Edible and medicinal monascus purpureus with high yield of lovastatin and application of monascus purpureus

By screening and optimizing the purple Aspergillus strain M230530Z3Db6a and its fermentation conditions, the problems of the different yield and metabolic species of the Aspergillus strain were solved, and high-efficiency and high-yield lovastatin without tangerine, improving the quality and application fields of Hongye-related products were achieved.

CN120366072APending Publication Date: 2025-07-25SHENYANG AGRI UNIV

Patent Information

Application Number
CN202510375102.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-27
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

There are differences in the yield and metabolites of existing Aspergillus strains in lovastatin and the types of metabolites, which affect product quality and efficacy. They lack excellent strains that are highly efficient and highly produced lovastatin and do not produce tangerine.

Method used

A purple Aspergillus strain M230530Z3Db6a was screened, and specific types of amino acids, organic acids and polysaccharide additives, such as burdock fructose oligosaccharides and ammonium sulfate, were added to its culture medium to optimize the fermentation conditions to improve the yield of lovastatin, and also have alcohol tolerance, temperature adaptability and pH adaptability.

Benefits of technology

It significantly increases the yield of lovastatin, ensures safety and non-toxicity, and gives fermented foods such as red koji rice, red koji sorghum, red koji wine and red koji tangerine peel and other products, improving the nutritional value and health attributes of the product.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366072A_ABST
    Figure CN120366072A_ABST
Patent Text Reader

Abstract

The invention discloses medicinal and edible monascus purpureus with high yield of lovastatin and application of the medicinal and edible monascus purpureus, and belongs to the technical field of microbial strains and fermentation engineering. The monascus purpureus M230530Z3Db6a has the following remarkable advantages that the monascus purpureus M230530Z3Db6a screened by the monascus purpureus M230530Z3Db6a has high yield of lovastatin, and the strain is safe and non-toxic; 3) the content of lovastatin can be obviously increased in the culture medium added with exogenous additives (including but not limited to glycine, galactose, burdock fructo-oligosaccharide, ammonium sulfate, tartaric acid, citric acid, ascorbic acid and other amino acids, organic acids and polysaccharides); 4) in the fermentation process of the traditional Chinese medicinal materials including the dried orange peel, the content of functional components such as total flavonoids can be remarkably increased, and the oxidation resistance is enhanced; the monascus purpureus M230530Z3Db6a has the advantages that the nutritional value of a traditional product can be improved, the product is endowed with a unique health attribute, important strain resources and technical support are provided for innovative development of monascus purpureus related industries, and the monascus purpureus M230530Z3Db6a has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microbial strains and fermentation engineering, and particularly relates to a purple Monascus which is both edible and medicinal and has a high yield of lovastatin and an application thereof. Background Art

[0002] Monascus is an important resource microorganism for both medicinal and edible purposes. Its fermented products, such as red yeast rice, have been used in China for nearly 2,000 years. Among them, lovastatin is the most important functional active substance produced by the secondary metabolism of Monascus. This substance is mainly used in traditional Chinese medicine to treat hypercholesterolemia and mixed hyperlipidemia. It can also be used to prevent and treat cardiovascular diseases such as coronary heart disease and stroke. Its main functions are: (1) Lowering blood lipids: By inhibiting the activity of hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase, it reduces cholesterol synthesis, thereby reducing the levels of total cholesterol (TC) and low-density lipoprotein cholesterol (LDI-C) in the blood. At the same time, it can also increase the level of high-density lipoprotein cholesterol (HDL-C) to a certain extent, which helps to adjust the blood lipid profile. (2) Stabilizing plaques: Long-term use of lovastatin can make atherosclerotic plaques more stable, reduce the risk of plaque rupture and thrombosis, and thus reduce the risk of cardiovascular disease. (3) Improve endothelial function: It helps to restore the normal function of endothelial cells, improve vasodilation and contraction, promote normal blood flow, and reduce damage to the vascular wall and inflammatory response. (4) Anti-inflammatory effect: It has certain anti-inflammatory properties, can reduce the inflammatory response of the vascular wall, reduce the level of inflammatory factors, and delay the progression of atherosclerosis.

[0003] As living standards improve, high-calorie diets become more prevalent, physical activity decreases, and overweight and obesity issues become increasingly prominent. Data from the World Health Organization show that the number of obese people in the world continues to grow, and obesity has become a global public health challenge. Lovastatin is an important lipid-lowering drug, and red yeast rice products are an important source of lovastatin. Red yeast rice and its related industries will also usher in new development opportunities in this process.

[0004] On March 20, 2025, the "Opinions on Improving the Quality of Traditional Chinese Medicine and Promoting the High-quality Development of the Traditional Chinese Medicine Industry" was issued. It was emphasized that to safeguard the security of industrial development, various means such as traditional knowledge protection should be used to vigorously strengthen the protection of traditional Chinese medicine resources and core technical processes. As the first-choice drug for traditional Chinese medicine to lower blood lipids, Monascus strains are the key to the efficacy of Monascus. Given the important value of Monascus products in the fields of traditional Chinese medicine and food and medicine, and the differences in the types and yields of metabolites among different Monascus strains, excellent Monascus strains with high activity have become the key objects of protection. These characteristic differences determine the quality and efficacy of Monascus products and have a profound impact on the development of related industries. Protecting excellent strains helps ensure the stable quality of Monascus products, promote industrial innovation and upgrading, and enable Monascus to continue to play a greater role in maintaining health and promoting economic development. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a Monascus purpureus strain M230530Z3Db6a that produces high levels of lovastatin and does not produce citrinin, and its applications.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] In the first aspect, the present invention provides a Monascus purpureus strain M230530Z3Db6a that produces high levels of lovastatin and does not produce citrinin. This strain is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M 20242079, the preservation date of September 25, 2024, and the preservation address of Wuhan University, Wuhan, China.

[0008] The suitable culture medium for the Monascus purpureus strain M230530Z3Db6a contains: glucose, peptone, NaNO3, MgSO4·7H2O, KH2PO4; in a feasible embodiment, per 1000 mL of the culture medium, it contains: 40 - 60 g of glucose, preferably 50 g, 10 - 20 g of peptone, preferably 15 g, 1 - 3 g of NaNO3, preferably 2 g, 0.8 - 1.2 g of MgSO4·7H2O, preferably 1 g, 1 - 2 g of KH2PO4, preferably 1.5 g, and the rest is water.

[0009] The inventors found that adding specific types of amino acid and / or organic acid and / or polysaccharide additives to its culture medium can significantly improve the ability of the Monascus purpureus strain M230530Z3Db6a to produce lovastatin.

[0010] Therefore, preferably, the suitable medium for the Monascus purpureus M230530Z3Db6a further comprises amino acid-based and / or organic acid-based and / or polysaccharide-based additives; in a preferred specific embodiment, the medium further comprises any one or more additives selected from the following: glycine, galactose, burdock oligofructose, ammonium sulfate, tartaric acid, citric acid, ascorbic acid, preferably burdock oligofructose and ammonium sulfate.

[0011] In addition, the inventors also found that the Monascus purpureus M230530Z3Db6a has strong fermentation characteristics, including alcohol tolerance, temperature adaptability, and pH adaptability.

[0012] In a second aspect, the present invention provides a fermenting agent, which comprises the Monascus purpureus M230530Z3Db6a and / or its metabolites as described in the first aspect above.

[0013] Preferably, the fermenting agent is a fermented culture of the Monascus purpureus M230530Z3Db6a;

[0014] Preferably, the fermenting agent is a fermented culture of the Monascus purpureus M230530Z3Db6a in a medium containing glucose, peptone, NaNO3, MgSO4·7H2O, and KH2PO4; more preferably, the medium further comprises amino acid-based and / or organic acid-based and / or polysaccharide-based additives; even more preferably, the medium further comprises any one or more additives selected from the following: glycine, galactose, burdock oligofructose, ammonium sulfate, tartaric acid, citric acid, ascorbic acid, preferably burdock oligofructose and ammonium sulfate; the addition amount of the additive is 0.01-10%;

[0015] Preferably, the fermenting agent is a liquid or solid preparation; optionally, the dosage form of the fermenting agent is selected from: solution, suspension, emulsion, powder, granule, pill, tablet, gel.

[0016] In a third aspect, the present invention provides a preparation method of the fermenting agent as described in the second aspect above, and the preparation method comprises: fermenting and culturing the Monascus purpureus M230530Z3Db6a as described in the first aspect above in a medium.

[0017] Preferably, the medium comprises glucose, peptone, NaNO3, MgSO4·7H2O, and KH2PO4;

[0018] Further preferably, the culture medium further contains amino acid and / or organic acid and / or polysaccharide additives; even more preferably, the culture medium further contains any one or more additives selected from the following: glycine, galactose, burdock oligofructose, ammonium sulfate, tartaric acid, citric acid, ascorbic acid, preferably burdock oligofructose and ammonium sulfate; the addition amount of the additive is 0.01-10%;

[0019] Preferably, the fermentation culture temperature is 25-35 °C, preferably 30 °C;

[0020] Preferably, the fermentation culture time is 7-40 days, preferably 29-31 days.

[0021] Fourthly, the present invention provides a composition, which comprises Monascus purpureus M230530Z3Db6a as described in the first aspect above, or comprises the fermenting agent as described in the second aspect above.

[0022] In a feasible embodiment, the composition is a food or pharmaceutical composition and further comprises a food or pharmaceutically acceptable carrier.

[0023] Fifthly, the present invention provides the use of Monascus purpureus M230530Z3Db6a as described in the first aspect above, the fermenting agent as described in the second aspect above, and / or the composition as described in the third aspect above in the preparation of fermented foods.

[0024] In a feasible embodiment, the fermented food is made from cereals, beans or Chinese medicinal herbs homologous to food and medicine;

[0025] Preferably, the raw material of the fermented food is rice, sorghum or dried tangerine peel;

[0026] Even more preferably, the fermented foods include red yeast rice, red yeast sorghum, red yeast wine, red yeast dried tangerine peel, red yeast dried tangerine peel beverage.

[0027] Sixthly, the present invention provides a method for preparing a fermented food, the method comprising: using Monascus purpureus M230530Z3Db6a as described in the first aspect above, the fermenting agent as described in the second aspect above, and / or the composition as described in the fourth aspect above, and fermenting with cereals, beans or Chinese medicinal herbs homologous to food and medicine as raw materials.

[0028] Preferably, the raw materials are selected from: rice, miscellaneous grains (such as sorghum) or dried tangerine peel;

[0029] Preferably, the fermented foods include: red yeast rice, red yeast sorghum, red yeast wine, red yeast dried tangerine peel, red yeast dried tangerine peel beverage;

[0030] Preferably, the fermentation temperature is 25-35 °C, preferably 30 °C;

[0031] Preferably, the fermentation time is 5 - 10 days, preferably 6 - 8 days.

[0032] By fermenting rice using the above method, red yeast rice with a high lovastatin content and being non-toxic and harmless can be obtained;

[0033] By fermenting sorghum using the above method, red yeast sorghum with a fermented aroma and a high lovastatin content can be obtained;

[0034] By brewing wine using the above method, the obtained red yeast wine with lovastatin has a light orange color, is uniform and natural, has a smooth taste, and is non-toxic and harmless;

[0035] By fermenting tangerine peel using the above method, the total flavonoid content and its antioxidant activity of tangerine peel can be greatly improved.

[0036] In a seventh aspect, the present invention provides a method for producing lovastatin, the method comprising: fermenting and culturing Monascus purpureus M230530Z3Db6a as described in claim 1 in a medium containing glucose, peptone, NaNO3, MgSO4·7H2O, and KH2PO4 to produce lovastatin;

[0037] In a feasible embodiment, every 1000 mL of the medium contains: 40 - 60 g of glucose, preferably 50 g, 10 - 20 g of peptone, preferably 15 g, 1 - 3 g of NaNO3, preferably 2 g, 0.8 - 1.2 g of MgSO4·7H2O, preferably 1 g, 1 - 2 g of KH2PO4, preferably 1.5 g, and the rest is water.

[0038] Preferably, the medium further contains amino acid-based and / or organic acid-based and / or polysaccharide-based additives.

[0039] More preferably, the medium further contains any one or more than two additives selected from the following: glycine, galactose, burdock oligofructose, ammonium sulfate, tartaric acid, citric acid, ascorbic acid, preferably selected from: burdock oligofructose and ammonium sulfate; the addition amount of the additive is 0.01 - 10%;

[0040] Preferably, the fermentation and culture temperature is 25 - 35 °C, preferably 30 °C;

[0041] Preferably, the fermentation and culture time is 7 - 40 days, preferably 29 - 31 days.

[0042] Preferably, the method further includes the step of separating and purifying lovastatin from the fermentation culture.

[0043] Advantages of the present invention:

[0044] The Monascus purpureus M230530Z3Db6a screened by the present invention has high lovastatin production and does not produce citrinin, is safe and non-toxic, has strong fermentation characteristics, and can significantly increase the lovastatin content in a medium added with exogenous additives (including but not limited to amino acids, organic acids, polysaccharides such as glycine, galactose, burdock fructooligosaccharide, ammonium sulfate, tartaric acid, citric acid, ascorbic acid, etc.). This discovery provides a new technical idea for the efficient biosynthesis of lovastatin; in addition, inoculating Monascus purpureus M230530Z3Db6a into cereal grains such as rice and sorghum can endow the cereal grains with functional characteristics; using Monascus purpureus M230530Z3Db6a for fermented wine making can make the wine aroma rich in layers and increase the functional activity; fermenting dried tangerine peel with Monascus purpureus M230530Z3Db6a can increase the total flavonoid content in the dried tangerine peel and improve its antioxidant activity, providing a new way for the value-added development of traditional Chinese medicinal materials. In summary, the Monascus purpureus M230530Z3Db6a of the present invention has significant technical advantages in promoting lovastatin production, expanding the application field, and increasing the added value of products, providing important strain resources and technical support for the innovative development of the Monascus-related industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] To more clearly illustrate the embodiments of the present invention, the drawings involved in the embodiments will be briefly introduced below.

[0046] Figure 1 Colony morphology diagrams of Monascus purpureus M230530Z3Db6a cultured at a constant temperature of 30 °C for 7 d, 15 d, and 30 d in PDA medium.

[0047] Figure 2 Observation result diagrams of Monascus purpureus M230530Z3Db6a under an optical microscope.

[0048] Figure 3 Phylogenetic tree constructed for Monascus purpureus M230530Z3Db6a based on ITS sequencing.

[0049] Figure 4 Phylogenetic tree constructed for Monascus purpureus M230530Z3Db6a based on β-tubulin sequencing.

[0050] Figure 5 ISSR amplification detection result diagrams of different primers for Monascus purpureus M230530Z3Db6a.

[0051] Figure 6 Appearance diagram of Monascus rice of Monascus purpureus M230530Z3Db6a.

[0052] Figure 7 Appearance diagram of Monascus sorghum of Monascus purpureus M230530Z3Db6a.

[0053] Figure 8 It is a picture of Monascus purpureus M230530Z3Db6a red yeast rice wine.

[0054] Figure 9 It is an external view picture of Monascus purpureus M230530Z3Db6a red yeast rice with dried tangerine peel.

[0055] Figure 10 It is an external view picture of Monascus purpureus M230530Z3Db6a red yeast rice with dried tangerine peel beverage. Specific implementation manners

[0056] The present invention will be described in detail below in conjunction with embodiments, but the implementation manners of the present invention are not limited thereto. Obviously, the embodiments described below are only partial embodiments of the present invention. For those skilled in the art, without creative efforts, obtaining other similar embodiments all fall within the protection scope of the present invention.

[0057] The culture medium formula and index determination method used in the present invention are as follows:

[0058] PD culture medium: 60 g potatoes, 6 g glucose, 300 mL distilled water, sterilized at 121 °C for 30 min.

[0059] PDA culture medium: 60 g potatoes, 6 g glucose, 6 g agar, 300 mL distilled water, sterilized at 121 °C for 30 min.

[0060] Seed liquid culture medium: 50 g glucose, 15 g peptone, 2 g NaNO3, 1 g MgSO4·7H2O, 1.5 g KH2PO4, sterilized at 121 °C for 30 min.

[0061] Liquid culture medium: 50 g glucose, 15 g peptone, 2 g NaNO3, 1 g MgSO4·7H2O, 1.5 g KH2PO4, sterilized at 121 °C for 30 min.

[0062] The Monascus strains in this embodiment are isolated and screened from relevant naturally fermented red yeast rice from various places;

[0063] The determination method of lovastatin in the embodiment is as follows: Weigh 100.0 mg of the sample, add an appropriate amount of acetonitrile to dissolve the sample, shake well, ultrasonicate for 1 h, then add acetonitrile to make the volume up to 1 mL, continue to ultrasonicate for 10 min, cool to room temperature, centrifuge at 8000 r / min for 10 min, filter the supernatant with a 0.22 μm microporous filter membrane, and determine the lovastatin content by high performance liquid chromatography.

[0064] The detection conditions for high performance liquid chromatography are as follows: Shimadzu high performance liquid chromatograph (equipped with a diode array detector) is selected, and the chromatographic column is Inert Systain AQ-C18 (250x4.6 mm, 5um). The column temperature is controlled at 30 °C, the mobile phase is methanol: phosphoric acid aqueous solution (pH = 4.0) = 80:20 (v / v), the detection wavelength is 238 nm, the injection volume is 10 uL, and the flow rate is 1 mL / min.

[0065] In the examples, the contents of monascus pigments, citrinin, reducing sugar and total acid were determined with reference to the national standards GB 1886.19-2015 "Food Additive Monascus Rice", GB 5009.222-2016 "Determination of Citrinin in Foods", QB 5334-2019 "Red Yeast Rice Wine" and GB 13662-2018 "Yellow Rice Wine".

[0066] Screening of Monascus purpureus M230530Z3Db6a in Example 1

[0067] The strains of the present invention are selected from the Monascus strain library of Shenyang Agricultural University, and the strains in the library are all isolated from naturally fermented monascus rice. The Monascus purpureus M230530Z3Db6a of the present invention is obtained through primary screening and secondary screening. The specific steps are as follows:

[0068] 1. Primary screening of strains:

[0069] The seed liquid culture method is adopted to preliminarily screen Monascus strains with high lovastatin content.

[0070] Screening steps: Take out the stored Monascus cake from the -80 °C refrigerator, dissolve it under natural conditions, and then place it in a PDA medium and incubate it at 30 °C for 7 days. Pick the spores on the surface of the PDA medium into sterile water to prepare a spore suspension with a spore concentration of 1×10 6 spores / mL. Take 4 mL of each spore suspension and add it to 50 mL of the seed liquid medium, and incubate it at 30 °C and 180 r / min for 7 days.

[0071] Determination of lovastatin: Take 1 mL of the sample fermentation broth, add 9 mL of 70% ethanol and shake well. After shaking at 28 °C and 140 r / min for 1 h, take it out, centrifuge at 4200 r / min for 5 min, and measure the absorbance value of lovastatin at OD 237nm .

[0072] Results: The lovastatin production of 20 Monascus strains is above 1 U / mL, so these strains are selected for the subsequent secondary screening.

[0073] 2. Secondary screening of strains:

[0074] The solid state fermentation is adopted to re-screen Monascus strains with high lovastatin production.

[0075] Screening step: The seed solutions of 20 Monascus strains obtained from primary screening were subjected to solid-state fermentation culture: Weigh 20 g of polished rice, wash it with clear water until it is no longer turbid, then add it to the fermentation tank. Add 40 mL of water to the fermentation tank, soak for 24 - 28 h, wash and drain the soaked rice, and sterilize it at 115 °C for 20 min. After cooling, absorb 10% of the seed solution for solid-state fermentation, place it in a constant temperature incubator at 30 °C for 7 d, then grind it into powder, and measure the lovastatin and citrinin contents.

[0076] For the high-yield lovastatin and non-citrinin-producing strains finally screened, prepare fermentation inoculants. Inoculate the spore suspension of this strain into the liquid medium, and culture it at 30 °C and 180 r / min for 4 d to obtain the fermentation inoculant of this strain.

[0077] The results showed that 6 strains produced citrinin. 14 strains did not produce citrinin. Among them, the lovastatin content of M230530Z3Db6a was the highest, reaching 7.83 mg / g. Therefore, the M230530Z3Db6a strain was finally determined as a high-quality strain with high lovastatin production and no citrinin production.

[0078] Table 1 Lovastatin and citrinin contents of the re-screened strains

[0079]

[0080] Example 2 Morphological identification of Monascus purpureus M230530Z3Db6a

[0081] Observation by plate culture method: Inoculate the activated M230530Z3Db6a bacterial cake into the PDA medium, and incubate it at a constant temperature of 30 °C for 7 d, 15 d, and 30 d, and observe its colony morphology, color, and growth conditions.

[0082] The results are as Figure 1 shown. On the 7th day, the colony of M230530Z3Db6a was circular, with a diameter of 13 - 16 mm, and the mycelium was orange; on the 15th day, the colony diameter of M230530Z3Db6a was 36 - 38 mm, the mycelium was orange, and the edge was complete; on the 30th day, the colony diameter of M230530Z3Db6a was 41 - 44 mm, and the mycelium was red; the color of the PDA medium gradually changed from transparent to orange and finally to red.

[0083] Observation by optical microscope: Add an appropriate amount of distilled water to the plate, gently scrape off the mycelium and spores on the bacterial cake, absorb 10 μL and drop it onto the glass slide, and use an optical microscope to observe the morphological characteristics of conidia, ascospores, ascocarps, etc.

[0084] The results are as Figure 2As shown, the hyphae of M230530Z3Db6a are irregularly branched, transparent, septate, and have wart-like crystals on the wall; the ascocarp type is cleistothecium, and there are many asci scattered in the ascocarp, which are spherical, and each ascus contains ascospores, and the ascospores are spherical or oval.

[0085] Example 3 Molecular Identification of Monascus purpureus M230530Z3Db6a

[0086] DNA Extraction: Inoculate the hyphae of strain M230530Z3Db6a into PD medium, culture for 4 days on a constant temperature shaker at 32 °C and 120 r / min, then filter and dry at 60 °C. Take 0.1 g of hyphae and extract DNA with reference to the fungal genomic DNA kit (Shenyang Wanlei Company).

[0087] For the identification of this strain, ITS sequence and β-tubulin sequence were selected for analysis, and the specific operations are as follows:

[0088] 1. ITS Phylogenetic Tree Analysis:

[0089] ITS Sequence Primers: Use ITS5 (5’-GGAAGTAAAAGTCGTAACAAGG-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) for PCR amplification.

[0090] Sequencing and Identification: After the purified PCR product was sequenced by Shanghai Bioengineering Company, a phylogenetic analysis was further constructed for strain M230530Z3Db6a and the type strain ( Figure 3 ).

[0091] The ITS sequence of M230530Z3Db6a is as follows (SEQ ID NO.1):

[0092] TACGAGTGCGGGTCCCTTCGTGGGACCCAACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGAGGA。

[0093] The results showed that the homology between strain M230530Z3Db6a and Monascus purpureus MN 156545.1 reached 99%, and strain M230530Z3Db6a was identified as Monascus sp.

[0094] 2. Phylogenetic tree analysis of β-tubulin:

[0095] β-tubulin sequence primers: Bt2a (5'-GGTAACCAAATCGGTGCTGCTTTC-3') and Bt2b (5'-ACCCTCAGTGTAGTGACCCTTGGC-3') were used for Ben A region PCR amplification.

[0096] Sequencing and identification: The purified PCR products were sent to Shanghai Bioengineering Company for sequencing, and a phylogenetic analysis was further constructed for strain M230530Z3Db6a and the type strain ( Figure 4 ).

[0097] The β-tubulin sequence of M230530Z3Db6a is as follows (SEQ ID NO.2):

[0098] GGTAACCCAAAACGGTGCTGCTTTCTGGTATGTTATTCAGGCGATTGAACGATATGGAAGAACGCGTAGACCCCATTCCTGGTGGATGAGGTTCCAGCTGTTCTTTTGTTTTCTGGGTCCGAGTTTTTGCTGACTTGTTCTTTTATAGGCAGAACATCTCTGGTGAGCACGGCCTTGATGGCTCCGGTGTGTAAGTAGAAACCTTTTCCATCTATCTCAAGGCATTGTACAGGGTGTGAGGGGAAAAGGGGCATCAATGTCTAATGTGATAACAGCTACCATGGTACTTCCGACCTTCAGTTGGAGCGTATCAACGTTTACTTCAACGAGGTTCGTCCTGTGGTGGATTCCTATTCCAAGTAGAGCACCTTTCTGATAATTTCGATTAGGCCAGTGGTCAGAAGTACGTTCCTCGTGCCGTCCTGGTCGACCTCGAGCCCGGTACCATGGATGCCGTCCGTGCTGGTCCCTTCGGTGAACTTTTCCGCCCCGACAACTTCATCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAACCTGAGGGGTA。

[0099] The results showed that the homology between strain M230530Z3Db6a and Monascus purpureus MN 229577.1 was 99%, and strain M230530Z3Db6a was identified as Monascus purpureus.

[0100] Example 4 ISSR fingerprint of Monascus purpureus M230530Z3Db6a

[0101] ISSR is suitable for marking the differences within microbial populations. In this example, 8 ISSR primers were used to construct the fingerprint of the strain M230530Z3Db6a of the present invention.

[0102] Selection of primers: The 8 selected primers are all from the 100 ISSR primers published by Columbia University, numbered 816, 817, 836, 855, 857, 888, 889, and 890 respectively. The specific sequences are shown in Table 2.

[0103] Table 2 Tested ISSR primers

[0104]

[0105] Note: Among them, Y = (C, T), B = (C, G, T), D = (A, G, T), H = (A, C, T), V = (A, C, G)

[0106] PCR reaction system (total volume 25 μL): 1.5 μL of DNA, 1.5 μL of primer, 9.5 μL of dd H2O, and 12.5 μL of 2×TaqMaster Mix DNA polymerase.

[0107] Amplification program: Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at the optimal annealing temperature for 45 s, a total of 35 cycles, and extension at 72°C for 7 min.

[0108] Construction of ISSR map: Prepare a 1.5% agarose gel, take 5 μL of the PCR product for loading and electrophoresis. The voltage is 100 V. Stop electrophoresis when the bromophenol blue dye band in the gel moves close to the end of the gel. Observe on the gel imaging system and take pictures for recording. The obtained map is the DNA fingerprint map of the PCR product.

[0109] The fingerprint maps obtained by amplifying the strains of the present invention with 8 primers are shown in Figure 5 , among which,

[0110] The map amplified by primer 816 has 4 obvious bands, 2 bands are distributed in the range of 1000 - 2000 bp, and 2 bands are distributed in the range of 500 - 750 bp;

[0111] Primer 817 has 4 obvious bands, 2 bands are distributed in the range of 500 - 750 bp, and 2 bands are distributed in the range of 750 - 1000 bp;

[0112] The primer 836 amplified more bands, with a total of 8 clear bands. 3 bands are distributed in the range of 250 - 500 bp, and 5 bands are concentrated in the range of 750 - 2000 bp;

[0113] Primer 855 has 1 particularly clear band, concentrated in the range of 1000 - 2000 bp;

[0114] Primer 857 has 3 particularly clear bands, mainly concentrated in the range of 500 - 1000 bp;

[0115] The primer 888 amplified more bands. There were 7 clear bands, 1 band was distributed at 2000 bp, 2 bands were distributed in the range of 1000 - 2000 bp, and 4 bands were distributed in the range of 250 - 750 bp.

[0116] The primer 889 had 3 particularly clear bands. Among them, 2 bands were concentrated at 1000 bp and 1 band was at 500 bp.

[0117] The primer 890 had 6 clear bands, and the band at 1000 bp had the most prominent brightness.

[0118] Example 5 Effect of Different Exogenous Additives on the Lovastatin Production Capacity of Monascus purpureus M230530Z3Db6a

[0119] Through solid - state fermentation, the effect of exogenous addition on the lovastatin content produced by Monascus purpureus M230530Z3Db6a was observed.

[0120] Screening of different exogenous additives: 7 exogenous additives (glycine, galactose, burdock oligosaccharide, ammonium sulfate, tartaric acid, citric acid, ascorbic acid) were added to the seed liquid of Monascus purpureus M230530Z3Db6a respectively, with an addition amount of 5 g / L. After mixing evenly, solid - state fermentation was carried out. The process of solid - state fermentation was referred to Example 1, and it was incubated at a constant temperature of 30 °C for 7 d. Then 1 g of red yeast rice was ground into powder, and the lovastatin and citrinin contents were measured. The group without adding exogenous additives was used as the CK control group.

[0121] The results are shown in Table 3. After adding burdock oligosaccharide and ammonium sulfate, the lovastatin contents were 11.35 mg / g and 11.33 mg / g respectively, which were about 1 time higher than the lovastatin content of the CK group (7.83 mg / g). Among them, the addition of burdock oligosaccharide was the most significant, and no citrinin was produced. The addition of glycine and galactose also promoted the increase of lovastatin. Although the addition of organic acids (tartaric acid, citric acid, ascorbic acid) significantly increased the lovastatin content, it also promoted the production of citrinin. The above results indicate that burdock oligosaccharide has the most significant effect on the lovastatin content and does not produce citrinin.

[0122] Table 3 Effects of Different Exogenous Additives on Lovastatin and Citrinin of Monascus purpureus M230530Z3Db6a Strain

[0123]

[0124]

[0125] Determination of fermentation time: Through the screening of the above 7 kinds of exogenous additives, the fermentation time of the finally screened exogenous substance (burdock fructooligosaccharide) was determined. By fermenting for 2 - 40 days, the effect of the finally screened exogenous addition on the content of lovastatin produced was observed.

[0126] The results are shown in Table 4. During the 2 - 40 days after adding burdock fructooligosaccharide, the content of lovastatin showed a trend of first increasing and then decreasing. When the fermentation time was 18 days, the content of lovastatin reached 29.85 mg / g. When the fermentation days were 30 days, the content of lovastatin was the highest, at 49.65 mg / g.

[0127] Table 4 Effects of fermentation time on lovastatin and citrinin of Monascus purpureus M230530Z3Db6a strain

[0128]

[0129] Example 6 Alcohol tolerance of Monascus purpureus M230530Z3Db6a strain

[0130] Take an appropriate amount of the spore suspension of Monascus purpureus M230530Z3Db6a and inoculate it into PD medium and PDA plate medium with alcohol concentrations of 8%, 10%, 12%, 15%, 18%, and 20% respectively. Among them, the PD medium was incubated at 30 °C and 180 r / min for 4 days; the PDA plate medium was incubated statically at 30 °C.

[0131] The results are shown in Table 5. Monascus purpureus M230530Z3Db6a can grow within the range of alcohol content ≤ 18% and has strong alcohol tolerance.

[0132] Table 5 Effects of alcohol concentration on the growth of Monascus purpureus M230530Z3Db6a

[0133]

[0134] Note: "-" means no growth; "±" means slight growth; "+" means general growth; "++" means good growth; "+++" means vigorous growth;

[0135] The volume of the samples for growth measurement is 30 mL for all.

[0136] Example 7 Temperature adaptability of Monascus purpureus M230530Z3Db6a strain

[0137] Take an appropriate amount of the spore suspension of Monascus purpureus M230530Z3Db6a and inoculate it into PD medium and PDA plate medium. The PD medium is placed in a constant temperature shaker at 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, and 180 r / min for 4 days. The PDA plate medium is placed under constant temperature static culture at 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C.

[0138] As shown in Table 6, under the conditions of 15°C - 45°C, the strain M230530Z3Db6a can grow, and it has strong temperature adaptability.

[0139] Table 6 Effects of temperature on the growth of Monascus purpureus M230530Z3Db6a

[0140]

[0141] Note: "-" means no growth; "±" means slightly growing; "+" means average growth; "++" means good growth; "+++" means vigorous growth;

[0142] The volume of the samples for measuring the growth amount is 30 mL for all.

[0143] Example 8 pH adaptability of Monascus purpureus M230530Z3Db6a

[0144] Take an appropriate amount of the spore suspension of Monascus purpureus M230530Z3Db6a and inoculate it into PD medium with pH values of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0 respectively, and culture it under constant temperature at 30°C and 180 r / min for 4 days.

[0145] As shown in Table 7, Monascus purpureus M230530Z3Db6a has strong pH adaptability and can grow in both strong acid fermentation environment and weak base fermentation environment.

[0146] Table 7 Effects of pH value on the growth of Monascus purpureus M230530Z3Db6a

[0147]

[0148] Note: "-" means no growth; "±" means slightly growing; "+" means average growth; "++" means good growth; "+++" means vigorous growth;

[0149] The volume of the samples for measuring the growth amount is 30 mL for all.

[0150] Example 9 Preparation of lovastatin red yeast rice using Monascus purpureus M230530Z3Db6a

[0151] Preparation of Monascus rice: Weigh 20 g of high-quality japonica rice, put it into a fermentation tank, and wash it 3 - 4 times with clear water until the water is no longer turbid. Add 40 mL of water to the fermentation tank and soak for 24 - 28 h until the rice fully absorbs water. Wash and drain the soaked rice, and sterilize it at 115 °C for 20 min. After cooling, suck 10% of the fermentation agent of Monascus purpureus M230530Z3Db6a into the fermentation tank, and stir well to make the seed liquid evenly distributed on the rice grains. Seal the fermentation tank and place it in a constant temperature incubator at 30 °C for 7 days to obtain Monascus rice.

[0152] Determination method: Grind the Monascus rice into powder, and determine its lovastatin content and citrinin content by high performance liquid chromatography.

[0153] The results showed that the lovastatin content in the Monascus rice of Monascus purpureus M230530Z3Db6a was 7.67 mg / g, and no citrinin was produced.

[0154] Sensory evaluation of the Monascus rice of Monascus purpureus M230530Z3Db6a found that the Monascus rice of Monascus purpureus M230530Z3Db6a was red in color, the rice grains were intact, there was no obvious adhesion between the grains, and at the same time there was a fermented koji smell ( Figure 6 ).

[0155] Example 10 Preparation of high-lovastatin Monascus sorghum using Monascus purpureus M230530Z3Db6a

[0156] Preparation of Monascus sorghum rice: Weigh 20 g of sorghum rice, wash it 3 - 4 times with clear water until the water is no longer turbid, add 40 mL of water to the fermentation tank, and soak for 24 - 28 h until the sorghum rice fully absorbs water. Wash and drain the soaked sorghum, and sterilize it at 115 °C for 20 min. After cooling, suck 10% of the fermentation agent of Monascus purpureus M230530Z3Db6a into the fermentation tank, and place it in a constant temperature incubator at 30 °C for 7 days to obtain Monascus sorghum.

[0157] Determination method: Grind the Monascus sorghum into powder, and determine its lovastatin content and citrinin content. The determination method of lovastatin is detailed in Example 9. The determination method of citrinin refers to the national standard GB 5009.222 - 2016 "Determination of citrinin in foods".

[0158] The results showed that the lovastatin content in the Monascus sorghum of Monascus purpureus M230530Z3Db6a was 5.44 mg / g, and there was no citrinin.

[0159] Sensory evaluation of the Monascus sorghum of Monascus purpureus M230530Z3Db6a found that the Monascus sorghum of Monascus purpureus M230530Z3Db6a was red in color, brittle in texture, the grains were intact and non-adherent, and there was a fermented koji aroma ( Figure 7 ).

[0160] Example 11 Preparation of Monascus purpureus - fermented red rice wine with high lovastatin content using Monascus purpureus M230530Z3Db6a

[0161] Method for preparing red rice wine: Weigh 20 g of high - quality japonica rice and put it into a conical flask. Wash it 3 - 4 times with clear water until the washing water is no longer turbid. Then add 40 mL of water and soak for 24 - 48 h until the rice fully absorbs water. Wash and drain the soaked rice, and sterilize it at 115 °C for 20 min. After cooling to room temperature, add 40 mL of sterile distilled water, 10% of the red rice from Example 9, and 0.72% of medium - temperature saccharifying enzyme. Seal and store it in an incubator at 30 °C for 7 d, and shake the wine liquid every 12 h during this period. Squeeze and filter the fermented wine liquid, and decoct the wine in a constant - temperature water bath at 80 °C for 15 min. After complete sedimentation, take the supernatant and transfer it to a sterile storage bottle, seal it, and store it at 4 °C.

[0162] Determination method: Take an appropriate amount of the wine liquid to measure the relevant indicators of lovastatin, Monascus pigment, citrinin, reducing sugar, and total acid content, and conduct a sensory evaluation of the wine liquid. The determination of relevant indicators refers to the national standards GB 1886.19 - 2015 "Food additive - Red rice", GB 5009.222 - 2016 "Determination of citrinin in foods", QB 5334 - 2019 "Red rice wine", and GB13662 - 2018 "Yellow rice wine" respectively.

[0163] The results show that the lovastatin content in the red rice wine fermented by Monascus purpureus M230530Z3Db6a is 3.376 mg / g, the Monascus pigment content is 2.707 U / mL, the reducing sugar content is 25.0474 g / L, the total acid content is 6.48 g / L, the alcohol content is 6.8%, and there is no citrinin.

[0164] The sensory evaluation of the red rice wine fermented by Monascus purpureus M230530Z3Db6a shows that the color of the red rice wine fermented by Monascus purpureus M230530Z3Db6a is light orange and natural; the red rice wine contains the aroma of rice, wine, and the unique aroma of Monascus. The aroma of the wine has rich layers; the red rice wine has a smooth taste, is slightly sweet and mellow, and has no alcohol pungency( Figure 8 )

[0165] Example 12 Fermentation of tangerine peel by Monascus purpureus M230530Z3Db6a

[0166] Tangerine peel is commonly used in traditional Chinese medicine and traditional diet therapy. It has the functions of regulating qi and strengthening the spleen, relieving cough and reducing phlegm, and anti-oxidation. Generally, consumers obtain the active substances in tangerine peel by brewing it. Monascus is a fungus that is both a medicine and food. Its metabolite, lovastatin, has the functions of lowering cholesterol and blood sugar. Fermenting tangerine peel with Monascus can not only significantly increase the content of functional ingredients in tangerine peel, but also give tangerine peel the functional characteristics of Monascus.

[0167] The method for fermenting tangerine peel is as follows: 5 g tangerine peel is weighed and put into a fermentation tank, rinsed with clean water for 3-4 times, then drained, sterilized at 115° C. for 20 min, cooled to room temperature, added with 10% purple Monascus M230530Z3Db6a fermentation agent and placed in the fermentation tank, sealed and stored, cultured in a 30° C. constant temperature incubator for 7 days, shaken once every 12 hours, and dried at 40° C. for 4 hours to obtain red yeast tangerine peel.

[0168] Determination of red yeast rice and tangerine peel: Take an appropriate amount of red yeast rice and tangerine peel to determine the indicators related to lovastatin, citrinin, total flavonoids, and antioxidant activity. The following is the specific operation method:

[0169] Drawing of the standard curve of total flavonoids: Pipette 0.2mg / mL rutin standard solution 0mL, 0.2mL, 0.4mL, 0.6mL, 0.8mL, 1.0mL into a 10mL test tube, add 1mL of 5% NaNO2, shake well, let stand for 6min, add 1mL of 10% Al(NO3)3, shake well, let stand for 6min. Finally, add 5mL of 4% NaOH, make up to volume with 70% ethanol, shake well, let stand for 15min. Measure the absorbance at 510nm, and get the regression equation of Y=0.0053x+0.0009, R 2 =0.9996.

[0170] Sample determination method: crush the red yeast rice and tangerine peel sample, sieve, weigh about 0.1g of powder, add 5mL of 7% ethanol, water bath for 1h, centrifuge at 8000rpm for 5min, collect the supernatant. Measure 0.5mL of the test solution, add 1mL of 5% NaNO2, shake well, let stand for 6min, add 1mL of 10% Al(NO3)3, shake well, let stand for 6

[0171] min. Finally, add 5 mL of 4% NaOH, dilute with 70% ethanol, shake well, and let stand for 15 min. Measure the absorbance at a wavelength of 510 nm and calculate the total flavonoid content in mg / g.

[0172] Determination of DPPH free radical scavenging ability: After centrifugation of the fermentation broth, take the supernatant, dilute it 10 times with distilled water, take 0.3 mL and add 3.7 mL 1.0×10 -4DPPH solution at mol / L was added, and after thorough mixing, the reaction was carried out in the dark at room temperature for 20 min. Then, it was centrifuged at 8000 rpm for 5 min. The supernatant was taken to measure its absorbance at a wavelength of 517 nm, and the DPPH radical scavenging rate was calculated. The calculation formula for the DPPH radical scavenging rate is as follows:

[0173] DPPH radical scavenging rate (%) = [1 - (A1 - A2)] / A0 × 100%;

[0174] In the formula: A1 is the absorbance value of the supernatant; A2 is the absorbance value of the reference control (anhydrous ethanol instead of DPPH - ethanol solution); A0 is the absorbance value of the blank control (distilled water instead of the sample).

[0175] The results are shown in Table 8. The lovastatin content in the red yeast rice - aged tangerine peel fermented by Monascus purpureus M230530Z3Db6a was 4.756 mg / g, and the total flavonoid content was 8.32 mg / g, which was 1.3 times that of the tangerine peel (6.31 mg / g) without inoculating Monascus purpureus M230530Z3Db6a fermentation, and there was no citrinin. The tangerine peel fermented by Monascus purpureus M230530Z3Db6a not only contained lovastatin but also significantly increased the total flavonoid content in the tangerine peel. In addition, the addition of Monascus purpureus M230530Z3Db6a could improve the antioxidant ability of the tangerine peel, and its DPPH radical scavenging rate could reach 79.30%, which was 1.7 times that of the tangerine peel (45.62%) without inoculating Monascus purpureus M230530Z3Db6a fermentation.

[0176] Sensory evaluation of the red yeast rice - aged tangerine peel fermented by Monascus purpureus M230530Z3Db6a found that the red yeast rice - aged tangerine peel fermented by Monascus purpureus M230530Z3Db6a was dark brown in color, brittle in texture, and had a fermented aroma and the delicate fragrance of tangerine peel ( Figure 9 ).

[0177] Table 8 Comparison of pigment content, total flavonoids, and antioxidant activity between fermented tangerine peel and unfermented tangerine peel

[0178]

[0179] Example 13 Preparation of red yeast rice - aged tangerine peel beverage using Monascus purpureus M230530Z3Db6a

[0180] Preparation and determination of the red yeast rice - aged tangerine peel beverage: 1.5 g of the tangerine peel fermented by Monascus purpureus M230530Z3Db6a and unfermented tangerine peel were each taken and added with 13.5 mL of normal - temperature purified water for brewing. After brewing for 10 min, 1 mL of the brewing liquid of the fermented tangerine peel and unfermented tangerine peel was taken respectively to compare the color, total flavonoid content, and antioxidant activity (for the specific operation, see the above - mentioned determination method of red yeast rice - aged tangerine peel).

[0181] The results are shown in Table 9. The lovastatin content of the red yeast tangerine peel beverage fermented by Monascus purpureus M230530Z3Db6a was 2.98 U / mL, and the total flavonoid content (5.99 mg / g) was 1.6 times that of the un-inoculated beverage (3.67 mg / g), and no citrinin was produced. In addition, the DPPH free radical scavenging rate of the fermented beverage was 65.75%, which was 1.6 times that of the un-inoculated beverage (39.21%). The results indicate that the beverage fermented by Monascus purpureus M230530Z3Db6a also has high antioxidant activity.

[0182] Sensory evaluation of the red yeast tangerine peel beverage fermented by Monascus purpureus M230530Z3Db6a found that the color of the red yeast tangerine peel beverage fermented by Monascus purpureus M230530Z3Db6a was brownish-yellow, with the aroma of tangerine peel and a unique koji aroma ( Figure 9 、 10 ). In addition, the red yeast tangerine peel beverage (liquid) was prepared into a red yeast tangerine peel solid powder by dry spraying, and then brewed. The beverage had good solubility, a smooth taste, and the fragrance of tangerine peel and koji.

[0183] Table 9 Comparison of pigment content, total flavonoids, and antioxidant activity between fermented tangerine peel and unfermented tangerine peel beverages

[0184]

[0185] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A high-yield lovastatin-producing and citrinin-non-producing Monascus purpureus M230530Z3Db6a, characterized in that, This strain is deposited in the China Center for Type Culture Collection, with the deposit number CCTCC NO: M 20242079, the deposit date being September 25, 2024, and the deposit address being Wuhan University, Wuhan, China.

2. A starter culture, characterized in that, Including the Monascus purpureus M230530Z3Db6a described in claim 1 and / or its metabolites.

3. The starter culture according to claim 2, characterized in that, The starter is a fermentation culture of Monascus purpureus M230530Z3Db6a; Preferably, the starter is a fermentation culture of Monascus purpureus M230530Z3Db6a in a medium containing glucose, peptone, NaNO3, MgSO4·7H2O, KH2PO4; More preferably, the medium further contains amino acid-based and / or organic acid-based and / or polysaccharide-based additives; Even more preferably, the medium further contains any one or more of the following additives: glycine, galactose, burdock oligofructose, ammonium sulfate, tartaric acid, citric acid, ascorbic acid, preferably burdock oligofructose and ammonium sulfate; The starter is a liquid or solid preparation; The dosage form of the starter is selected from solution, suspension, emulsion, powder, granule, pill, tablet, gel.

4. The preparation method of the starter culture according to claim 2 or 3, characterized in that, Prepared by fermenting the Monascus purpureus M230530Z3Db6a described in claim 1; Preferably, the medium contains glucose, peptone, NaNO3, MgSO4·7H2O, KH2PO4; More preferably, the medium further contains amino acid-based and / or organic acid-based and / or polysaccharide-based additives; Even more preferably, the medium further contains any one or more of the following additives: glycine, galactose, burdock oligofructose, ammonium sulfate, tartaric acid, citric acid, ascorbic acid, preferably burdock oligofructose and ammonium sulfate; The fermentation culture temperature is 25 - 35 °C, preferably 30 °C; The fermentation culture time is 7 - 40 days, preferably 29 - 31 days.

5. A composition, characterized in that, The composition contains the Monascus purpureus M230530Z3Db6a described in claim 1, or contains the starter described in claim 2 or 3; The composition is a food or pharmaceutical composition, which further contains a food or pharmaceutically acceptable carrier.

6. Use of the Monascus purpureus M230530Z3Db6a described in claim 1, the starter described in claim 2 or 3, and / or the composition described in claim 5 in the preparation of fermented foods.

7. The use according to claim 6, characterized in that, The fermented food is made from cereals, legumes or Chinese medicinal herbs homologous to food and medicine; Preferably, the raw material of the fermented food is rice, sorghum or tangerine peel; More preferably, the fermented foods include red yeast rice, red yeast sorghum, red yeast wine, red yeast tangerine peel, red yeast tangerine peel beverage.

8. A method for preparing a fermented food, characterized in that, The method includes: fermenting with the Monascus purpureus M230530Z3Db6a described in claim 1, the starter described in claim 2 or 3, and / or the composition described in claim 5, using cereals, legumes or Chinese medicinal herbs homologous to food and medicine as raw materials.

9. The method according to claim 8, wherein The raw materials are selected from rice, sorghum or tangerine peel; The fermented foods include: red yeast rice, red yeast sorghum, red yeast wine, red yeast tangerine peel, and red yeast tangerine peel beverage; The fermentation temperature is 25-35°C, preferably 30°C; The fermentation time is 5-10 days, preferably 6-8 days.

10. A method for producing lovastatin, characterized in that, The method includes: fermenting and culturing Monascus purpureus M230530Z3Db6a as described in claim 1 in a medium containing glucose, peptone, NaNO3, MgSO4·7H2O, and KH2PO4 to produce lovastatin; Preferably, the method further includes the step of separating and purifying lovastatin from the fermentation culture; Preferably, the medium further contains amino acid-based and / or organic acid-based and / or polysaccharide-based additives; more preferably, the medium further contains any one or more of the following additives: glycine, galactose, burdock oligofructose, ammonium sulfate, tartaric acid, citric acid, ascorbic acid, preferably burdock oligofructose and ammonium sulfate; The fermentation and culture temperature is 25-35°C, preferably 30°C; The fermentation and culture time is 7-40 days, preferably 29-31 days.

Citation Information

Patent Citations

  • Monascus purpureus W-4 with high yield of lovastatin and application thereof

    CN113151005A

  • Monascus novel strain and traditional Chinese medicine monascus prepared by fermenting the same

    CN1908156A

  • Monascus purpureus and use thereof

    US20220183310A1

Cited By

  • Efficient fermentation process applied to purple sweet potato fermented rice

    CN121182574A