Immune regulation type DNA vaccine for preventing chicken eimeria tenella and application of immune regulation type DNA vaccine
By designing eukaryotic plasmid vector DNA vaccine encoding EtROP27, ChIL-2 and ChIFN-γ genes, the drug resistance of chemical drugs to prevent and treat coccidiosis and the safety risks of traditional vaccines are solved, and efficient and safe immune protection effects are achieved.
Patent Information
- Application Number
- CN202510638931.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-07-25
AI Technical Summary
Existing chemical drugs to prevent and treat chicken coccidiosis have drug resistance and drug residues. Traditional vaccines have safety and pathogenic risks. It is necessary to develop a safe and efficient immunomodulatory DNA vaccine to prevent chicken tender Eimeria.
A DNA vaccine for eukaryotic plasmid vector encoding EtROP27, ChIL-2 and ChIFN-γ genes was designed. By expressing these genes in chickens, it activates the immune system, improves immune protection, and reduces post-infection lesions and oocyst production.
The vaccine is highly immunogenic, safe, easy to produce and store, and can significantly reduce the lesions and oocyst production of chicken tender Eimeria coccidius, providing long-term immune protection.
Smart Images

Figure CN120361201A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biological veterinary drugs, and more particularly to an immunomodulatory DNA vaccine for preventing Eimeria tenella in chickens and its application. Background Art
[0002] Avian coccidiosis is a globally prevalent parasitic disease caused by Eimeria spp. parasitizing in the chicken intestine. Among them, Eimeria tenella has the strongest pathogenicity, the widest distribution, and the greatest harm. After chickens are infected with E. tenella, the initial symptoms mainly include listlessness, head curling, eyes closed and standing still, reduced food intake. Severely affected chickens start to excrete bloody stools on the 5th day after infection. In intensive farming, avian coccidiosis is often caused by mixed infection of one or more coccidia, with an incidence rate as high as 50% - 70%, and the mortality rate can reach 80% in severe cases. It is estimated that the annual production loss caused by avian coccidiosis globally exceeds 10.4 billion pounds.
[0003] Currently, the prevention and control of avian coccidiosis still mainly rely on chemical drugs. However, the negative impacts brought by the problems of drug resistance and food safety issues caused by drug residues to the poultry industry cannot be ignored, and the cost of developing new chemical drugs is expensive. Therefore, finding effective protective antigens and using immunoprevention to replace drug prevention and control of coccidiosis has great advantages.
[0004] Currently, vaccines for preventing coccidia mainly include live coccidia vaccines and genetic engineering vaccines. Vaccination with virulent or attenuated vaccines is an effective way to prevent avian coccidiosis. Among them, although virulent vaccines can produce good protective immunity, due to their strong virulence, they are likely to trigger the outbreak of avian coccidiosis; although attenuated live vaccines have good preventive effects, they still have certain pathogenicity, affecting the production performance of chicken flocks and having the risk of reversion to virulence. With the development of DNA recombination technology, genetic engineering vaccines have become a research hotspot for many scholars to seek prevention and control of avian coccidiosis.
[0005] At present, the research on genetic engineering vaccines against chicken coccidia mainly includes subunit vaccines, DNA vaccines, and live vector vaccines. Among them, DNA vaccines are a new biotechnology developed in recent years. It involves cloning the exogenous gene DNA encoding the antigen protein into a eukaryotic plasmid expression vector, and then directly injecting the recombinant plasmid DNA into an animal. This enables the exogenous gene to synthesize the antigen protein through the host cell's transcription system, activating the body's immune system and thereby triggering an immune response. Compared with traditional vaccines, DNA vaccines can induce a comprehensive immune response in the body; are easy to construct and modify; have a long-lasting immune protection duration; have low costs for large-scale production, good thermal stability, and are conducive to storage and transportation; the vaccine protein antigen is expressed in the host animal cells, eliminating the risk of virulence reversion. Based on this, DNA vaccines have become a research hotspot for preventing and treating chicken coccidia.
[0006] Eimeria tenella belongs to Apicomplexa protozoa. The apical complex of Apicomplexa protozoa consists of an apical polar ring and a group of specialized secretory organelles, namely micronemes, rhoptries, and dense granules. EtROP27 belongs to the rhoptry basal protein and is an important functional protein during host cell invasion, the formation of the moving complex, and the establishment of the parasitophorous vacuole. It is a key protein for the parasite to invade host cells and plays many roles in the intracellular parasitism of coccidia. The EtROP27 gene sequence was obtained by transcriptome sequencing (Cluster-10347.5943), with a gene size of approximately 1068 bp, a theoretical molecular weight of 38 kDa, and is mainly expressed in the sporozoite and merozoite stages.
[0007] Cytokines are a group of immunomodulatory factors with a wide range of biological activities produced by immune cells or non-immune cells in the body. They can activate and regulate immune active cells in the body and play an important role in the generation and regulation of immune responses. Cytokines also play a key role in anti-coccidia immunity. Currently, the cytokines that have been studied more for chicken coccidia are mainly IL-2 and IFN-γ. IL-2 is mainly produced by T cells or T cell subsets and is a type of T cell growth factor. It can promote the differentiation and maturation of T cells, NK cells, and B cells and activate their biological activities, induce the activity of lymphokine-activated killer cells (LAK), and also promote the synthesis and release of many lymphokines such as IFN-γ, TNF-α, etc., as well as antibody production, greatly enhancing the body's immune function. IFN-γ is mainly produced by NK cells, with the ability to activate CTLs, enhance the function of macrophages and upregulate the expression of MHC class I and II molecules on antigen-presenting cells and myoblasts. IFN-γ can activate the production of reactive oxygen species (ROS) and nitric oxide (NO) in animals infected with Eimeria. ROS intermediates are One of the direct effector factors that resist and kill intracellular parasitic protozoa, NO can act as an effector molecule to inhibit the development of coccidia in the parasitophorous vacuole by reacting with proteins containing iron-sulfur centers in E. tenella, thereby enhancing the anti-coccidial immune protection of the body.
[0008] Therefore, providing an immunomodulatory DNA vaccine against Eimeria tenella in chickens is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0009] In view of this, the object of the present invention is to provide an immunomodulatory DNA vaccine against Eimeria tenella in chickens and its application to solve the deficiencies in the prior art.
[0010] To achieve the above object, the present invention adopts the following technical solutions:
[0011] In view of this, the present invention provides an immunomodulatory DNA vaccine against Eimeria tenella in chickens and its application. This DNA vaccine encodes the sporozoite stage antigen EtROP27 of Eimeria tenella, chicken interleukin-2 (ChIL-2), and chicken interferon-γ (ChIFN-γ) genes, and contains a eukaryotic plasmid vector containing the rhoptry basal protein EtROP27 of E. tenella, which can provide effective immune protection for chickens against E. tenella. Containing chicken IL-2 and IFN-γ genes can increase the induction of ChIL-2 and ChIFN-γ in the cecal tonsils of chickens, and can reduce the cecal lesion score and oocyst output after E. tenella infection. It has high immunogenicity and contains multiple T cell epitopes. The vaccine of the present invention is simple to prepare, easy to produce, low in cost, easy to store and transport, suitable for wide use, can provide a theoretical basis for the DNA vaccine to enter clinical practice, and can provide new ideas for the prevention of E. tenella disease and the development of vaccines, and has important scientific and practical significance.
[0012] To achieve the above object, the present invention adopts the following technical solutions:
[0013] An immunomodulatory DNA vaccine against Eimeria tenella in chickens, containing the rhoptry basal protein ROP27 (EtROP27) gene of Eimeria tenella, chicken interleukin-2 (ChIL-2) gene, and chicken interferon-γ (ChIFN-γ) gene;
[0014] Among them, the EtROP27 gene sequence is as shown in SEQ ID NO.1;
[0015] The ChIL-2 gene sequence is as shown in SEQ ID NO.2;
[0016] The ChIFN-γ gene is as shown in SEQ ID NO.3.
[0017] The sequence of the EtROP27 gene (Cluster-10347.5943) was measured by transcriptome sequencing. Its open reading frame sequence is 1068 bp in total. By analyzing the differential genes between the precocious and virulent strains of E. tenella, it was found that EtROP27 might be a pathogenic-related gene. According to the NCBI (National Center for Biotechnology Information), the sequences of the ChIL-2 gene and the ChIFN-γ gene are (GU119890.1) and (NM205149.2) respectively, and their open reading frame sequences are 432 bp and 495 bp respectively.
[0018] A preparation method of the above-mentioned immunomodulatory DNA vaccine for preventing Eimeria tenella in chickens specifically includes the following steps:
[0019] (1) Clone the EtROP27 gene, the ChIL-2 gene, and the ChIFN-γ gene and perform sequencing;
[0020] (2) Construct the E. tenella DNA vaccine recombinant plasmids pVAX-ROP27, pVAX-ROP27-IL-2, pVAX-ROP27-IFN-γ, pVAX-ROP27-IL-2-IFN-γ;
[0021] (3) In vivo detection of the recombinant plasmids;
[0022] (4) Animal immune protection experiment.
[0023] The present invention also requests protection for the application of the above-mentioned immunomodulatory DNA vaccine for preventing Eimeria tenella in chickens in the preparation of a pharmaceutical preparation for preventing or treating chicken coccidiosis.
[0024] As can be seen from the above technical solutions, compared with the prior art, the beneficial effects of the present invention are as follows:
[0025] 1. The DNA vaccine of the present invention uses a eukaryotic plasmid expression vector as the structural framework. This eukaryotic plasmid vector has the basic elements of an expression vector and inserts the target gene at the restriction enzyme site. The eukaryotic expression vector used in the present invention is pVAX1.0 (purchased from Miaoling Biology). The pVAX1.0 vector is derived from the pcDNA3.1 vector and has been modified and specifically designed for developing DNA vaccines. It is currently recognized as a relatively safe vaccine vector.
[0026] 2. The life cycle of chicken coccidia is complex and the genome is huge. The immunogenicity and antigen composition at different developmental stages are different. The encoded EtROP27 of this vaccine is expressed in both the sporozoite and merozoite stages, and can induce a more comprehensive and strong immune response.
[0027] 3. Chicken cytokines have good adjuvant properties. When used in combination with vaccines, they can enhance the immune effect of vaccines. Interleukin and interferon are the most commonly used immune adjuvants among cytokines. Cytokines secreted by immune cells or non-immune cells in the body, such as IL-2 and IFN-γ, are soluble small-molecule polypeptides or proteins. When the prepared fusion DNA vaccine is injected into the body, it can regulate the body's immune response, improve the immunogenicity, safety, and stability of the vaccine, shorten the immune cycle, and have a good immune effect.
[0028] 4. The vaccine of the present invention is a DNA vaccine. Compared with traditional vaccines, it has the advantages of high safety, long retention time in the body, simple preparation, good thermal stability, convenient storage and transportation, and time-saving and labor-saving use. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 It is the PCR agarose gel electrophoresis result of the EtROP27 gene of Eimeria tenella;
[0030] Figure 2 It is the PCR agarose gel electrophoresis result of the chicken ChIL-2 and chicken ChIFN-γ genes;
[0031] Figure 3 It is the PCR agarose gel electrophoresis result of the bacterial liquid of pMD18T-ROP27, pMD18T-IL-2, pMD18T-IFN-γ (containing KpnⅠ restriction site) and pMD18T-IFN-γ (containing NotⅠ restriction site);
[0032] Figure 4 It is the double digestion agarose gel electrophoresis result of the pMD18T-ROP27 plasmid;
[0033] Figure 5 It is the PCR agarose gel electrophoresis result of the pVAX-ROP27 bacterial liquid;
[0034] Figure 6 It is the double digestion agarose gel electrophoresis result of the pMD18T-IL-2 plasmid;
[0035] Figure 7 It is the double digestion agarose gel electrophoresis result of the pMD18T-IFN-γ (containing KpnⅠ restriction site) plasmid;
[0036] Figure 8 It is the PCR agarose gel electrophoresis result of the bacterial liquid of pVAX-ROP27-IL-2 and pVAX-ROP27-IFN-γ;
[0037] Figure 9The results of double digestion of plasmid pMD18T-IFN-γ (containing NotⅠ restriction site) by agarose gel electrophoresis;
[0038] Figure 10 The results of PCR of pVAX-ROP27-IL-2-IFN-γ bacterial liquid by agarose gel electrophoresis;
[0039] Figure 11 RT-PCR was used to detect the transcription of genes in each vaccine group in chickens. Among them, lane 1 was the EtROP27 gene of the pVAX-ROP27 vaccine group, lanes 4-6 were the EtROP27 and ChIL-2 genes of the pVAX-ROP27-IL-2 vaccine group, lanes 9-11 were the EtROP27 and ChIFN-γ genes of the pVAX-ROP27-IFN-γ vaccine group, and lanes 14-17 were the transcription results of the EtROP27, ChIL-2, and ChIFN-γ genes of the pVAX-ROP27-IL-2-IFN-γ vaccine group in chickens;
[0040] Figure 12 Western Blot was used to detect the expression results of pVAX-ROP27, pVAX-ROP27-IL-2, pVAX-ROP27-IFN-γ, and pVAX-ROP27-IL-2-IFN-γ in chickens. Among them, the expression of each vaccine in vivo was detected separately, and the expression results of each vaccine in vivo were not detected in the muscle injected with PBS;
[0041] Figure 13 Schematic diagram of the animal experiment process:
[0042] Figure 14 Evaluation of immune protection effect. Among them, A: average weight gain after challenge; B: bloody stool score; C: average cecal lesion score; D: lesion score reduction rate; E: oocysts per gram of feces (OPG); F: oocyst reduction rate. When comparing pairwise between groups, the same lowercase letters represent no significant difference between groups (P>0.05), and different lowercase letters represent significant difference between groups (P<0.05);
[0043] Figure 15 ELISA was used to detect serum antibodies. Among them, A: the results of ELISA detecting the level of serum cytokine IL-2; B: the results of ELISA detecting the level of serum cytokine IFN-γ; C: the results of ELISA detecting the level of serum antibody IgG; D: the results of ELISA detecting the level of serum antibody IgA. When comparing pairwise between groups of the same age, the same letters represent no significant difference (P>0.05), and different letters represent significant difference (P<0.05);
[0044] Figure 16It is a pathological tissue section diagram of the cecum; among them, A: blank control group; B: challenged control group; C: pVAX control group; D: pVAX-ROP27 group; E: pVAX-ROP27-IL-2 group; F: pVAX-ROP27-IFN-γ group; G: pVAX-ROP27-IL-2-IFN-γ group. Detailed implementation manners
[0045] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Apparently, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0046] Experimental materials
[0047] (1) Sporulated oocysts: Sporulated oocysts of Eimeria tenella Shanxi strain (E. tenella oocysts), which are rejuvenated and sporulated in chickens every three months, and the sporulation rate is above 80%.
[0048] (2) Experimental animals: One-day-old chicks are purchased from SPF breeding embryos provided by Beijing Meri Avigon Experimental Animal Technology Co., Ltd. They are raised in a strictly disinfected and coccidia-free environment from hatching to the end of the experiment, and are allowed to eat and drink freely.
[0049] (3) Plasmids and strains: Host bacteria E. coli DH5α and pMD18-T cloning vector are purchased from Dalian Takara Biotechnology Co., Ltd.; pVAX1.0 is from Miaoling Biology.
[0050] (4) Tool enzymes and reagents
[0051] NheⅠ, KpnⅠ, NotⅠ and XbaⅠ restriction endonucleases, DNA Ligation Kit, PrimeScript RT reagent Kit with gDNA Eraser are purchased from TAKARA; GoTaq Green Master Mix is purchased from Omega; protease inhibitors and phosphatase inhibitors are purchased from Beyotime; Chicken interleukin-2 (IL-2), chicken interferon-γ (IFN-γ), chicken immunoglobulin G (IgG), chicken immunoglobulin A (IgA) enzyme-linked immunosorbent assay kits are purchased from Jianglai Biology; formaldehyde solution, absolute ethanol, xylene, hematoxylin, alcohol-soluble eosin.
[0052] Example 1 Preparation of EtROP27, ChIL-2 and ChIFN-γ genes
[0053] 1) Synthesize primers
[0054] According to the EtROP27 gene sequence (Cluster-10347.5943) obtained from transcriptome sequencing and the ChIL-2 (GU119890.1) and ChIFN-γ (NM205149.2) genes from the NCBI website, primers were designed using the Primer-Blast function on the NCBI website as shown in Table 1, and sent to Sangon Biotech Co., Ltd. for primer synthesis.
[0055] The EtROP27 gene sequence (SEQ ID NO.1) is:
[0056]
[0057] The chIL-2 gene sequence (SEQ ID NO.2) is as follows:
[0058] ATGATGTGCAAAGTACTGATCTTTGGCTGTATTTCGGTAGCAATGCTAATGACTACAGCTTATGGAGCATCTCTATCATCAGAAAAATGGAAAACTCTTCAAACATTAATAAAGGATTTAGAAATATTGGAAAATATCAAGAATAAGATTCATCTCGAGCTCTACACACCAACTGAGACCCAGGAGTGCACCCAGCAAACTCTGCAGTGTTACCTGGGAGAAGTGGTTACTCTGAAGAAAGAAACTGAAGATGACACTGAAATTAAAGAAGAATTTGTAACTGCTATTCAAAATATCGAAAAGAACCTCAAGAGTCTTACGGGTCTAAATCACACCGGAAGTGAATGCAAGATCTGTGAAGCTAACAACAAGAAAAAATTTCCTGATTTTCTCCATGAACTGACCAACTTTGTGAGATATCTGCAAAAATAA。
[0059] The chIFN-γ gene sequence (SEQ ID NO.3) is as follows:
[0060] ATGACTTGCCAGACTTACAACTTGTTTGTTCTGTCTGTCATCATGATTTATTATGGACATACTGCAAGTAGTCTAAATCTTGTTCAACTTCAAGATGATATAGACAAACTGAAAGCTGACTTTAACTCAAGTCATTCAGATGTAGCTGACGGTGGACCTATTATTGTAGAGAAACTGAAGAACTGGACAGAGAGAAATGAGAAAAGGATCATACTGAGCCAGATTGTTTCGATGTACTTGGAAATGCTTGAAAACACTGACAAGTCAAAGCCGCACATCAAACACATATCTGAGGAGCTCTATACTCTGAAAAACAACCTTCCTGATGGCGTGAAGAAGGTGAAAGATATCATGGACCTGGCCAAGCTCCCGATGAACGACTTGAGAATCCAGCGCAAAGCCGCGAATGAACTCTTCAGCATCTTACAGAAGCTGGTGGATCCTCCGAGTTTCAAAAGGAAAAGGAGCCAGTCTCAGAGGAGATGCAATTGCTAA。
[0061] Table 1 Primers for Amplifying Three Genes
[0062]
[0063] 2) PCR Amplification of EtROP27, chIL-2 and chIFN-γ Genes
[0064] Using E. tenella sporozoite cDNA as a template to amplify the EtROP27 gene and chicken spleen cDNA as a template to amplify the ChIL-2 and ChIFN-γ genes (containing KpnⅠ and NotⅠ restriction sites respectively), the following reaction system was used for PCR: 2×12.5 μL of GoTaq Green Master Mix, 2 μL of template, 1 μL of upstream primer, 1 μL of downstream primer, and supplemented with ultrapure water to 25 μL. Mix well, pre-denature at 98℃ for 2 min on a PCR instrument; denature at 98℃ for 30 s, anneal at 58℃ for 30 s, extend at 72℃ for 60 s, for 35 cycles; then extend at 72℃ for 5 min.
[0065] 3) Construction of Recombinant Plasmids pMD18T-ROP27, pMD18T-IL-2, pMD18T-IFN-γ (Containing KpnⅠ and NotⅠ Restriction Sites Respectively)
[0066] Take 25 μL of each PCR product obtained in step (2) and perform 1% agarose gel electrophoresis ( Figure 1 and Figure 2 ). Cut the agarose gel at the target band under ultraviolet light, and use the SanPrep column DNA gel extraction kit from Sangon Biotech Co., Ltd. to recover and purify the target fragment according to the instructions. Take the purified PCR product and ligate it with the pMD18-T vector. The reaction systems are shown in Table 2.
[0067] Table 2 T vector ligation system
[0068] Reagent Dosage pMD18-T 1 μL Each PCR recycled product 4 μL Sterilized water 5 μL Total system 10 μL
[0069] After mixing the above components evenly in an Ep tube, perform ligation overnight at 16°C. Transform the ligation product into Escherichia coli competent DH5α, pick positive clone bacteria, and the results of PCR agarose gel electrophoresis of pMD18T-ROP27, pMD18T-IL-2, pMD18T-IFN-γ (containing KpnⅠ restriction site) and pMD18T-IFN-γ (containing NotⅠ restriction site) bacterial solutions are shown in Figure 3 ; perform sequencing identification.
[0070] Example 2 Construction of immunomodulatory DNA vaccines pVAX-ROP27, pVAX-ROP27-IL-2, pVAX-ROP27-IFN-γ and pVAX-ROP27-IL-2-IFN-γ
[0071] 1) Construction of DNA vaccine pVAX-ROP27
[0072] Digest pMD18-T-ROP27 and pVAX with NheⅠ and KpnⅠ double enzymes respectively. The results of plasmid double digestion agarose gel electrophoresis are shown in Figure 4 , recover the target gene of EtROP27 and the large fragment of pVAX. Add 8 μL of the EtROP27 target fragment + 2 μL of pVAX plasmid (the pVAX plasmid is incubated in a water bath at 55 - 60°C for 5 min and then on ice for 2 min to prevent self-ligation) + 2 μL of 10×T4 DNA ligase Buffer + 0.4 μL of T4 DNA ligase + 7.6 μL of ddH2O into an Ep tube, mix well and perform ligation overnight at 16°C. Transform the ligation product into Escherichia coli competent DH5α, and after PCR identification, see Figure 5 , pick positive clone bacterial solution and perform sequencing identification to determine it as DNA vaccine pVAX-ROP27.
[0073] 2) Construction of DNA vaccines pVAX-ROP27-IL-2 and pVAX-ROP27-IFN-γ
[0074] pVAX-ROP27 and pMD18T-IL-2 were double digested with KpnⅠ and NotⅠ. The results of plasmid double digestion agarose gel electrophoresis are shown in Figure 6 ; pVAX-ROP27 and pMD18T-IFN-γ (containing KpnⅠ restriction site) were double digested with KpnⅠ and XbaⅠ. The results of plasmid double digestion agarose gel electrophoresis are shown in Figure 7 ; The large fragments of pVAX-ROP27 and the target genes of chIL-2 and chIFN-γ (containing KpnⅠ restriction site) were recovered respectively, and then ligated, transformed and amplified (the same as the previous step). The results of PCR identification are shown in Figure 8 ; Positive clone bacterial solutions were picked and identified by sequencing, and the DNA vaccines pVAX-ROP27-IL-2 and pVAX-ROP27-IFN-γ were confirmed.
[0075] 3) Construction of DNA vaccine pVAX-ROP27-IL-2-IFN-γ
[0076] pVAX-ROP27-IL-2 and pMD18T-IFN-γ (containing NotⅠ restriction site) were double digested with NotⅠ and XbaⅠ. The results of plasmid double digestion agarose gel electrophoresis are shown in Figure 9 ; The large fragments of pVAX-ROP27-IL-2 and the target genes of chIFN-γ (containing NotⅠ restriction site) were recovered respectively, and then ligated, transformed and amplified (the same as the previous step). The results of PCR identification are shown in Figure 10 ; Positive clone bacterial solutions were picked and identified by sequencing, and the DNA vaccine pVAX-ROP27-IL-2-IFN-γ was confirmed.
[0077] Example 3 RT-PCR detection of ROP27 transcription in chickens
[0078] Four DNA vaccines were amplified in large quantities and plasmids were extracted. The plasmid concentrations are shown in Table 3 respectively.
[0079] Table 3 Determination of plasmid concentrations of four DNA vaccines
[0080]
[0081]
[0082] 14-day-old chicks were injected intramuscularly in the leg (100 μg / chick). After 7 days, the muscles at the injection site (experimental group) and the muscles at the PBS injection site (control group) were taken, lysed with Trizol, and RNA was extracted. According to PrimeScript TM RT reagent Kit with gDNA Eraser (TaKaRa), genomic DNA was removed from the RNA and reverse transcribed into cDNA. Subsequently, according to The Green Master Mix kit was used for PCR amplification of the target gene, and the amplification primers are shown in Table 4.
[0083] Table 4 Primers for RT-PCR detection of in vivo transcription of DNA vaccines
[0084]
[0085] The PCR amplification program was as follows: 95°C for 2 min; 95°C for 10 s, 59°C for 30 s, 72°C for 70 s; 35 cycles; 72°C for 5 min. After the PCR amplification was completed, the products were electrophoresed on 1% agarose gel at a constant voltage of 120 V for 35 min, and then the results were observed. The results of RT-PCR detection of the in vivo transcription of EtROP27, ChIL-2, and ChIFN-γ in chickens are shown in Figure 11 , and negative and positive control groups were set up. The results showed that the genes of EtROP27, ChIL-2, and ChIFN-γ were all successfully transcribed in chickens.
[0086] Example 4 Western Blot detection of the expression of each DNA vaccine in chickens
[0087] 100 mg of muscle from the PBS-injected site (control group) and the muscle from the site injected with each recombinant plasmid were respectively added to 200 μL of RIPA lysis buffer (prepared as follows: 500 μL of RIPA, 10 μL of protease inhibitor, 10 μL of phosphatase inhibitor, 10 μL of 0.05 M EDTA), lysed at 4°C for 30 min, and centrifuged at 12,000 r / min for 10 min to extract the total tissue protein. The concentration was measured using a BCA protein concentration assay kit as shown in Table 5.
[0088] Table 5 Measurement of the protein concentration of four DNA vaccines
[0089] Protein OD562 Protein concentration (mg / mL) Injected PBS 0.402 2.15 pVAX-ROP27 0.297 1.52 pVAX-ROP27-IL-2 0.262 1.314 pVAX-ROP27-IFN-γ 0.183 0.84 pVAX-ROP27-IL-2-IFN-γ 0.348 1.828
[0090] The concentration was diluted to 0.5 mg / mL, and the expression of the target gene was detected by Western Blot. The results are shown in Figure 12 , and the results showed that each DNA vaccine was successfully expressed in chickens.
[0091] Example 5 Immunoprotective experiment
[0092] 1) Experimental design
[0093] One hundred and forty 1-day-old chicks were randomly divided into 7 groups, namely the blank control group, the challenged control group, the pVAX control group, and the immunized and challenged groups. The immunized and challenged groups included four DNA vaccines, pVAX-ROP27, pVAX-ROP27-IL-2, pVAX-ROP27-IFN-γ, and pVAX-ROP27-IL-2-IFN-γ. Each chicken was injected with 100 μg of the DNA vaccine into the leg muscle. Each chicken in the pVAX control group was injected with 100 μg of the pVAX plasmid into the leg muscle. All groups were primed on day 14 and boosted on day 21, and the other two groups were injected with PBS. Except for the blank control group which was orally administered PBS, the remaining groups were orally challenged with 5×10 4 sporulated oocysts of E. tenella on day 28. After 7 days of challenge, the chickens were dissected. The schematic diagram of the animal experiment process is shown in Figure 13 .
[0094] 2) Observation of immune protection effect
[0095] After challenge, the spirit and feces of the chickens in each group were observed continuously for 7 days, the number of deaths in each group was recorded, the bloody stool score was recorded on the 5th day, the number of oocysts per gram of feces (OPG) was measured after changing the plastic sheet on the 7th day, each chicken was weighed on an empty stomach, and the cecal lesion score was determined by dissection. The mortality rate, relative weight gain rate (RWG), lesion score reduction rate (RLS), oocyst reduction rate, and anti-coccidial index (ACI) of the chickens were calculated.
[0096] (1) Weight gain
[0097] Average weight gain 1 = (total final weight of each group at 21 days - total initial weight of each group at 14 days) / number of chickens in each group;
[0098] Average weight gain 2 = (total final weight of each group at 28 days - total initial weight of each group at 21 days) / number of chickens in each group;
[0099] Average weight gain 3 = (total final weight of each group at 35 days - total initial weight of each group at 28 days) / number of chickens in each group;
[0100] Relative weight gain rate 1 (RWG) = (average weight gain 1 of each group / average weight gain 1 of the blank control group) × 100%;
[0101] Relative weight gain rate 2 (RWG) = (average weight gain 2 of each group / average weight gain 2 of the blank control group) × 100%;
[0102] Relative weight gain rate 3 (RWG) = (average weight gain 3 of each group / average weight gain 3 of the blank control group) × 100%.
[0103] (2) Mortality rate
[0104] Mortality rate (%) = (number of dead chickens in each group / total number of chickens in each group) × 100%.
[0105] (3) Cecum lesion score
[0106] Dissect the cecum on the 7th day after infection (when the lesions of the two ceca are inconsistent, take the more severe side as the standard).
[0107] 0 score: No visible lesions to the naked eye.
[0108] 1 score: There are very few scattered petechiae or ecchymoses on the serosa and mucosal surface of the cecum; the intestinal wall is not thickened, and the contents are normal.
[0109] 2 scores: There is a small amount of blood in the cecal contents; the intestinal wall is slightly thickened, and a large number of petechiae can be seen on the mucosa.
[0110] 3 scores: There is a large amount of blood in the cecal contents or there is a cecal core; the intestinal wall is thickened, the cecum is atrophied, and the contents are small.
[0111] 4 scores: The cecum is swollen due to being filled with blood or a cecal core; the cecal wall is extremely thickened, and the lesion reaches the rectal part (intestinal wall thickening). Chickens that die from this disease are scored 4.
[0112] (4) OPG
[0113] McMaster counting: Weigh 2 g of feces and place it in a beaker, add 10 mL of saturated saline, and crush the feces; take 50 mL of saturated saline and add it to the crushed feces; mix the fecal liquid evenly and filter it through a 60-mesh fecal sieve. Then, while shaking the filtrate, suck a small amount with a pipette, add it to the counting chamber, place it on the microscope stage, and let it stand for 1 - 2 minutes; count all the oocysts seen in the two counting chambers under a low-power microscope (10×10), take the average value and multiply it by 200, which is the number of oocysts per gram of feces (OPG).
[0114] OPG = (n1 + n2) / 2 ÷ 0.15 × 60 ÷ 2 = A × 200.
[0115] Note: n1 is the number of coccidia in the first counting chamber; n2 is the number of coccidia in the second counting chamber; A is the average value of the number of coccidia in the two counting chambers.
[0116] (5) Reduction rate of lesion score
[0117] Reduction rate of lesion score (RLS) = (Average lesion score of the challenged group - Average lesion score of the immunized and challenged group) / Average lesion score of the challenged group × 100%.
[0118] Calculate RLS according to the criteria of Martin et al. When RLS ≥ 70%, it is judged to have protective effect.
[0119] (6) Bloody stool score
[0120] Measure within the most severe 24 h after bloody stool appears, approximately on the 5th day after challenge.
[0121] 0 points: No fecal blood;
[0122] 1 point: 1%-25% fecal blood;
[0123] 2 points: 26%-50% fecal blood;
[0124] 3 points: 51%-75% fecal blood;
[0125] 4 points: 76%-100% fecal blood.
[0126] (7) Oocyst reduction rate
[0127] Oocyst reduction rate = (Average oocyst production in the challenged group - Average oocyst production in the immunized challenged group) / Average oocyst production in the challenged group × 100%.
[0128] Relative oocyst production (ROP) = Oocyst production per chicken in the immunized challenged group / Oocyst production per chicken in the challenged group × 100%.
[0129] Calculate the oocyst reduction rate according to the McDonald standard, which is the protective efficacy. When the reduction rate ≥ 75%, it is judged as having protective efficacy.
[0130] (8) Anticoccidial index (ACI)
[0131] ACI = (Survival rate + Relative weight gain rate) - (Lesion score + Oocyst score);
[0132] Among them, survival rate = Number of surviving chickens / Number of experimental chickens × 100%;
[0133] Lesion score = Average lesion score per group × 10;
[0134] Oocyst score: When the O.P.G value is < 0.1, the oocyst score is 0;
[0135] When the O.P.G value is 0.1 - 1, the oocyst score is 1;
[0136] When the O.P.G value is 2 - 5, the oocyst score is 10;
[0137] When the O.P.G value is 6 - 10, the oocyst score is 20;
[0138] When the O.P.G value ≥ 11, the oocyst score is 40.
[0139] The O.P.G value is the number of oocysts per gram of feces, in units of ×10 6 per unit.
[0140] When ACI ≥ 180, it has a high - efficiency anticoccidial effect; when 160 ≤ ACI < 180, it has a medium - efficiency anticoccidial effect; when ACI < 160, it has no anticoccidial effect.
[0141] 3) Analysis of immune protection effect
[0142] The protective effects of each DNA vaccine against Eimeria tenella were mainly evaluated by average weight gain, relative weight gain rate, survival rate, average cecal lesion score, lesion score reduction rate, OPG, oocyst reduction rate, blood stool score, and ACI. The results are shown in Tables 6 - 7 and Figure 14 .
[0143] Table 6 Average weight gain and relative weight gain rate of chickens after immunization
[0144]
[0145] Table 7 Evaluation of immune indexes
[0146]
[0147]
[0148] Note: The same lowercase letters indicate no significant difference between groups (P > 0.05), and different lowercase letters indicate significant differences between groups (P < 0.05).
[0149] During the vaccination period, there was no significant difference in average weight gain and relative weight gain rate between each immunized group and the blank control group (P > 0.05); after challenge, compared with the blank control group, the average weight gain and relative weight gain rate of the challenge control group, pVAX control group, pVAX - ROP27 group, pVAX - ROP27 - IL - 2 group, and pVAX - ROP27 - IFN - γ group were significantly decreased (P < 0.05), and there was no significant difference in the average weight gain and relative weight gain rate of the pVAX - ROP27 - IL - 2 - IFN - γ group compared with the blank control group (P > 0.05); compared with the challenge control group, except for the PVAX group with no significant difference (P > 0.05), the average weight gain and relative weight gain rate of the other vaccine groups were significantly higher than those of the challenge control group (P < 0.05). Compared with the challenge control group, except for the PVAX control group, the average cecal lesion score and oocysts per gram of feces (OPG) of each DNA vaccine group were significantly decreased (P < 0.05), and the cecal lesion score reduction rate and oocyst reduction rate were significantly increased (P < 0.05). Among them, the pVAX - ROP27 - IL - 2 - IFN - γ vaccine group had the most obvious effect, and the ACI reached 183.89.
[0150] Example 6 ELISA detection of serum antibody and cytokine levels
[0151] 1) Experimental design
[0152] Whole blood samples of chickens in the blank control group, pVAX control group, control group challenged with worms, and each vaccine group were collected before the first immunization (14 d), before the second immunization (21 d), before challenge (28 d), and after challenge (35 d), with 3 chickens in each group. The samples were left at room temperature for 2 h or overnight at 4 °C, centrifuged at 2500×g for 10 min, and the sera were taken to detect IL-2, IFN-γ, IgG, and IgA using an enzyme-linked immunosorbent assay kit as Figure 15 A - D in
[0153] 2) Analysis of serum cytokine results
[0154] With the increase in the number of immunizations, the contents of cytokines IL-2 and IFN-γ in the serum increased significantly (P < 0.05), and the pVAX-ROP27-IL-2-IFN-γ group had the most significant effect ( Figure 15 A, B in ). Moreover, the IL-2 content produced in vivo by the DNA vaccine containing the chIL-2 gene was also significantly higher than that of the vaccine group without the chIL-2 gene during the same period, and the IFN-γ content produced in vivo by the DNA vaccine containing the chIFN-γ gene was also significantly higher than that of the vaccine group without the chIFN-γ gene during the same period.
[0155] 3) Analysis of serum antibody results
[0156] The serum antibody IgG and IgA levels in each vaccine group increased significantly with the increase in the number of immunizations (P < 0.05), and the pVAX-ROP27-IL-2-IFN-γ group had the most significant effect ( Figure 15 C, D in ).
[0157] Example 7 Detection of pathological changes in each tissue by HE staining of cecal pathological tissue sections
[0158] 1) Experimental design
[0159] After sacrificing the chickens in each experimental group, the cecal tissues were taken and fixed in 10% formalin for 24 h. The tissues were trimmed into pieces with a thickness of 5 - 8 mm, a length of 10 - 20 mm, and then fixed for another 12 h. After flushing with water for 12 h, dehydration was carried out according to the dehydrator process. After dehydration was completed, the tissues were infiltrated with paraffin in an embedding machine for 40 min and then embedded. Subsequently, sectioning was performed using a microtome with a section thickness of 5 μm. The intact tissues in the paraffin ribbons were selected, flattened on water at 42 °C, and the tissues were slowly fished out with a glass slide and dried in an oven at 50 °C for 2 h. Then, HE staining was carried out through the following steps: Xylene I (10 min) → Xylene II (10 min) → Absolute alcohol:Xylene (1:1) 5 min → Absolute alcohol I (2 min) → Absolute alcohol II (2 min) → 95% alcohol (3 min) → 95% alcohol (2 min) → 85% alcohol (2 min) → 80% alcohol (2 min) → 70% alcohol (1 min) → 50% alcohol (1 min) → Distilled water (1 min) → Hematoxylin (14 min) → Distilled water (2 min) → Hydrochloric acid alcohol (30 s) → Rinsed with tap water (10 min) → 50% alcohol (3 min) → 75% alcohol (3 min) → 80% alcohol (3 min) → Alcohol-soluble eosin (3 min) → 95% alcohol I (3 min) → 95% alcohol II (3 min) → Absolute alcohol I (5 min) → Absolute alcohol II (5 min) → Xylene I (8 min) → Xylene II (8 min) → Sealed and observed for lesions, and the lesion results were photographed.
[0160] 2) Analysis of pathological tissue lesions in the cecum
[0161] As Figure 16 shown in A - G below, the red arrows represent hemorrhagic red blood cells, the blue arrows represent damaged and necrotic cecal epithelial cells, the yellow arrows represent damaged intestinal glands, the black arrows represent coccidia at various developmental stages, and the green arrows represent hyperplasia of the connective tissue in the submucosa accompanied by infiltration of inflammatory cells. The cecal tissue structure of the blank control group was intact, without obvious pathological tissue damage ( Figure 16 as shown in A below). The cecal structures of the coccidia-infected control group and the pVAX control group were severely damaged. A large number of cecal mucosal epithelial cells were necrotic and shed, the intestinal glands ruptured, and a large number of schizonts were present. The capillaries in the lamina propria and submucosa of the cecum were highly dilated, congested, hemorrhagic, and edematous, accompanied by infiltration of inflammatory cells. The cecal contents contained a large number of hemorrhagic red blood cells and shed cecal epithelial cells ( Figure 16 as shown in B and C below). The cecal structure of the pVAX-ROP27 vaccine group was relatively intact. Some cecal epithelial cells were shed and necrotic, the intestinal gland structure was damaged by coccidia and formed parasitophorous vacuoles, and some gametocytes and oocysts were present in the intestinal glands and the epithelium of intestinal villi. The intestinal contents contained red blood cells and oocysts, indicating that coccidia only caused certain damage to the cecum, and the vaccine had a certain protective effect. Figure 16In (D). The cecal structure of the pVAX-ROP27-IL-2 vaccine group was basically intact, with only a small amount of cecal epithelial cell necrosis, some intestinal glands were damaged, only a small amount of coccidia were present, but there was a small amount of capillary dilation and bleeding in the lamina propria and submucosa. In addition, there was a large amount of inflammatory cell infiltration in the submucosa, causing only mild damage to the cecum, indicating that this vaccine has a protective effect. Figure 16 In (E). The cecal structure of the pVAX-ROP27-IFN-γ vaccine group was basically intact, with only partial necrosis of cecal epithelial cells, the intestinal glands were basically intact, there were relatively more coccidia than in the pVAX-ROP27-IL-2 vaccine group, but there was almost no bleeding in the small amount of capillaries in the lamina propria and submucosa. In addition, there was also a large amount of inflammatory cell infiltration in the submucosa, causing only mild damage to the cecum, indicating that this vaccine has a good immune effect. Figure 16 In (F). The cecal structure of the pVAX-ROP27-IL-2-IFN-γ vaccine group was intact, the intestinal villi and intestinal gland structures were basically intact. Compared with other vaccine groups, there were only individual coccidian oocysts and gametocytes in the intestinal epithelial cells and glands, and there were relatively fewer hemorrhagic red blood cells in the submucosa, with inflammatory cell infiltration and a relatively mild degree of damage, indicating that this vaccine has a good immune effect. Figure 16 In (G).
[0162] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. An immunomodulatory DNA vaccine for preventing Eimeria tenella in chickens, characterized in that, It contains the EtROP27 gene, the ChIL-2 gene and the ChIFN-γ gene, and the gene sequences are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively.
2. A preparation method of an immunomodulatory DNA vaccine for preventing Eimeria tenella as described in claim 1, characterized in that, Specifically, it includes the following steps: (1) Clone the EtROP27 gene, the ChIL-2 gene and the ChIFN-γ gene and conduct sequencing; (2) Construct the E. tenella DNA vaccine recombinant plasmids pVAX-ROP27, pVAX-ROP27-IL-2, pVAX-ROP27-IFN-γ, pVAX-ROP27-IL-2-IFN-γ; (3) In vivo detection of the recombinant plasmids; (4) Animal immunoprotective experiment.
3. Use of an immunomodulatory DNA vaccine for preventing Eimeria tenella in chickens as claimed in claim 1 in the preparation of a pharmaceutical preparation for preventing or treating coccidiosis in chickens.