Rhodotrametes sanguineus with high yield of active spores and culture method thereof
By improving PDA culture medium and optimizing culture conditions, combined with silicone solution treatment, the problems of low yield and difficulty in collecting spores of hemorosomia were solved, and efficient production and collection of active spores were achieved, which expanded its medicinal value.
Patent Information
- Application Number
- CN202510485543.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-07-25
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
In the prior art, the spore yield of hemorosus cysts has low spore yield, poor activity, long spore production cycle, and difficulty in collecting spores, which limits its research and application in medicinal value.
Improved PDA culture medium (added maltose and yeast extract) and optimized culture conditions (temperature 30°C, pH 5), combined with silicone solution treatment and centrifugation technology, improve spore dispersion and collection efficiency.
On the modified PDA medium, hemosoporosis HSJ1029 can produce a large number of active spores within 7 days, shortening the spore production time, and significantly improving the spore collection efficiency and activity through optimization methods.
Smart Images
Figure CN120366074A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a high-yield active spore-producing Trametes sanguineus and a culture method thereof. Background Art
[0002] Tramectin sanguineus is a common medicinal fungus belonging to the genus Tramectin of the family Polyporaceae, Polyporaceae, and the order Polyporaceae of the phylum Basidiomycetes. Tramectin sanguineus is widely distributed in my country, mainly in Jilin, Hebei, Fujian, etc. It is mostly harvested in summer and autumn and dried after harvesting. Its fruiting bodies have high medicinal value and can stop bleeding, detoxify and eliminate dampness, and fight tumors.
[0003] Trametes sanguinea is also a white rot fungus that is sensitive to the ratio of carbon and nitrogen sources. Conventional culture media (such as potato dextrose agar, PDA for short) may not be able to effectively induce spore production. There are many other technical problems in the existing technology for the spore production of Trametes sanguinea plate culture, such as a long spore production cycle (such as "Optimization of laccase production culture medium and enzymatic properties of Trametes sanguinea WTFA5 produced by plasma mutagenesis", which discloses a laccase-producing Trametes sanguinea WTFA5, inoculated the strain on a YPD solid plate, and cultured for 14 days to produce spores), difficulty in spore collection, poor spore activity and uniformity, etc. At present, the existing plate culture conditions for Trametes sanguinea are relatively simple, the screening effect is poor, and most of them focus on the research on fruiting bodies and liquid fermentation broths, which limits the spore activity and yield, resulting in the research on Trametes sanguinea spores being hindered.
[0004] Trametes sanguinea has been reported, mainly collected from the wild. This type of fungus accounts for a very low proportion of fungi in nature, and even fewer species have been developed. A large number of wild fungus resources are in urgent need of development and utilization. Even if this type of fungus is of the same genus and species, the growth characteristics and metabolic activity of different strains are significantly different. For example, "Identification and domestication and cultivation of a wild polypore" (Hebei University of Science and Technology, Gao Zhiyuan, master's thesis) disclosed a wild polypore named XHMK, Trametes sanguinea. The optimal carbon source for this fungus is fructose, and the optimal nitrogen source is yeast extract powder. The mycelium grows fastest at pH 7.0 and 35°C. "Research on Deep Fermentation of Trametes sanguinea in Wuling Mountain" (Lishizhen Traditional Chinese Medicine 2010, Vol. 21, No. 6, School of Life Sciences and Technology, Yangtze Normal University, Chen Jinchao, Wang Xinhui, etc.) disclosed a strain of Trametes sanguinea, whose optimal carbon source is glucose, and the optimal nitrogen source is beef extract. The mycelium yield is highest at pH 6.0 and at 25°C.
[0005] In the prior art, there have been relatively many studies on the production of laccase and polysaccharides by Trametes sanguinea, but there have been no reports on the preparation of Trametes sanguinea spores. Since Trametes sanguinea is a common medicinal fungus and its fruiting body has high medicinal value, the study of Trametes sanguinea spores, as the main reproductive organ of the fungus, is also of great significance. Summary of the Invention
[0006] In view of the deficiencies of the prior art, the present invention provides a Trametes sanguinea with high-yield active spores and a cultivation method thereof.
[0007] A strain of Trametes sanguinea HSJ1029 was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on September 14, 2023, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 40866.
[0008] A cultivation method for high-yield Trametes sanguinea spores includes the following steps:
[0009] Inoculate the above-mentioned Trametes sanguinea HSJ1029 onto a modified PDA medium for cultivation. After spores are produced, collect the spores.
[0010] The modified PDA medium is: adding 0 - 30 g / L of maltose and 0 - 5 g / L of yeast extract to the PDA medium, with a pH of 4 - 8.
[0011] Preferably according to the present invention, the cultivation conditions are 28 - 30 °C.
[0012] More preferably, the cultivation condition is 30 °C.
[0013] Preferably according to the present invention, the modified PDA medium is: adding 20 g / L of maltose and 4 g / L of yeast extract to the PDA medium, with a pH of 5.
[0014] The PDA medium can be prepared according to the conventional formula or use a commercially available PDA medium.
[0015] Preferably according to the present invention, the method for collecting spores includes the following steps:
[0016] Add the medium with spores to a silicone solution for treatment to disperse the spores into the silicone solution; then remove the medium and mycelium to obtain a liquid containing spores, and then centrifuge and freeze-dry the liquid containing spores to obtain the spores.
[0017] More preferably, centrifuge the liquid containing spores at 8000 - 10000 r / min for 8 - 10 min.
[0018] Further preferably, the concentration of the siloxane solution is 0.01%-0.08% by volume;
[0019] More preferably, the culture medium with spores is added to a 0.01% silicone solution for treatment, so that the spores are dispersed in the silicone solution; then the culture medium and mycelium are removed to obtain a liquid containing spores; then 0.08% silicone solution is added to the culture medium and mycelium for treatment, so that the remaining spores are dispersed in the silicone solution; then the culture medium and mycelium are removed again to obtain a liquid containing spores; all the obtained liquid containing spores is centrifuged at 10000r / min for 10min, freeze-dried, and spores are obtained.
[0020] More preferably, the siloxane is poly(dimethylsiloxane) hydride terminated.
[0021] Preferably according to the present invention, Trametes sanguineus HSJ1029 is inoculated into a modified PDA medium in the form of a bacterial cake for culture.
[0022] A composition contains spore powder of Trametes sanguineum HSJ1029 and / or a spore powder extract of Trametes sanguineum HSJ1029.
[0023] Preferably according to the present invention, the spore powder of Trametes sanguineus HSJ1029 is wall-broken spore powder.
[0024] Preferably according to the present invention, the composition has at least one of immunomodulatory, antibacterial or antioxidant effects.
[0025] The beneficial effects of the present invention include at least the following:
[0026] 1. The present invention provides a strain of Trametes sanguineus HSJ1029, which has a strong spore-producing ability and can produce spores after 10 days of culture on a conventional PDA medium. A large number of active spores can be produced on the improved PDA medium provided by the present invention, and the spore-producing time is significantly shortened. A large number of mature spores can be produced after 7 days of culture on the improved PDA medium.
[0027] 2. The present invention prepares the spores of Trametes sanguineum HSJ1029, and the inventors firstly found that the spores of Trametes sanguineum HSJ1029 contain jurubin, which proves that the spores of Trametes sanguineum have important application potential. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 This is a picture of the fruiting bodies of Trametes sanguineus collected in the Taiyi Mountain area.
[0029] Figure 2Diagrams of the normal plate culture, improved plate culture, morphological identification, and molecular biological identification of Trametes sanguinea;
[0030] In the diagrams: a shows the plate culture of Trametes sanguinea HSJ1029. On the left is the diagram of PDA plate culture for 14 days, and on the right is the diagram of improved PDA plate culture for 7 days;
[0031] b shows the microscopic examination after staining with lactophenol cotton blue solution. On the left is the diagram of Trametes sanguinea hyphae, and on the right is the diagram of Trametes sanguinea spores;
[0032] c shows the scanning electron microscope (SEM) diagram of Trametes sanguinea. On the left is the diagram of Trametes sanguinea hyphae, and on the right is the diagram of Trametes sanguinea spores;
[0033] d shows the phylogenetic tree of Trametes sanguinea HSJ1029.
[0034] Figure 3 Diagrams of the effects of different pH values on the diameter and dry weight of Trametes sanguinea mycelia;
[0035] In the diagrams, a is the plate culture diagram, and b is the diagram of the dry weight of liquid-cultured mycelia.
[0036] Figure 4 Diagrams of the effects of different temperatures on the diameter and dry weight of Trametes sanguinea mycelia;
[0037] In the diagrams, a is the plate culture diagram, and b is the diagram of the dry weight of liquid-cultured mycelia.
[0038] Figure 5 Diagrams of the effects of different carbon sources and addition amounts on the diameter and dry weight of Trametes sanguinea mycelia;
[0039] In the diagrams, a shows the effect of glucose. On the left is the plate culture diagram, and on the right is the diagram of the dry weight of liquid-cultured mycelia;
[0040] b shows the effect of soluble starch. On the left is the plate culture diagram, and on the right is the diagram of the dry weight of liquid-cultured mycelia;
[0041] c shows the effect of sucrose. On the left is the plate culture diagram, and on the right is the diagram of the dry weight of liquid-cultured mycelia;
[0042] d shows the effect of maltose. On the left is the plate culture diagram, and on the right is the diagram of the dry weight of liquid-cultured mycelia.
[0043] Figure 6 Diagrams of the effects of different nitrogen sources and addition amounts on the diameter and dry weight of Trametes sanguinea mycelia;
[0044] In the diagrams, a shows the effect of NH4Cl. On the left is the plate culture diagram, and on the right is the diagram of the dry weight of liquid-cultured mycelia;
[0045] b shows the effect of yeast extract. On the left is the plate culture diagram, and on the right is the diagram of the dry weight of liquid-cultured mycelia;
[0046] Figure c shows the influence of (NH4)2SO4. The left side is the plate culture diagram, and the right side is the dry weight diagram of mycelium in liquid culture;
[0047] Figure d shows the influence of peptone. The left side is the plate culture diagram, and the right side is the dry weight diagram of mycelium in liquid culture.
[0048] Figure 7 It is a diagram of Trametes cinnabarina spores after freeze-drying.
[0049] Figure 8 It is the OD of Trametes cinnabarina spores 540 curve and germination microscope diagram;
[0050] In the figure: a is the OD 540 curve graph of Trametes cinnabarina spores; b is the spore germination microscope diagram; c is the plate growth diagram of spore suspension.
[0051] Figure 9 It is the HPLC detection diagram of the extract of Trametes cinnabarina spores;
[0052] In the figure: The arrow indicates Cinnabarin. Specific Embodiments
[0053] The technical solutions of the present invention will be further described below in conjunction with embodiments, but the scope of protection of the present invention is not limited thereto.
[0054] Sources of Biological Materials
[0055] Trametes sanguinea was collected from the Taiyi Mountain area and, as Figure 1 shown, was stored at the Shandong Academy of Agricultural Sciences after artificial isolation and purification. It has been preserved, and the preservation information is as follows:
[0056] A strain of Trametes sanguinea HSJ1029 was deposited at the China General Microbiological Culture Collection Center on September 14, 2023. The address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 40866.
[0057] PDA medium: Purchased from Qingdao Haibo Biotechnology Co., Ltd.;
[0058] PDB medium: Purchased from Qingdao Haibo Biotechnology Co., Ltd.;
[0059] Glucose: Purchased from Sinopharm Chemical Reagent Co., Ltd.;
[0060] Soluble starch: Purchased from Shanghai Macklin Biochemical Co., Ltd.;
[0061] Sucrose: purchased from Shanghai Macklin Biochemical Co., Ltd.;
[0062] Maltose: purchased from Shanghai Macklin Biochemical Co., Ltd.;
[0063] Peptone: purchased from Beijing Aoboxing Biotechnology Co., Ltd.;
[0064] Yeast extract: purchased from Shanghai Macklin Biochemical Co., Ltd.;
[0065] NH4Cl: purchased from Sinopharm Chemical Reagent Co., Ltd.;
[0066] (NH4)2SO4: purchased from Sinopharm Chemical Reagent Co., Ltd.
[0067] Example 1
[0068] Molecular identification of Trametes sanguinea HSJ1029 based on the ITS region
[0069] The genomic DNA of the strain was prepared using a Biospin fungal genomic DNA extraction kit, amplified with universal primers (18SF and 18SR) for fungal 18S ITS, and a Mix containing MgCl2 TM Taq PCR Mix (purchased from Sigma) was used to improve the amplification efficiency, followed by agarose gel electrophoresis. Then, the PCR amplification products were purified using an AxyPrep DNA Gel Extraction Kit (Axygen, USA), and sequenced after electrophoretic verification. The obtained sequences were compared and retrieved with the 18S rRNA gene sequences of standard strains archived in the National Center for Biotechnology Information (NCBI) of the United States, and a phylogenetic tree was constructed using MEGA11.
[0070] The above-mentioned universal primers for strain PCR amplification are:
[0071] 18SF: 5’AACTTAAAGGAATTGACGGAAG 3’SEQ ID NO.2;
[0072] 18SR: 5’TCCGCAGGTTCACCTACGGA3’SEQ ID NO.3.
[0073] The reaction system for the above-mentioned amplification of the strain's 18S rRNA gene is as follows, with a total volume of 50 μL:
[0074] The gene amplification reagents Prime STAR HS DNA polymerase, dNTP mixture, and buffer were purchased from TaKaRa Biotechnology Co., Ltd., Dalian.
[0075] The procedure for amplifying the 18S rRNA gene of the strain is as follows:
[0076] Pre-denaturation at 95°C for 15 min; denaturation at 95°C for 1 min, annealing at 56°C, and extension at 72°C for 10 min.
[0077] The method for constructing the 18S rRNA phylogenetic tree described above: Use MEGA11 software to perform multiple sequence alignments on the measured 18S rRNA gene sequences and the similar sequences of standard strains obtained from the NCBI gene database. Construct a phylogenetic tree using the UPGMA method and perform 1000 Bootstrap tests to obtain a statistical tree.
[0078] The results are as Figure 2 shown in d below. The 18S rRNA of the strain of the present invention is most similar to the sequence of Trametes sanguinea SDBR-CMUNK0189 (MW267631.1) registered in NCBI, with a similarity of 69%. Trametes sanguinea HSJ1029 clusters with multiple standard strains of Trametes sanguinea and is located inside this branch. Generally, this strain is considered to be Trametes sanguinea. The ITS sequence of Trametes sanguinea of the present invention is shown in SEQ ID NO.1. The identified Trametes sanguinea (Trametes sanguinea HSJ1029) of the present invention has a high similarity with the registered strains ( Figure 2 in d).
[0079] Example 2
[0080] Screening of the culture conditions of Trametes sanguinea:
[0081] 1. Screening of the optimal pH
[0082] (1) Prepare 5 conical flasks. Weigh 9.2 g of PDA medium in each conical flask, add 200 mL of pure water, and stir with a glass rod until completely dissolved. At the same time, prepare multiple bottles of 150 mL of PDB, and adjust the pH of PDA and PDB to 4, 5, 6, 7, and 8 using 1 M NaOH solution and 1 M HCl solution, then autoclave at 121°C for 20 min. When the PDA medium cools to about 60°C, pour it into plates and let it dry for later use.
[0083] (2) Take out the Trametes sanguinea plate with good growth state from the 4°C refrigerator (the plate that has grown on PDA medium for 14 days), and inoculate it onto the plates prepared in step (1) by punching out fungal cakes (with a diameter of 5 mm). Inoculate one fungal cake on each plate, seal the plates with sealing film, and then invert and culture them in a 28°C incubator in the dark. At the same time, inoculate 2 fungal cakes into each PDB medium by punching out fungal cakes, cover with sealing film, and culture them on a shaker at 28°C and 120 r / min.
[0084] (3) When the growth of Trametes sanguinea on the plate reached the 7th day, measure the mycelial growth diameter and take photos for record; Take out the PDB medium of Trametes sanguinea on the 7th day of growth, centrifuge at 11000 r / min for 20 min, pour out the fermentation broth, lyophilize the mycelium, and weigh the dry weight. Similarly, lyophilize and weigh the PDB medium of Trametes sanguinea on the 14th day of growth. Determine the pH value with the largest growth diameter and the largest dry weight of the mycelium as the optimal pH value. The results of the optimal pH are as Figure 3 shown. It can be seen from the mycelial diameter of the 7-day growth shown on the plate that the mycelial diameter is large at pH 5 (see Figure 3 a) in Figure 3 ; It can also be seen from the dry weight of the mycelium in liquid fermentation that the dry weight value of the mycelium is the largest at pH 5 (see
[0085] 2. Screening of the optimal temperature
[0086] (1) Weigh 9.2 g of PDA medium, add 200 mL of pure water, and stir with a glass rod until completely dissolved. At the same time, prepare multiple bottles of 150 ml of PDB and autoclave at 121 °C for 20 min. When the PDA medium cools to about 60 °C, pour the plate and let it dry for later use.
[0087] (2) Take out the Trametes sanguinea plate with good growth state from the 4 °C refrigerator (the plate that has grown on the PDA medium for 14 days), and inoculate it onto the plate prepared in step (1) by punching a mycelial cake. Inoculate one mycelial cake on each plate, seal the plate with a sealing film, and then invert it and place it in an incubator with temperature gradients of 15 °C, 20 °C, 28 °C, 30 °C, and 37 °C for dark culture. At the same time, inoculate 2 mycelial cakes into each PDB medium by punching a mycelial cake, cover it with a sealing film, and place it in a shaker with temperature gradients of 15 °C, 20 °C, 28 °C, 30 °C, and 37 °C at 120 r / min for culture.
[0088] (3) When the growth of Trametes sanguinea on the plate reached the 7th day, measure the mycelial growth diameter and take photos for record; Take out the PDB medium of Trametes sanguinea on the 7th day of growth, centrifuge at 11000 r / min for 20 min, pour out the fermentation broth, lyophilize the mycelium, and weigh the dry weight. Similarly, lyophilize and weigh the PDB medium of Trametes sanguinea on the 14th day of growth. Determine the temperature with the largest growth diameter and the largest dry weight of the mycelium as the optimal temperature. The results of the optimal temperature are as Figure 4 shown. It can be seen from the mycelial diameter of the 7-day growth shown on the plate that the mycelial diameter is large at 30 °C (see Figure 4 a) inFigure 4 In item b) of . Therefore, it can be concluded that the optimal growth temperature of Trametes sanguinea HSJ1029 is 30 °C.
[0089] 3. Screening of the optimal carbon source and its addition amount
[0090] (1) Weigh 9.2 g of PDA medium and add 200 mL of pure water. Stir with a glass rod until completely dissolved. Add 4 carbon sources to it respectively: Glucose, Maltose, Sucrose, Soluble starch. According to the amount of pure water, set the addition amounts of the 4 carbon sources to be: 0 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L. At the same time, prepare multiple bottles of 150 ml of PDB, with the carbon source types and addition amounts being the same as those added to PDA. Autoclave at 115 °C for 15 min. When the modified PDA medium cools to about 60 °C, pour plates and let them dry for later use.
[0091] (2) Take out the Trametes sanguinea plate with good growth state from the 4 °C refrigerator (the plate that has grown on PDA medium for 14 days), and inoculate it onto the plates prepared in step (1) in the form of punching out bacterial cakes. Inoculate one bacterial cake on each plate, seal the plates with sealing film, and then invert them on the pre-prepared modified PDA medium and culture them in the dark in an incubator at 28 °C. At the same time, in the form of punching out bacterial cakes, inoculate 2 bacterial cakes into each modified PDB medium, cover with sealing film, and place them in a shaker at 28 °C and 120 r / min for culture.
[0092] (3) On the 7th day of the growth of the Trametes sanguinea plate, measure the mycelial growth diameter and take pictures for record; take out the Trametes sanguinea PDB medium on the 7th day of growth, centrifuge at 11000 r / min for 20 min, pour out the fermentation broth, lyophilize the mycelium, and weigh the dry weight. Similarly, lyophilize and weigh the Trametes sanguinea PDB medium on the 14th day of growth. Determine the carbon source type and addition amount with the largest growth diameter and the largest mycelial dry weight as the optimal carbon source. The optimal carbon source and its addition amount are as Figure 5 shown. It can be seen from the mycelial diameter of the 7-day growth shown on the plate that when the carbon source is maltose and the addition amount is 20 g / L, the mycelial diameter is large (see Figure 5 in d); it can also be seen from the dry weight of the mycelium in liquid fermentation that when the carbon source is maltose and the addition amount is 20 g / L, the dry weight value of the mycelium is the largest (see Figure 5 in d). Therefore, it can be concluded that the optimal carbon source of Trametes sanguinea HSJ1029 is maltose, and the addition amount is 20 g / L.
[0093] 4. Screening of the optimal nitrogen source and its addition amount
[0094] (1) Weigh 9.2 g of PDA medium, add 200 mL of pure water, and stir with a glass rod until completely dissolved. Add 4 nitrogen sources to it respectively: Peptone, Yeast extract, NH4Cl, (NH4)2SO4. Set the addition amounts of the 4 nitrogen sources to 0 g / L, 1 g / L, 2 g / L, 3 g / L, 4 g / L, 5 g / L respectively according to the amount of pure water. At the same time, prepare multiple bottles of 150 ml of PDB, with the nitrogen source types and addition amounts being the same as those added to PDA. Autoclave at 115 °C for 15 min. When the modified PDA medium cools to about 60 °C, pour plates and let them dry for later use.
[0095] (2) Take out the Trametes sanguinea plate with good growth state from the 4 °C refrigerator (the plate grown on PDA medium for 14 days), and inoculate it onto the plates prepared in step (1) in the form of punching out bacterial cakes. Inoculate one bacterial cake on each plate, seal the plates with sealing film, and then invert them on the pre-prepared modified PDA medium and culture them in the dark in an incubator at 28 °C. At the same time, in the form of punching out bacterial cakes, inoculate 2 bacterial cakes into each modified PDB medium, cover with sealing film, and place them in a shaker at 28 °C and 120 r / min for culture.
[0096] (3) On the 7th day of the growth of the Trametes sanguinea plate, measure the hyphal growth diameter and take pictures for record; take out the Trametes sanguinea PDB medium on the 7th day of growth, centrifuge at 11000 r / min for 20 min, pour out the fermentation broth, freeze-dry the mycelium, and weigh the dry weight. Similarly, freeze-dry and weigh the Trametes sanguinea PDB medium on the 14th day of growth. Determine the nitrogen source type and addition amount with the largest hyphal growth diameter and the largest mycelial dry weight as the optimal nitrogen source. The optimal nitrogen source and addition amount are as Figure 6 shown. It can be seen from the hyphal diameter of the 7-day growth shown on the plate that when the nitrogen source is Yeast extract and the addition amount is 4 g / L, the hyphal diameter is large (see Figure 6 b in); it can also be seen from the dry weight of the mycelium in liquid fermentation that when the nitrogen source is Yeast extract and the addition amount is 4 g / L, the dry weight value of the mycelium is the largest (see Figure 6 b in). Therefore, it can be concluded that the optimal nitrogen source for Trametes sanguinea HSJ1029 is Yeast extract, and the addition amount is 4 g / L.
[0097] The inventor found that: Trametes sanguinea HSJ1029 can grow rapidly and produce a large number of active spores on the modified PDA plate at a culture temperature of 30 °C. Trametes sanguinea HSJ1029 can produce a large number of mature spores on the modified PDA plate on the 7th day of culture. The results are as Figure 2 shown in c.
[0098] The improved PDA medium is as follows: add 20 g / L of maltose and 4 g / L of yeast extract to the PDA medium, and adjust the pH value to 5.
[0099] Trametes sanguinea HSJ1029 can produce spores when cultured on a PDA plate at a culture temperature of 30°C for 10 days.
[0100] The spores produced by Trametes sanguinea in the present invention are arthrospores, as Figure 2 shown in b and c in, which are spores produced by the hyphae of Trametes sanguinea relying on septum fragmentation.
[0101] Figure 2 a in is the culture picture of Trametes sanguinea HSJ1029 on PDA plates and improved PDA plates respectively.
[0102] Example 3
[0103] Take the optimal pH, temperature, carbon and nitrogen sources and their addition amounts obtained in Example 2 as the growth conditions for subsequent spore production of Trametes sanguinea HSJ1029. The optimal growth conditions of Trametes sanguinea HSJ1029 in Example 2 are pH 5 and temperature 30°C. Add maltose as the carbon source to the PDA medium, with an addition amount of 20 g / L, add yeast extract as the nitrogen source, with an addition amount of 4 g / L, and adjust the pH value to 5, which is the improved PDA medium.
[0104] The culture and collection of Trametes sanguinea spores are as follows:
[0105] (1) Weigh 9.2 g of PDA medium, add 200 mL of pure water, stir with a glass rod until completely dissolved, add 4 g of maltose and 0.8 g of yeast extract thereto, adjust the pH of the PDA to 5 with 1 M NaOH and 1 M HCl, and then autoclave at 115°C for 15 min. When the improved PDA medium cools to about 60°C, pour plates and let them dry for later use.
[0106] (2) Take out the Trametes sanguinea plate with good growth state from the 4°C refrigerator (the plate grown on the PDA medium for 14 days), inoculate it onto the plate prepared in step (1) in the form of punching a bacterial cake, inoculate one bacterial cake on each plate, seal the plate with a sealing film, and then invert it and culture it in an incubator at 30°C on the previously prepared improved PDA medium. After culturing for 7 days, stain it with lactophenol cotton blue staining solution in a laminar flow hood and examine it under a microscope to find a large number of spores.
[0107] (3) Prepare poly(dimethylsiloxane) hydride-terminated solutions with volume fractions of 0.01%, 0.08%, and 0.16% (purchased from aladdin). First, use the 0.01% siloxane solution to collect the culture of the improved PDA medium in step (2). In the form of punching out bacterial cakes, place three bacterial cakes in a 50 mL centrifuge tube, add 30 mL of the 0.01% siloxane solution, and vortex for 30 s to fully detach the spores from the agar plate and disperse them into the siloxane solution. Filter the liquid through eight layers of lens paper to fully filter out the hyphae, and transfer the filtrate containing spores to a clean centrifuge tube.
[0108] (4) Then, add the 0.08% siloxane solution to the 50 mL centrifuge tube in step (3), and vortex for 30 s to fully disperse the spores that adhered to the tube wall and the bacterial cakes and were not dispersed into the 0.01% siloxane solution. Filter the liquid through eight layers of lens paper, and transfer the filtrate containing spores to a clean centrifuge tube.
[0109] (5) Finally, use the 0.016% siloxane solution to verify whether the spores are completely collected. Add it to the 50 mL centrifuge tube in step (4), add 30 mL of the 0.01% siloxane solution, vortex for 30 s, collect the liquid, and observe the spores under a microscope using a hemocytometer. If more spores are detected by microscopy, continue to increase the concentration of the siloxane solution and the vortex time to fully collect the spores in the tube; if no more spores are detected by microscopy, it proves that the collection of Trametes sanguinea spores is completed.
[0110] The inventor verified with the 0.016% siloxane solution and found that very few spores were detected by microscopy, proving that the collection of Trametes sanguinea spores was completed.
[0111] (6) Centrifuge the filtrates containing spores collected in steps (3) and (4) at 10,000 r / min for 10 min, freeze-dry, and store in a 4°C refrigerator. The freeze-dried spores are as Figure 7 shown. The Trametes sanguinea spores are colorless or light yellow.
[0112] The preparation method of the above 0.01% siloxane solution is as follows:
[0113] Add 3 μL of siloxane to 30 mL of ultrapure water to a final concentration of 0.01% (v / v);
[0114] The preparation method of the above 0.08% siloxane solution is as follows:
[0115] Add 24 μL of siloxane to 30 mL of ultrapure water to a final concentration of 0.08% (v / v);
[0116] The preparation method of the above 0.16% siloxane solution is as follows:
[0117] 48 μL of siloxane was added to 30 mL of ultrapure water to a final concentration of 0.16% (v / v).
[0118] Example 4
[0119] Determination of spore viability and germination
[0120] ① 0.1 mg of the freeze-dried spores in Example 3 was weighed and suspended in 1 mL of sterile distilled water to prepare a spore suspension. Subsequently, the spore suspension was inoculated into 10 mL of PDB, and the OD was measured at four time intervals: 0 h, 12 h, 24 h, and 48 h. 540 .
[0121] ② 100 μL of the spore suspension at 48 h in step ① was evenly spread on PDA, and the plate was placed in an incubator for dark incubation to observe spore growth.
[0122] ③ The Trametes cinnabarina spore powder (the freeze-dried spore powder in Example 3) in step ① was used to prepare a spore suspension of 1×10 7 CFU / mL. The suspension was cultured on a shaker at 28 °C and 180 r / min. At 0 h, 12 h, and 24 h, 10 μL of the suspension was dropped onto a glass slide, stained with lactophenol cotton blue, and the spore germination was observed under a 100x oil immersion lens. The results are as Figure 8 shown, Figure 8 where a in 540 shows that the OD value increases with time. The spore suspension at the corresponding time was examined under a microscope (see Figure 8 b in Figure 8 ), and it was observed that the spores elongated, indicating that the Trametes cinnabarina spores were in a germinated state. The spore suspension at 48 h was taken out for plating, and the spore suspension grew successfully (see
[0123] Example 5
[0124] Analysis of hydrophobicity and heat resistance of Trametes cinnabarina spores
[0125] The hydrophobicity of Trametes cinnabarina spores is closely related to their dissemination. The stronger the hydrophobicity, the easier it is for them to spread; the heat resistance is related to the stress resistance of the spores.
[0126] The hydrophobicity of Trametes cinnabarina spores was determined by the water-solvent partition method. The specific operation steps are as follows:
[0127] ① The Trametes cinnabarina agar cake was transferred to an EP tube containing 1 mL of 0.1 M KOH and shaken for 30 s. After taking out the plate, the Trametes cinnabarina spores were in the KOH solution at this time and filtered through a 150 μm × 150 μm sterile filter cloth.
[0128] ② Take 10 μL of the filtrate from step ① and drop it onto a hemocytometer to count the number of spores at this time, which serves as the number of spores before the hydrophobicity experiment.
[0129] ③ Adjust the concentration of the spore suspension to 1×10 7 CFU / mL using KOH solution. Add 50 μL of paraffin oil to every 500 μL of the suspension, shake for 1 min, and let it stand at room temperature for 5 min.
[0130] ④ Collect the spores in the aqueous phase from step ③ and count them using a hemocytometer. According to the hydrophobicity formula:
[0131] (1 - C / C0)×100%
[0132] where C0 is the number of spores in the aqueous phase before the hydrophobic interaction, and C is the number of spores remaining in the aqueous phase after the hydrophobic interaction.
[0133] Perform a heat resistance experiment on the freeze-dried spores in Example 3. The specific steps are as follows:
[0134] ⑤ Adjust the concentration of the silicone-mediated freeze-dried spore powder in Example 3 to a 1×10 7 CFU / mL spore suspension. Transfer one group of it to an EP tube and incubate it in a water bath at 45°C for 5 min. Another group is carried out simultaneously but without heat shock treatment.
[0135] ⑥ Inoculate all the two groups of spore suspensions from step ⑤ into PDB for germination experiments. Incubate them in a shaker at 28°C for 24 h. Divide the spores in the hemocytometer under a microscope into groups of 100 spores each, and randomly select one group. Use a 100× oil immersion lens to count the number of germinated spores and non-germinated spores in every 100 spores to determine the spore germination rate; the results of heat resistance and hydrophobicity are shown in Table 1. For the hydrophobicity experiment on the spores, before adding paraffin oil, the number of spores in 10 μL of the aqueous phase was 17, and after adding paraffin oil, the number of spores in 10 μL of the aqueous phase decreased to 9. Calculated according to the formula, the hydrophobicity of the spores was 47.06%, and the hydrophobicity was average; for the heat resistance experiment on the spores, the two groups of experiments were control experiments. The experiment without heat shock treatment was the data before the experiment, the number of germinated spores was 64, and the spore germination rate was 64%. The experiment with heat shock treatment was the data after the experiment, the number of germinated spores was 36, and the spore germination rate was 36%. Then the relative heat resistance of the spores was 43.75%. Heat shock significantly inhibited the germination of spores, indicating that the spores are sensitive to high temperature and have weak heat resistance.
[0136] Table 1
[0137]
[0138] Example 6
[0139] Extraction and High Performance Liquid Chromatography Analysis of Bissoulin in the Spores of Trametes cinnabarina
[0140] The specific operation steps are as follows:
[0141] Preparation of hot water extract sample ①: Weigh 50 mg of freeze-dried Trametes cinnabarina spores (the freeze-dried spore powder in Example 3), add 1 mL of pure water, sonicate for 30 min, and extract at 80 °C in a water bath for 12 h;
[0142] Preparation of hot water then ethanol extract sample ②: Weigh 50 mg of freeze-dried Trametes cinnabarina spores, add 0.5 mL of pure water, sonicate for 30 min, extract at 80 °C in a water bath for 6 h, then add 0.5 mL of absolute ethanol and extract at room temperature for 6 h;
[0143] Preparation of ethanol extract sample ③: Weigh 50 mg of freeze-dried Trametes cinnabarina spores, add 1 mL of absolute ethanol, sonicate for 30 min, and extract at room temperature for 12 h;
[0144] Centrifuge the above three samples at 11000 r / min, take the supernatant and filter it through a membrane. Sample ① is filtered through a 0.45 μm aqueous membrane, and samples ② and ③ are filtered through a 0.45 μm organic membrane, and then detected by high performance liquid chromatography. The detection results are as Figure 9 shown. The control is bissoulin, and bissoulin is detected by all three extraction methods.
[0145] The inventors first discovered that the spores of Trametes cinnabarina HSJ1029 contain bissoulin, which proves that the spores of Trametes cinnabarina have important application potential.
[0146] The present invention provides a strain of Trametes cinnabarina HSJ1029, which has strong sporulation ability. It can produce spores after being cultured on a conventional PDA medium for 10 days. It can produce a large number of active spores on the improved PDA medium provided by the present invention, and the sporulation time is significantly shortened. It can produce a large number of mature spores after being cultured on the improved PDA medium for 7 days. The inventors first discovered that the spores of Trametes cinnabarina HSJ1029 contain bissoulin, which proves that the spores of Trametes cinnabarina have important application potential.
Claims
1. A strain of Trametes sanguinea HSJ1029 was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on September 14, 2023. The address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 40866.
2. A cultivation method for high-yielding Trametes sanguinea spores, characterized in that, It includes the following steps: Inoculate the Trametes sanguinea HSJ1029 described in claim 1 onto a modified PDA medium for cultivation. After cultivating until spores are produced, collect the spores. The modified PDA medium is: adding 0 - 30 g / L of maltose and 0 - 5 g / L of yeast extract to the PDA medium, and the pH is 4 - 8.
3. The cultivation method according to claim 2, characterized in that, The cultivation condition is 28 - 30 °C; Preferably, the cultivation condition is 30 °C.
4. The culturing method according to claim 2, wherein, The modified PDA medium is adding 20 g / L of maltose and 4 g / L of yeast extract to the PDA medium, and the pH is 5.
5. The culturing method according to claim 2, characterized in that, The method for collecting spores includes the following steps: Add the medium with spores to a siloxane solution for treatment to disperse the spores into the siloxane solution; then remove the medium and mycelium to obtain a liquid containing spores, and then centrifuge and freeze-dry the liquid containing spores to obtain spores. Preferably, centrifuge the liquid containing spores at 8000 - 10000 r / min for 8 - 10 min.
6. The cultivation method according to claim 5, characterized in that, The concentration of the siloxane solution is 0.01% - 0.08% by volume percentage.
7. The culturing method according to claim 5, wherein Add the medium with spores to a 0.01% siloxane solution for treatment to disperse the spores into the siloxane solution; Then remove the medium and mycelium to obtain a liquid containing spores; add a 0.08% siloxane solution to the medium and mycelium for treatment to disperse the remaining spores into the siloxane solution; Then remove the medium and mycelium again to obtain a liquid containing spores; centrifuge all the obtained liquids containing spores at 10000 r / min for 10 min and then freeze-dry to obtain spores.
8. The cultivation method according to claim 5, characterized in that, The siloxane is end-capped with poly(dimethylsiloxane) hydride.
9. The culturing method according to claim 2, wherein Inoculate the Trametes sanguinea HSJ1029 in the form of a mycelial cake onto a modified PDA medium for cultivation.
10. A composition, characterized in that, Spores powder of Trametes sanguinea HSJ1029 described in claim 1 and / or extract of spores powder of Trametes sanguinea HSJ1029; Preferably, the spores powder of Trametes sanguinea HSJ1029 is broken spores powder; Preferably, the composition has at least one of the functions of immunomodulation, antibacterial or antioxidant.