by C.
[0105] 3) The results shown in Figure 6 indicate that polymerase BST+, polymerase SD+, polymerase Klenow Fragment, and polymerase Bsu Large Fragment all exhibited strand displacement polymerization activity under high-salt conditions of 0.15 M KCl and 0.30 M KCl. Polymerase phi29 exhibited strand displacement polymerization activity under high-salt conditions of 0.15 M KCl, but had almost no strand displacement polymerization activity under high-salt conditions of 0.30 M KCl.
[0106] Example 2: Detection of the inhibition of polymerase chain displacement polymerization activity by modified nucleotides LNA in the non-template strand.
[0107] Figure 4(b) shows a schematic diagram of the experiment in Example 2. Polynucleotides SEQ.4, SEQ.5, and SEQ.6 contain two LNAs, four LNAs, and eight LNAs, respectively (indicated by bold black segments), serving as A strands. These strands anneal with SEQ.2 (B strand) to form Y-shaped nucleic acid duplexes, designated Y-2LNA, Y-4LNA, and Y-8LNA, respectively. SEQ.3 (C strand) is 15 nt long, with a CY3 fluorescent modification at its 5' end (indicated by a star), and is complementary to the 3' end of SEQ.2 (B strand). A polymerase with strand displacement activity (indicated by an ellipse) binds to the nucleic acid complex. In the reaction buffer, the polymerase uses the B chain as a template to extend the C chain; if the polymerase is inactive, the C chain cannot be extended and remains 15 nt; if the two LNAs, or four LNAs, or eight LNAs contained in SEQ.4, or SEQ.5, or SEQ.6 can inhibit the chain displacement polymerization activity of the polymerase, the A chain cannot be displaced and can only extend the C chain to 21 nt; if the two LNAs, or four LNAs, or eight LNAs contained in SEQ.4, or SEQ.5, or SEQ.6 cannot inhibit the chain displacement polymerization activity of the polymerase, the A chain can be completely displaced, extending the C chain to 48 nt; the length of the C chain is detected by electrophoresis.
[0108] 1. Annealing of Y-shaped nucleic acid duplexes.
[0109] 1) According to the manufacturer's instructions, SEQ.1, SEQ.2, SEQ.3, SEQ.4, SEQ.5, and SEQ.6 were dissolved in TE buffer (pH = 8) to a stock solution with a final concentration of 100 μM.
[0110] 2) Sequences 1, 4, 5, and 6 were individually annealed with SEQ. 2 to form Y-shaped nucleic acid duplexes. The annealing products were designated Y-0LNA, Y-2LNA, Y-4LNA, and Y-8LNA, respectively. Y-0LNA served as a control group without LNA. The annealing process consisted of incubation at 95°C for 5 minutes, followed by a cooling rate of 0.1°C / s to 25°C, and continued incubation for 30 minutes. The annealing reaction system is shown in Table 3.
[0111] Table 3 Y-shaped nucleic acid duplex annealing reaction system
[0112]
[0113] 3) The polynucleotides and annealed products were subjected to 15% TBE native polyacrylamide gel electrophoresis at 200V for 1 hour. The electrophoresis results are shown in Figure 5 . Lanes 1-4 represent the annealing products of SEQ.1 + SEQ.2 (Y-0 LNA), SEQ.4 + SEQ.2 (Y-2 LNA), SEQ.5 + SEQ.2 (Y-4 LNA), and SEQ.6 + SEQ.2 (Y-8 LNA), respectively. Arrows indicate Y-shaped nucleic acid duplexes. Lanes 5-9 represent SEQ.1, SEQ.4, SEQ.5, SEQ.6, and SEQ.2, respectively. Lane 10 contains a DNA molecular weight standard (Thermo Scientific, SM1313). These results demonstrate that SEQ.1 and SEQ.2, SEQ.4 and SEQ.2, SEQ.5 and SEQ.2, and SEQ.6 and SEQ.2 all form Y-shaped nucleic acid duplexes as expected.
[0114] 2. Detect the inhibition of polymerase chain displacement polymerization activity by modified nucleotide LNA in the non-template chain.
[0115] 1) As shown in Figure 4(b), the annealing product of SEQ.1 and SEQ.2 (chain A + chain B) (Y-0 LNA) (serving as a control without LNA), the annealing product of SEQ.4 and SEQ.2 (chain A + chain B) (Y-2 LNA), the annealing product of SEQ.5 and SEQ.2 (chain A + chain B) (Y-4 LNA), or the annealing product of SEQ.6 and SEQ.2 (chain A + chain B) (Y-8 LNA), SEQ.3 (chain C) with a CY3 fluorescent modification at the 5' end, and a polymerase with strand displacement activity were mixed in a reaction buffer containing high salt concentrations and incubated at 30°C for 1 hour. The polymerases with strand displacement activity tested were: BST+ (ArcticZymes Technologies, 71502-201); Klenow Fragment (NEB, M0212S); and Bsu Large Fragment (NEB, M0330S). The reaction buffers were: reaction buffer 2 (final concentration: 0.30 M KCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM dNTP, pH = 8.10). The polymerase reaction system is shown in Table 4.
[0116] Table 4 Polymerase reaction system
[0117]
[0118] 2) Mix 10 μL of the reaction product with 10 μL of 2× loading buffer (Invitrogen, AM8546G) and treat at 95°C for 10 minutes. The sample was subjected to 20% TBU denaturing polyacrylamide gel electrophoresis at 200V for 1 hour. CY3 fluorescence was detected after the electrophoresis. The electrophoresis results are shown in Figure 7. Lanes 1-4 represent the strand displacement polymerization products of polymerase BST+, lanes 6-9 represent polymerase Bsu Large Fragment, and lanes 11-14 represent polymerase Klenow Fragment, all performed under 0.30 M KCl conditions. Lanes 5, 10, and 15 represent SEQ.3 modified with CY3 fluorescence at the 5' end, serving as a negative control (NC). The electrophoresis position of the C chain extended to 48 nt is marked with C-48nt, the position of the C chain extended to 21 nt is marked with C-21nt, and the position of the unextended C chain is marked with C.
[0119] The results shown in Figure 7 indicate that under high salt conditions of 0.30 M KCl, 4 or 8 LNAs in the non-template chain can effectively inhibit the strand displacement polymerization activity of polymerase BST+, polymerase Klenow Fragment, and polymerase Bsu Large Fragment; 2 LNAs in the non-template chain can partially inhibit the strand displacement polymerization activity of polymerase BST+, polymerase Klenow Fragment, and polymerase Bsu Large Fragment.
[0120] Example 3: Construction of sequencing library.
[0121] Figure 8 shows a schematic diagram of sequencing library construction in Example 3. (a) Schematic diagram of sequencing adapter. The top strand (SEQ.7, SEQ.8, SEQ.9) consists of three parts: A, B, and C. A is the guide sequence, consisting of 30 iSpC3s (indicated by black dashed lines in the figure); B is a segment capable of inhibiting polymerase chain displacement polymerization activity (inhibitory segment), consisting of 2, 4, and 8 LNA-modified nucleic acids, respectively (indicated by bold black segments in the figure); C is DNA that complements the bottom strand and has a protruding T at the 3' end. The 5' end of the bottom strand (SEQ.10) is modified with a phosphate group and consists of two parts: D and E. D is a sequence that complements the top strands B and C, and E is a sequence that complements the primer (SEQ.11). Figure 12 shows the specific structure of iSp18. The top and bottom strands are annealed in a 1:1 ratio to form a Y-shaped double-stranded sequencing adapter. The adapters are labeled as follows: the adapter annealing between SEQ.7 and SEQ.10 is labeled Adaptor-2LNA, the adapter annealing between SEQ.8 and SEQ.10 is labeled Adaptor-4LNA, and the adapter annealing between SEQ.9 and SEQ.10 is labeled Adaptor-8LNA. (b) Schematic diagram of the sequencing library. The target polynucleotide (pUC57 plasmid digested and linearized double-stranded DNA) is end-repaired and A-added before being ligated to Y-shaped double-stranded sequencing adapters. After magnetic bead purification, the sequencing library is obtained.
[0122] 1. Annealing of Y-shaped double-stranded sequencing adapters.
[0123] 1) Dissolve SEQ.7, SEQ.8, SEQ.9, and SEQ.10 in TE buffer (pH=8) according to the manufacturer's instructions to a stock solution with a final concentration of 100 μM.
[0124] 2) As shown in Figure 8, SEQ.7, SEQ.8, and SEQ.9 were individually annealed with SEQ.10 to form Y-shaped double-stranded sequencing adapters. The resulting annealing products were named Adaptor-2LNA, Adaptor-4LNA, and Adaptor-8LNA, respectively. The annealing process was incubation at 95°C for 5 minutes, followed by a cooling rate of 0.1°C / s to 25°C, and continued incubation for 30 minutes. The annealing reaction system is shown in Table 5.
[0125] Table 5 Y-shaped double-stranded sequencing adapter annealing reaction system
[0126]
[0127] 2. Connect the Y-shaped double-stranded sequencing adapter and the DNA to be tested to form a sequencing library.
[0128] 1) The pUC57 plasmid (SEQ. 12) was digested with restriction endonucleases EcoRI-HF (NEB, R3101) and HindIII-HF (NEB, R3104) according to the manufacturer's instructions. The reaction conditions were incubation at 37°C for 60 minutes. The digestion reaction system is shown in Table 6.
[0129] Table 6 Enzyme digestion reaction system
[0130]
[0131] 2) The digested product was purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions, and the product concentration was determined using the Qubit dsDNA HS kit (Thermofisher, Q32854).
[0132] 3) Perform end repair and dA-tailing of the digested and purified product using NEBNext FFPE DNA Repair Mix (NEB, M6630) and NEBNext Ultra II End Repair / dA-tailing Module (NEB, E7546) according to the manufacturer's instructions. The reaction conditions were incubation at 20°C for 5 minutes and then at 65°C for 5 minutes. See Table 7 for the end repair and dA-tailing reaction system.
[0133] Table 7 End repair and A addition reaction system
[0134]
[0135] 4) The end-repair and A-addition products were purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions, and the product concentration was determined using the Qubit dsDNA HS kit (Thermofisher, Q32854).
[0136] 5) Perform adapter ligation on the purified product using the NEBNext Quick Ligation Module (NEB, E6056) according to the manufacturer's instructions. The reaction conditions are incubation at 25°C for 10 minutes. The ligation reaction system is shown in Table 8.
[0137] Table 8 Ligation reaction system
[0138]
[0139] 6) Purify the adapter-ligated product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions, and determine the product concentration using the Qubit dsDNA HS kit (Thermofisher, Q32854), resulting in a sequencing library as shown in FIG8 .
[0140] 7) The sequencing libraries were subjected to 6% TBE native polyacrylamide gel electrophoresis at 200V for 2 hours. The electrophoresis results are shown in Figure 9. Lane 1 represents the target polynucleotide before ligation, i.e., double-stranded DNA linearized by enzyme digestion with the pUC57 plasmid. Lanes 2-4 represent the purified products of sequencing adapters containing two, four, and eight LNA-modified nucleic acids ligated to the target polynucleotide, respectively. These are labeled pUC57+Adaptor-2LNA, pUC57+Adaptor-4LNA, and pUC57+Adaptor-8LNA. The electrophoresis position of the ligated sequencing library is indicated by "pUC57+Adaptor," while the electrophoresis position of the target polynucleotide without adapter ligation is indicated by "pUC57." The results shown in Figure 9 indicate that all three sequencing libraries, pUC57+Adaptor-2LNA, pUC57+Adaptor-4LNA, and pUC57+Adaptor-8LNA, were successfully constructed.
[0141] Example 4: Perform nanopore sequencing.
[0142] 1) Incubate the sequencing library pUC57+Adaptor-4LNA with primers (SEQ. 11), a polymerase with strand displacement activity, BST+, and reaction buffer at 30°C for 1 hour to form the sequencing complex shown in Figure 10. In Figure 10, the sequencing library labeled A is complementary to the primer labeled B, which has a cholesterol modification at its 5' end (labeled C). Simultaneously, the primers are incubated with a polymerase with strand displacement activity (labeled D) to form the sequencing complex. The final reaction buffer concentration is 37.5mM KCl, 12.5mM Tris-HCl, 2.5mM MgCl2, pH = 8.10. The sequencing complex incubation system is shown in Table 9.
[0143] Table 9 Sequencing complex incubation reaction system
[0144]
[0145] 2) According to the method disclosed in the literature (Ji Z, Guo P. Channel from bacterial virus T7 DNA packaging motor for the differentiation of peptides composed of a mixture of acidic and basic amino acids. Biomaterials. 2019 May 21; 214: 119-222), a single-channel nanopore detection system based on patch clamp and signal amplifier was constructed to complete a single porin pore. The incubated sequencing complex was added to the single-channel system, and the change in current signal was observed and obtained under 100 mV conditions. The sequencing buffer was 0.30 M KCl, 50 mM Tris-HCl, 10 mM MgCl2, 0.5 mM dNTP, pH = 8.10, marked as the first group.
[0146] The sequencing results are shown in Figure 11. The pUC57+Adaptor-4 LNA sequencing library shows captured sequencing signals, yielding clear graphs of the sequencing signal current amplitude changes. In Figure 11, (a) shows the current signal changes after the nanopore captures the sequencing library. (b) is a magnified view of the signal within the box in (a).
[0147] 3) A second set of tests was performed using the same experimental procedures, except for the use of a different sequencing buffer. The second set of tests used a sequencing buffer of 0.30 M KCl, 50 mM Tris-HCl, 10 mM MgCl2, pH 8.10, which did not contain dNTPs. Consequently, no sequencing signal was captured. See Table 10 for the sequencing buffer and sequencing results.
[0148] Table 10 Sequencing buffer and sequencing results
[0149]
[0150] The results shown in Table 10 indicate that sequencing can be performed using the polymerase BST+ with strand displacement activity and the pUC57+Adaptor-4 LNA sequencing library in the presence of dNTPs in the sequencing buffer, demonstrating that the sequencing scheme of the present invention is feasible.
[0151] Sequence Listing
[0152] SEQ.1:
[0153] 5'XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGGTTGTTTCTGTTGGTGCTGATATTGC 3'(X=iSpC3)
[0154] SEQ.2:
[0155] 5’GCAATATCAGCACCAACAGAAACAACCTCGGGTCGTAAGAATTCTATT 3’
[0156] SEQ.3:
[0157] 5’CY3-AATAGAATTCTTACG 3’
[0158] SEQ.4:
[0159] 5’XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX(LNA_G)(LNA_G)TTGTTTCTGTTGGTGCTGATATTGC 3’(X=iSpC3)
[0160] SEQ.5:
[0161] 5’XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX(LNA_G)(LNA_G)(LNA_T)(LNA_T)GTTTCTGTTGGTGCTGATATTGC 3’(X=iSpC3)
[0162] SEQ.6:
[0163] 5’XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX(LNA_G)(LNA_G)(LNA_T)(LNA_T)(LNA_G)(LNA_T)(LNA_T)(LNA_T)CTGTTGGTGCTGATATTGC 3’(X=iSpC3)
[0164] SEQ.7:
[0165] 5’XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX(LNA_G)(LNA_G)TTGTTTCTGTTGGTGCTGATATTGCT 3’(X=iSpC3)
[0166] SEQ.8:
[0167] 5’XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX(LNA_G)(LNA_G)(LNA_T)(LNA_T)GTTTCTGTTGGTGCTGATATTGCT 3’(X=iSpC3)
[0168] SEQ.9:
[0169] 5’XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX(LNA_G)(LNA_G)(LNA_T)(LNA_T)(LNA_G)(LNA_T)(LNA_T)(LNA_T)CTGTTGGTGCTGATATTGCT 3’(X=iSpC3)
[0170] SEQ.10:
[0171] 5’Phosphorylation-GCAATATCAGCACCAACAGAAACAACCTTTGAGGCGAGCGGTCAA 3’
[0172] SEQ.11:
[0173] 5’Cholesterol-YTTGACCGCTCGC 3’(Y=iSp18)
[0174] SEQ.12:
[0175]
[0176] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.
Claims
1. A nanopore sequencing method, comprising: 1) providing a sequencing library, wherein the sequencing library comprises a target polynucleotide duplex, wherein the target polynucleotide duplex comprises a first strand and a second strand, wherein the 5' end of the first strand and the 3' end of the second strand comprise an unpaired first single-stranded region, the 5' end of the first single-stranded region of the first strand comprises a guide sequence, and the 3' end of the first single-stranded region of the second strand comprises a second primer pairing region; 2) incubating a first primer with the sequencing library to form a sequencing complex, wherein the first primer binds to the pairing region of the second primer through the principle of base complementary pairing, the first primer has a 3' free end, and the complex is attached to a membrane embedded with a nanopore through the 5' end of the first primer; 3) allowing a polymerase with strand displacement activity to extend the first primer using the second strand as a template; under the action of an electric field, the guide sequence is captured by the nanopore on the membrane and passes through the nanopore; as the extension proceeds, the first strand is displaced and passes through the nanopore; 4) detecting the change in the electrical signal generated when the first strand passes through the nanopore during the extension process, and determining the sequence information of the first strand of the target polynucleotide double strand. 2 . The method according to claim 1 , wherein in 1), the 3′ end of the first chain and the 5′ end of the second chain are completely complementary to each other to form a pairing region.
3. The method according to claim 1, in 1), the target polynucleotide double strand further comprises: The 3' end of the first chain and the 5' end of the second chain include a non-paired second single-stranded region, and the 3' end of the second single-stranded region of the first chain includes a first primer pairing region.
4. The method according to claim 3, further comprising: In 2), the first primer, the second primer and the sequencing library are incubated to form a sequencing complex, wherein the first primer and the second primer pairing region are bound by the base complementary pairing principle, the second primer and the first primer pairing region are bound by the base complementary pairing principle, and the complex is fixed on a membrane embedded with a nanopore through the 5' end of the first primer and / or the second primer.
5. The method according to claim 4, further comprising: 5) The polymerase extends the second primer using the first strand as a template, causing the first strand to exit the nanopore on the membrane in the direction opposite to the electric field, detecting the change in the electrical signal generated when the first strand exits the nanopore, and re-determining the sequence information of the first strand of the target polynucleotide duplex. The method according to claim 4 or 5, wherein the 5' end of the second strand contains a leader sequence.
7. The method according to claim 1, in 1), the target polynucleotide double strand further comprises: The 3' end of the first strand and the 5' end of the second strand are connected, so that the double-stranded target polynucleotide has a hairpin structure at the end.
8. The method according to claim 7, further comprising: 5) After extending to the hairpin structure, the polymerase continues to extend the first strand using the first strand as a template, causing the first strand to exit the nanopore on the membrane in the opposite direction of the electric field, detecting the change in the electrical signal generated when the first strand exits the nanopore, and re-determining the sequence information of the first strand of the target polynucleotide double strand.
9. The method according to any one of claims 1 to 8, wherein a target polynucleotide double-strand is prepared by connecting a Y-shaped linker to the polynucleotide double-strand, wherein the two chains of the Y-shaped linker respectively include a guide sequence and a primer pairing region, and after connection with the polynucleotide double-strand, the 5' end of the first chain of the obtained target polynucleotide contains the guide sequence, and the 3' end of the second chain includes the second primer pairing region.
10. The method according to any one of claims 1 to 8, wherein the primer is less than 80, 70, 60 or 50 nucleotides in length. The method according to any one of claims 1 to 8, wherein a hydrophobic molecule is connected to the 5' end of the primer.
12. The method according to claim 11, wherein the hydrophobic molecules are selected from any one or more of the following: lipids, fatty acids, sterols, carbon nanotubes, polypeptides, proteins and / or amino acids.
13. The method according to any one of claims 1 to 8, wherein the guide sequence comprises a polynucleotide or a plurality of iSpC3s.
14. The method according to any one of claims 1 to 8, wherein the guide sequence is 10 to 50 nucleotides in length or iSpC3. 15 . The method according to claim 1 , wherein the 3′ end of the guide sequence is connected to an inhibitory segment that inhibits polymerase chain displacement polymerization activity. The method according to claim 15 , wherein the inhibitory segment is a GC-rich motif or an artificially modified nucleotide. The method according to claim 16 , wherein the artificially modified nucleotide is LNA, PNA, BNA or any combination thereof.
18. The method according to claim 17, wherein the artificially modified nucleotides are LNAs, and the number of the artificially modified nucleotides is 2-10, preferably 4-8.
19. The method according to any one of claims 1 to 8, wherein the polymerase having strand displacement activity is a DNA polymerase or an RNA polymerase. 20 . The method according to claim 19 , wherein the polymerase having strand displacement activity is a salt-tolerant DNA polymerase or RNA polymerase.
21. The method according to claim 19 or 20, wherein the polymerase having strand displacement activity is: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, E. coli RNA polymerase, or any combination thereof.
22. The method according to claim 19 or 20, wherein the polymerase is a polymerase without strand displacement activity that is modified to have strand displacement activity.
23. The method according to claim 22, wherein the polymerase is T4 DNA polymerase, T7 DNA polymerase, DNA polymerase I or any combination thereof that has been modified to have strand displacement activity.
24. The method of any one of claims 1-8, wherein the nanopore is a transmembrane protein pore or a solid-state pore.
25. The method of claim 24, wherein the transmembrane protein pore is selected from hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG, GspD, or any combination thereof.
26. The method according to any one of claims 1 to 8, wherein the nanopore is further connected to another polypeptide, and the other polypeptide is selected from a tag, an enzyme cleavage site, a signal peptide or a leader peptide, a detectable label or any combination thereof.
27. The method according to any one of claims 1 to 8, wherein the membrane is an amphiphilic membrane, a high molecular polymer membrane or any combination thereof.
28. The method of claim 27, wherein the membrane is a phospholipid bilayer, a diblock copolymer, or a triblock copolymer.
29. The method according to any one of claims 1 to 8, wherein the method is performed in the following buffer or sequencing buffer: dihydrogen phosphate-dihydrogen phosphate buffer system, carbonic acid-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, MOPS buffer system, or any combination thereof.
30. The method according to claim 29, wherein the reaction buffer or sequencing buffer contains additives or auxiliary reagents that enhance polymerase extension reaction.
31. The method according to claim 30, wherein the additive or auxiliary agent is selected from dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, non-ionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein or any combination thereof.
32. A kit comprising: A Y-shaped linker for ligating to a double-stranded nucleotide, wherein the two chains of the Y-shaped linker respectively include a guide sequence and a primer pairing region, so that after ligation to the double-stranded nucleotide, the 5' end of the first chain of the obtained target polynucleotide contains the guide sequence, and the 3' end of the second chain includes the primer pairing region; nanopores; membrane; a primer, wherein the primer is complementary to the primer pairing region, and the 5' end of the primer has a fixing component for attaching to the membrane; a polymerase with strand displacement activity; Buffer system for polymerization reaction.
33. The kit of claim 32, wherein the nanopore is embedded in the membrane. The kit according to claim 32 or 33, wherein the 3' end of the guide sequence is connected to an inhibitory segment that inhibits polymerase chain displacement polymerization activity, and the inhibitory segment is a GC-rich motif or artificially modified nucleotides.
35. The kit according to claim 34, wherein the artificially modified nucleotides are LNA, PNA, BNA or any combination thereof; preferably 2-10 LNAs, more preferably 4-8 LNAs.
36. The kit according to claim 32 or 33, wherein the length of the primer is less than 80, 70, 60 or 50 nucleotides, and the 5' end of the primer is connected to a hydrophobic molecule, and the hydrophobic molecule is selected from any one or more of the following: lipids, fatty acids, sterols, carbon nanotubes, polypeptides, proteins and / or amino acids.
37. The kit according to claim 32 or 33, wherein the guide sequence comprises a polynucleotide or a plurality of iSpC3s and is 10-50 nucleotides or iSpC3s in length.
38. The kit according to claim 32 or 33, wherein the polymerase is Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, E. coli RNA polymerase, or any combination thereof, or the polymerase is T4 DNA polymerase modified to have strand displacement activity, T7 DNA polymerase, DNA polymerase I, or any combination thereof.
39. The kit of claim 32 or 33, wherein the nanopore is a transmembrane protein pore or a solid-state pore.
40. The kit of claim 39, wherein the transmembrane protein pore is selected from hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG, GspD, or any combination thereof. The kit according to claim 32 or 33 , wherein the membrane is an amphiphilic membrane, a high molecular polymer membrane or any combination thereof.
42. The kit of claim 41, wherein the membrane is a phospholipid bilayer, a diblock copolymer, or a triblock copolymer.
43. The kit according to claim 32 or 33, wherein the buffer system for performing the polymerization reaction is a dihydrogen phosphate-hydrogen phosphate buffer system, a carbonic acid-sodium bicarbonate buffer system, a Tris-HCl buffer system, a HEPES buffer system, a MOPS buffer system, or any combination thereof.
44. The kit according to claim 32 or 33, wherein the buffer system for the polymerization reaction contains an additive or auxiliary reagent that enhances the polymerase extension reaction, and the additive or auxiliary reagent is selected from dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, a non-ionic detergent, N,N,N-trimethylglycine, a single-stranded nucleic acid binding protein, or any combination thereof.
45. Use of the kit according to any one of claims 32 to 44 in high-throughput sequencing. The use according to claim 45 , wherein the high-throughput sequencing is nanopore sequencing.