Trichoderma virens and application thereof
Through the reparametric effect of Trichoderma chlorophyllium MJ18 strain and the combination with thiaminine, the prevention and control problems of peanut white silk disease and pests were solved, and the combination of biodefense and chemical control was achieved, and the emergence rate of peanuts and the growth of seedlings was improved.
Patent Information
- Application Number
- CN202510840267.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-23
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2045-06-23
AI Technical Summary
The prior art lacks effective bio-control strains to prevent and control peanut white silk bacteria, and chemical agent prevention and control lead to environmental pollution and drug resistance problems, making it difficult to prevent and control peanut white silk bacteria and pests at the same time.
A Trichoderma virens strain MJ18 is provided, which has a strong reparasitic effect and can effectively prevent and treat peanut lemoniae and sclerotid bacteria, and is compounded with neonicotinoid insecticide thiamethyroidamine for peanut seed treatment to improve seedling emergence rate and promote seedling growth.
MJ18 significantly inhibits peanut lemoniae and sclerotid bacteria, increases peanut seedling emergence rate, promotes seedling growth, and realizes joint prevention and control of peanut lemoniae and pests, and reduces environmental pollution.
Smart Images

Figure CN120366084A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological control of plant pathogenic fungi. More specifically, it relates to a Trichoderma viride ( Trichoderma virens ) and its applications. Background Art
[0002] Plant fungal diseases are a common type of plant disease caused by plant pathogenic fungi. Their occurrence will seriously affect the yield and quality of agricultural products and restrict the development of related agricultural industries. Peanut Linn.) is an important oil crop, and peanut Sclerotium rolfsii ( Sclerotium rolfsii Sacc) can harm the rhizomes, fruit stalks and pods of peanut plants, causing the rhizomes to brown and the pods to rot, seriously affecting the yield and quality of peanuts and causing huge economic losses.
[0003] At present, the prevention and control of plant diseases is still mainly based on chemical agents. However, improper use of chemical agents can easily lead to drug resistance in plant pathogens, increasing the difficulty of prevention and control. Moreover, chemical agents can pollute and damage the environment, endanger the health of organisms, and destroy the food chain. Therefore, it is urgent to find environmentally friendly and pollution-free prevention and control technologies. Biological control based on biocontrol bacteria is one of the effective prevention and control methods for plant fungal diseases, which has the advantages of being green and safe. Trichoderma spp.) are a class of saprophytic fungi widely distributed in nature, among which the most common Trichoderma is Trichoderma harzianum ( T. harzianum )、Trichoderma viride( T.viride ) and Trichoderma longibrachiatum ( T. Longibrachiatum ) etc. Since Trichoderma was found to have antagonistic effects on plant pathogenic fungi, many Trichoderma biocontrol fungi have been reported. However, different Trichoderma can control different plant fungal diseases. Even different Trichoderma strains of the same species may have significant differences in their efficacy against the same plant fungal diseases.
[0004] For example, the green Trichoderma isolated from the cultivation material of Pleurotus ostreatus by Gao Wei et al. Trichoderma green )TH4 against Fusarium oxysporum of cucumber ( Fusarium oxysporum ) and Rhizoctonia solani ( Rhizoctonia solani ) These two pathogens have strong inhibitory effects (Gao Wei, Li Baoju, Sun Junde, et al. Antagonistic effect of Trichoderma viride on Rhizoctonia solani and Fusarium oxysporum of cucumber [J]. Chinese Vegetables, 2008(6):4.), while Trichoderma viride TV41 screened by An Xia has inhibitory effects on the growth of Phytophthora capsici, Fusarium wilt and Colletotrichum solani, but has no inhibitory effect on the growth of Rhizoctonia solani of cucumber (An Xia. Study on the control effect of Trichoderma viride TV41 on pepper blight [D]. Jiangsu: Nanjing Agricultural University, 2014.). Therefore, only by continuously exploring strains with good biocontrol effects and continuously enriching the biocontrol bacteria library can it be more conducive to the biological control of plant fungal diseases.
[0005] Although the pathogens that cause white rot in different plants all belong to the same family, Sclerotium rolfsii Sacc), but the biological characteristics of the white rot fungi isolated from different plants are not the same. The biological characteristics of the white rot fungi isolated from the same plants in different regions are also significantly different, including the growth rate of the strains, the width of the hyphae, the number of sclerotia produced and the size of the sclerotia (Xiao Xiang, Chen Xiaolan, Deng Mingguang, et al. A preliminary report on the distribution and biological characteristics of peanut white rot fungi in Guangdong Province [J]. Guangdong Agricultural Sciences, 2012, 39(17):4.). It is also reported that the white rot fungi collected from different regions have obvious differences in drug resistance, indicating that different pesticides should be used to control the white rot fungi in different cultivation areas in production (Xiao Zhongjiu, Li Xiaoxia, Tian Maojie. Study on the difference in toxicity of fungicides against white rot fungi in different planting areas [J]. Jiangsu Agricultural Sciences, 2012, 40(4):3.). Although there are reports of green Trichoderma strains that can effectively control jasmine white rot, they are not necessarily effective in controlling peanut white rot. Because jasmine and peanut are so different, the pathogens that infect and cause white rot in both are also very different. However, there is no effective biological control strain for white rot in peanut.
[0006] In addition, peanut pests are also key diseases that affect its yield and quality. If we can provide biocontrol bacteria that can be used in conjunction with chemical agents used to control peanut pests, it will be helpful to ensure peanut yield and quality and promote the development of the peanut planting industry. Summary of the invention
[0007] In view of the above-mentioned deficiencies in the prior art, the present invention provides a strain of Trichoderma viride ( Trichoderma virens ) strain, which can be used to effectively control peanut white rot fungus, and the green Trichoderma strain can be used in combination with neonicotinoid insecticides to achieve joint control of peanut white rot and peanut pests.
[0008] The first object of the present invention is to provide a strain of Trichoderma viride.
[0009] The second object of the present invention is to provide a preparation containing the Trichoderma virens.
[0010] The third object of the present invention is to provide the use of the Trichoderma viride or the preparation in inhibiting plant pathogenic fungi.
[0011] The fourth object of the present invention is to provide use of the Trichoderma viride or the preparation in preparing a product for inhibiting plant pathogenic fungi.
[0012] The fifth object of the present invention is to provide the use of the Trichoderma viride or the preparation in preventing and controlling plant fungal diseases.
[0013] The sixth object of the present invention is to provide the application of the Trichoderma viride or the preparation in the preparation of a product for controlling plant fungal diseases.
[0014] The seventh object of the present invention is to provide the application of the Trichoderma viride or the preparation in improving the emergence rate of peanuts and / or promoting the growth of peanuts at the seedling stage.
[0015] The eighth object of the present invention is to provide the application of the Trichoderma viride or the preparation in the preparation of a product for improving the emergence rate of peanuts and / or promoting the growth of peanuts at the seedling stage.
[0016] The above objects of the present invention are achieved by the following technical solutions: In the present invention, a strain of Trichoderma viride with hyperparasitic effect ( Trichoderma virens ) is isolated and purified, named MJ18 (hereinafter referred to as Trichoderma viride MJ18 or strain MJ18). The Trichoderma viride MJ18 has a strong hyperparasitic effect on Sclerotium rolfsii and Sclerotinia sclerotiorum of peanuts, and can effectively control southern blight caused by Sclerotium rolfsii and sclerotinia rot caused by Sclerotinia sclerotiorum. In addition, the Trichoderma viride MJ18 can also inhibit the growth of plant pathogenic fungi such as Pythium ultimum, Fusarium graminearum, Fusarium pseudograminearum and Rhizoctonia solani, and can be used for the control of related plant diseases caused by the above pathogenic fungi. In addition, in the present invention, Trichoderma viride MJ18 is compounded with the neonicotinoid insecticide clothianidin and used to treat peanut seeds, and it is found that it can effectively improve the emergence rate of peanuts and promote the growth of peanuts at the seedling stage. Therefore, the present invention claims to protect the Trichoderma viride MJ18 and its related products and applications.
[0017] The present invention provides a strain of Trichoderma viride, named MJ18, which was deposited with the China Center for Type Culture Collection on January 15, 2025, and the deposit number is CCTCC NO: M 2025149.
[0018] The present invention also sequenced and analyzed the specific sequences contained in the Trichoderma viride MJ18, and found 4 specific genes, named specific genes 1-4, and their nucleotide sequences are shown in SEQ ID NO.4-7 in sequence.
[0019] Except for the Trichoderma viride MJ18 deposited in the present invention, other Trichoderma viride strains having one or more of the specific genes 1-4 of the present invention will also have the same effects as the Trichoderma viride MJ18 of the present invention. Therefore, Trichoderma viride strains containing one or more of the specific genes 1-4 should also be within the protection scope of the present invention.
[0020] The present invention also provides a preparation, which contains the Trichoderma viride MJ18 and / or its culture of the present invention.
[0021] Optionally, the preparation further contains a neonicotinoid insecticide.
[0022] Optionally, the neonicotinoid insecticide includes imidacloprid, acetamiprid, thiamethoxam, clothianidin, thiacloprid, dinotefuran, nitenpyram, chlorothianidin, epoxyfenozide, and / or flupyradifurone.
[0023] Specifically, the neonicotinoid insecticide is thiamethoxam, clothianidin, or thiacloprid.
[0024] In a specific embodiment of the present invention, the neonicotinoid insecticide is clothianidin.
[0025] In view of the inhibitory effect of Trichoderma viride MJ18 on plant pathogenic fungi such as Sclerotium rolfsii. Therefore, the present invention claims the application of the Trichoderma viride MJ18 or the preparation in inhibiting plant pathogenic fungi.
[0026] The present invention also claims the application of the Trichoderma viride MJ18 or the preparation in preparing a product for inhibiting plant pathogenic fungi.
[0027] Specifically, the plant pathogenic fungi are Sclerotium rolfsii ( Sclerotium rolfsii Sacc), Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ), Pythium ultimum ( The last Pythium ), Fusarium graminearum ( Fusarium grasses ), Fusarium pseudograminearum ( Fusarium pseudogramineum ), and / or Rhizoctonia solani ( Rhizoctonia solani ).
[0028] Among them, the Trichoderma viride MJ18 effectively inhibits Sclerotium rolfsii through hyperparasitism, preventing southern blight of peanut caused by Sclerotium rolfsii; the Trichoderma viride MJ18 can also effectively inhibit Sclerotinia sclerotiorum through hyperparasitism, preventing sclerotinia rot caused by Sclerotinia sclerotiorum.
[0029] Trichoderma viride MJ18 can inhibit pathogenic fungi such as Sclerotium rolfsii, and it can be used to control related plant diseases. Therefore, the present invention also claims the application of the Trichoderma viride MJ18 or the preparation in controlling plant fungal diseases.
[0030] The present invention also claims the application of the Trichoderma viride MJ18 or the preparation in preparing a product for controlling plant fungal diseases.
[0031] Specifically, the plant fungal diseases are caused by Sclerotium rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Fusarium pseudograminearum, and / or Rhizoctonia solani.
[0032] The present invention combines Trichoderma viride MJ18 with the neonicotinoid insecticide clothianidin and treats peanut seeds, and it is found that it can effectively improve the emergence rate of peanuts and promote the growth of peanuts at the seedling stage. Therefore, the present invention also claims the application of the said Trichoderma viride MJ18 or the said preparation in improving the emergence rate of peanuts and / or promoting the growth of peanuts at the seedling stage.
[0033] The application of the said Trichoderma viride MJ18 or the said preparation in the preparation of a product for improving the emergence rate of peanuts and / or promoting the growth of peanuts at the seedling stage should also be within the protection scope of the present invention.
[0034] Specifically, the application of the said Trichoderma viride MJ18 and the neonicotinoid insecticide in pest control should also be within the protection scope of the present invention.
[0035] The present invention has the following beneficial effects: Through isolation and purification, the present invention obtained a strain of Trichoderma viride with a strong hyperparasitic effect on Sclerotium rolfsii and Sclerotinia sclerotiorum of peanuts, named MJ18. The said Trichoderma viride MJ18 was deposited at the China Center for Type Culture Collection (CCTCC) on January 15, 2025, with the deposit number CCTCC NO: M 2025149. In addition to being able to inhibit Sclerotium rolfsii and Sclerotinia sclerotiorum of peanuts, the said Trichoderma viride MJ18 can also inhibit plant pathogenic fungi such as Pythium ultimum, Fusarium graminearum, Fusarium pseudograminearum, and Rhizoctonia solani, and can be used for the control of related plant diseases caused by the above-mentioned pathogenic fungi.
[0036] In addition, the said Trichoderma viride MJ18 can improve the emergence rate of peanuts and promote the growth of peanuts at the seedling stage. It can be used in combination with chemical insecticides and, as a seed coating agent, can achieve the co-control of Sclerotium rolfsii of peanuts and peanut pests while promoting peanut germination. Description of the Drawings
[0037] Figure 1 Shows the growth of bacteria in the confrontation plates of strain MJ18, Trichoderma harzianum, and Trichoderma asperellum with Sclerotium rolfsii of peanuts.
[0038] Figure 2 Shows the growth of bacteria in the confrontation plates of strain MJ18 with Fusarium graminearum, Fusarium pseudograminearum, Rhizoctonia solani, and Pythium ultimum, as well as the growth of bacteria in the control plates of each pathogenic fungus.
[0039] Figure 3 Shows the results of the hyperparasitism test of strain MJ18 on Sclerotium rolfsii of peanuts.
[0040] Figure 4 Shows the results of the hyperparasitism test of strain MJ18 on Sclerotinia sclerotiorum.
[0041] Figure 5 Shows the results of the effect of the combination of strain MJ18 and 18% clothianidin on peanut emergence.
[0042] Figure 6 The effects of different concentrations of clothianidin on the growth of strain MJ18. Detailed implementation manners
[0043] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not impose any form of limitation on the present invention. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.
[0044] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0045] The taxonomic name of strain MJ18 described in the embodiments of the present invention is Trichoderma viride ( Trichoderma virens ), which was deposited at the China Center for Type Culture Collection (CCTCC) on January 15, 2025, with the deposit number CCTCC NO: M2025149, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.
[0046] Example 1 Isolation and molecular identification of strain MJ18 1. Isolation and purification of the strain The strain MJ18 described in the present invention was isolated from a green parasitic fungus in the white silk-like mycelium on potted peanuts, and its isolation and purification process is as follows: Dip a sterile cotton swab into the spores of the green fungus in the white silk-like mycelium on potted peanuts, dissolve the dipped spores in sterile water, dilute to an appropriate multiple and then coat on a PDA plate for culture; after culturing for 24 - 48 h, pick a single colony on the plate to a blank PDA plate for subculture; after subculturing for 24 - 48 h, use sterile forceps to pick the mycelium on the colony to a blank plate for secondary isolation culture, and the colony obtained from the secondary isolation culture is regarded as a pure culture colony, named MJ18.
[0047] Take the culture of the pure culture colony for strain identification.
[0048] 2. Molecular identification of the strain Extract the genomic DNA of strain MJ18 using a bacterial DNA extraction kit. Using the extracted genomic DNA as a template, amplify its ITS sequence by PCR; after the amplified product is detected by electrophoresis, send it to a sequencing company for sequencing to obtain the ITS sequence of strain MJ18 (shown as SEQ ID NO.1), and perform Blast analysis on it in the NCBI database.
[0049] The primers used for PCR amplification of the ITS sequence of strain MJ18 are as follows: ITS1-F: TCCGTAGGTGAACCTGCGG (SEQ ID NO.2); ITS4-R: TCCTCCGCTTATTGATATGC (SEQ ID NO.3).
[0050] The PCR amplification system was as follows: 12.5 μL of PCR reaction mixture (containing 10 × PCR Buffer, dNTP (each 10 mM), TaqPlus DNA Polymerase (5 U / μL) and 50 mM MgSO4), 1 μL of primer ITS1-F (10 μM), 1 μL of primer ITS1-R (10 μM), 1 μL of template DNA, and supplemented with ddH2O to 25 μL.
[0051] The PCR amplification program was: 5 min at 95°C; 30 s at 94°C, 30 s at 57°C, 90 s at 72°C, for 30 cycles; 10 min at 72°C.
[0052] It can be seen from the sequencing results that the ITS sequence of strain MJ18 is as shown in SEQ ID NO.1. Comparing and analyzing it in the NCBI database, taking the 100% matching strain with a longer Acc.Len as a reference, and combining with the physiological characteristics of strain MJ18, it can be known that strain MJ18 is Trichoderma viride ( Trichoderma virens ).
[0053] 3. Analysis of the specific sequence (specific gene) of the strain In addition, the present invention also commissioned Sangon Biotech (Shanghai) Co., Ltd. to analyze the specific sequence of strain MJ18.
[0054] Genomic DNA of strain MJ18 was extracted, and its specific sequence was sequenced and analyzed using an ABI 3730 DNA sequencer. Through sequencing analysis, there are 4 specific sequences in strain MJ18, and the nucleotide sequences of the specific sequences are as shown in SEQ ID NO.4 - 7 in sequence.
[0055] Among them, during the sequencing process, the primers used for PCR amplification are as follows (shown in SEQ ID NO.8 - 17): AF395754.1-F: GATCCAATGCCACGTATGCTCA (SEQ ID NO.8); AF395754.1-R: CACATCATGGCACCGGCAAA (SEQ ID NO.9); AF395756.1-F: ATGCCCAGGTTGTTTATATCCCT (SEQ ID NO.10); AF395756.1 - R: CCACCGGGAGCTAGACCACT (SEQ ID NO.11); AF397019.1 - F: CTGCCTATCGATCTACCGCCTA (SEQ ID NO.12); AF397019.1 - R: CCAGCGTATTCGTCCAAAGCTC (SEQ ID NO.13); AF397020.1 - F: TACCCTCAGCTCTGCAAGCCCTC (SEQ ID NO.14); AF397020.1 - R: CACCGCCACCTCCAACTCCG (SEQ ID NO.15); EF534378.1 - F: TGCCTTCGTTGACTGCTCTCG (SEQ ID NO.16); EF534378.1 - R: GACCTGTGCCTCAAAACCAGTG (SEQ ID NO.17).
[0056] The strain MJ18 of the present invention was deposited at the China Center for Type Culture Collection (CCTCC) on January 15, 2025, with the deposit number CCTCC NO: M 2025149 and the deposit address at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.
[0057] Example 2 Inhibitory effect of strain MJ18 on different pathogenic fungi 1. Testing the inhibitory effect of strain MJ18 on Sclerotium rolfsii by the plate confrontation method Take fresh cultures of strain MJ18 and Sclerotium rolfsii ( Sclerotium rolfsii Sacc. .). Prepare plates. Use a 6 - mm - diameter punch to cut a mycelial disc of Sclerotium rolfsii and place it in the center of a blank PDA plate. Use a 6 - mm - diameter punch to cut a mycelial disc of strain MJ18 and place it on both sides, controlling the distance between it and the mycelial disc of Sclerotium rolfsii to be 20 mm. Place the confrontation plates inoculated with the mycelial discs in an incubator at 30°C. After culturing for 11 days, observe the inhibitory effect of strain MJ18 on Sclerotium rolfsii. Separately take the Trichoderma harzianum ( Trichoderma harzianum Rifai ) and Trichoderma asperellum ( Trichoderma rough ) strains preserved in the laboratory, and obtain the confrontation plates of Trichoderma harzianum / Trichoderma asperellum and Sclerotium rolfsii respectively according to the same method as described above. Place them in an incubator at 30°C and observe after culturing for 11 days.
[0058] The growth of strains MJ18, Trichoderma harzianum, and Trichoderma asperellum in confrontation plates with Sclerotium rolfsii of peanut is as follows Figure 1 shown. From Figure 1 it can be seen that strain MJ18 has obvious hyperparasitism on Sclerotium rolfsii of peanut, manifested as the mycelium of MJ18 adsorbing and twining around the surface of the mycelium of Sclerotium rolfsii of peanut, and a large amount of green spore powder covering the plaque of Sclerotium rolfsii of peanut. Although the inoculated strains of Trichoderma harzianum and Trichoderma asperellum have a certain inhibitory effect on Sclerotium rolfsii of peanut, there is no obvious hyperparasitism phenomenon.
[0059] 2. Inhibitory rate of strain MJ18 on other pathogenic fungi In addition to Sclerotium rolfsii of peanut, by using the plate confrontation method, the present invention also tested the inhibitory rates of strain MJ18 on Fusarium graminearum ( Fusarium gramineae ), Fusarium pseudograminearum ( Fusarium pseudograsses ), Rhizoctonia solani ( Rhizoctonia solani ), and Pythium ultimum ( The last Pythium ) collected from different regions and / or host crops.
[0060] The method for testing the antibacterial rate is as follows. Take the freshly cultured strain MJ18 and the plate of the pathogenic fungus, use a punch with a diameter of 6 mm to punch out the fungal cake of the pathogenic fungus and the fungal cake of MJ18 respectively, place them on both sides of the plate as a confrontation plate, and at the same time set a plate with only the fungal cake of the pathogenic fungus placed at one end. After culturing the plate inoculated with the fungal cake in a constant temperature incubator for 3 d, measure the radius R1 of the fungal cake of the pathogenic fungus towards the center of the plate on the pathogenic fungus plate, and at the same time measure the radius R2 of the fungal cake of the pathogenic fungus towards the center of the plate on the confrontation plate, and calculate the inhibitory rate according to the following formula; .
[0061] The inhibitory rates of strain MJ18 on pathogenic fungi collected from different regions and / or host plants are shown in Table 1, and the corresponding plates are as Figure 2 shown.
[0062] Table 1 Inhibitory rates of strain MJ18 on pathogenic fungi collected from different regions and / or host plants
[0063] Combined with Figure 2 and the results shown in Table 1, it can be seen that strain MJ18 can effectively inhibit the growth of Pythium ultimum, and its inhibitory rate is greater than 75%; strain MJ18 can also inhibit the growth of Fusarium graminearum, Fusarium pseudograminearum, and Rhizoctonia solani to a certain extent, and there are certain differences in the inhibitory effects on Fusarium graminearum collected from different regions and different host crops.
[0064] Example 3 Efficacy test of strain MJ18 against southern blight of peanut 1. Test on the hyperparasitic effect of strain MJ18 on Sclerotium rolfsii Put 30 g of wheat grains into a 500 mL Erlenmeyer flask, add 70 mL of water, mix well, and sterilize at 121 °C for 30 min to obtain sterile wheat grains; scrape an appropriate amount of fungal cakes from the Sclerotium rolfsii plate with an inoculation spatula and inoculate them into the sterile wheat grains. After mixing evenly, place them in an incubator at 30 °C for 7 d to obtain a large amount of Sclerotium rolfsii mycelium. Add 200 g of organic soil to a clean disposable lunch box, take 10 g of Sclerotium rolfsii mycelium and mix well to obtain diseased soil; take 1 mL of MJ18 spore solution with a concentration of 1×10 9 cfu / mL and evenly drip it on the surface of the obtained diseased soil as the experimental group. At the same time, set up a blank control group by dripping 1 mL of clear water; place the experimental group and the blank control group at room temperature of 20 - 35 °C and culture for 11 d.
[0065] The test results of the hyperparasitism of strain MJ18 on Sclerotium rolfsii are as Figure 3 shown. It can be Figure 3 seen that after 11 d of culture, the mycelium of Sclerotium rolfsii in the blank control group grew vigorously, while the mycelium of Sclerotium rolfsii in the experimental group was parasitized and killed by strain MJ18 after growth.
[0066] Furthermore, take the Sclerotium rolfsii colonies on the blank control group and the experimental group and conduct subculture tests on the plate to verify the control effect of strain MJ18 on Sclerotium rolfsii. The specific method is as follows: Use forceps to pick up the mycelium of Sclerotium rolfsii in the blank control group and place it in the center of the PDA plate respectively, set up 10 parallels for subculture, as the mycelium blank control group; use forceps to pick up the sclerotia of Sclerotium rolfsii in the blank control group and place it in the center of the PDA plate respectively, set up 10 parallels for subculture, as the sclerotium blank control group; pick up the mycelium of Sclerotium rolfsii in the group inoculated with MJ18 spore solution, rinse it three times under sterile water, and then pick up the mycelium without the attachment of MJ18 mycelium and spores under the microscope and place it on the PDA plate, set up 10 parallels for subculture, as the mycelium experimental group; pick up the sclerotia of Sclerotium rolfsii in the group inoculated with MJ18 spore solution, rinse it three times under sterile water, and then pick up the sclerotia without the attachment of MJ18 mycelium and spores under the stereomicroscope and place it on the PDA plate, set up 10 parallels for subculture, as the sclerotium experimental group; place the above subcultured plates in an incubator at 30 °C in the dark for 5 d and observe whether the mycelium and sclerotia of Sclerotium rolfsii grow normally. The results are shown in Table 2.
[0067] Table 2 Test on the hyperparasitic effect of strain MJ18 on Sclerotium rolfsii
[0068] As can be seen from the results shown in Table 2, the strain MJ18 has a strong hyperparasitic effect on Sclerotium rolfsii of peanut, and can kill 100% of the hyphae and sclerotia of the parasitic Sclerotium rolfsii of peanut, showing good application prospects for the control of peanut southern blight.
[0069] 2. Efficacy test of strain MJ18 against peanut southern blight Taking peanut as an example, the present invention tested the efficacy of strain MJ18 against peanut southern blight.
[0070] Peanut seeds (Yuanhua 308) were sown in medium-sized flower pots, 2 seeds per pot. After sowing, they were placed in a greenhouse at 28 °C, 75% humidity, and a photoperiod of 14 h light / 10 h dark for cultivation. Watering was carried out once every 3 - 5 days during the cultivation process; 10 days after sowing, the seedlings of the potted plants were thinned, and 1 plant remained in each pot. The plants that were too weak or too strong in growth in each pot were cut off from the hypocotyl with scissors to remove the above-ground parts; after continuing to grow for 15 days, the peanut hypocotyls were pricked 5 times with a syringe needle to damage the roots, and the experimental treatments were started: For treatment 1, 20 wheat grains colonized by Sclerotium rolfsii of peanut were placed at the hypocotyl part of the peanut plant. After 2 days of cultivation, 1 mL of MJ18 spore suspension with a concentration of 2×10 8 cfu / mL was dropped near the hypocotyl, and 20 replicates were set; for treatment 2, 20 wheat grains colonized by Sclerotium rolfsii of peanut were placed at the hypocotyl part of the peanut plant. After 2 days of cultivation, 1 mL of Trichoderma viride ( 8 ), MJ20 spore suspension (Trichoderma viride strain MJ20 is a strain preserved in the applicant's laboratory, and its inhibition rate of the Sclerotium rolfsii of peanut colony on the plate is about 75%, but it has no hyperparasitic ability to Sclerotium rolfsii of peanut) with a concentration of 2×10 Trichoderma green cfu / mL was dropped near the hypocotyl, and 20 replicates were set; for treatment 3, 20 wheat grains colonized by Sclerotium rolfsii of peanut were placed at the hypocotyl part of the peanut plant. After 2 days of cultivation, 1 mL of MJ18 spore suspension after high-temperature sterilization (this spore suspension was exactly the same as that in treatment 1 before sterilization) was dropped near the hypocotyl, and 20 replicates were set; for treatment 4, 20 sterilized wheat grains were placed at the hypocotyl part of the peanut plant. After 2 days of cultivation, 1 mL of MJ18 spore suspension with a concentration of 2×10 8 cfu / mL was dropped near the hypocotyl, and 20 replicates were set.
[0071] After the above 4 treatments were completed, they were placed in a greenhouse at 28 °C, 90% relative humidity, and a photoperiod of 14 h light / 10 h dark for cultivation; the disease index and incidence rate were investigated once every 3 days. After continuous investigation for 10 times, the disease index and incidence rate of the plants were calculated, and the control effect was statistically analyzed.
[0072] Disease grading standard: Grade 0 means no yellowed diseased leaves or branches; Grade 1 means that less than 25% of the whole plant shows wilting or death; Grade 3 means that 25 - 50% of the whole plant shows wilting or death; Grade 5 means that more than 50% shows wilting but not death; Grade 7 means the whole plant is dead.
[0073] Incidence = (Number of diseased plants) × 100% / (Number of surveyed plants); Disease index = Σ(Number of diseased plants at each level × Corresponding disease level value) × 100 / (Total number of surveyed plants × Highest disease level); Control effect = ((Disease index of control group - Disease index of treatment group) × 100%) / Disease index of control group.
[0074] In the above treatment, the preparation method of wheat grains infected with Sclerotium rolfsii of peanut is as follows: 100 g of wheat grains and 100 mL of water are placed in a 500 mL Erlenmeyer flask and mixed for sterilization (sterilized at 121 °C for 30 min). After cooling, the preserved mycelium of Sclerotium rolfsii of peanut is inoculated. Then, it is cultured in an incubator at 28 °C and 80% humidity for 5 - 8 d to obtain wheat grains infected with Sclerotium rolfsii of peanut.
[0075] The statistical results of the incidence, disease index, and control effect of peanuts in each treatment group are shown in Table 3. It can be seen from the results shown in Table 3 that strain MJ18 has a good control effect on peanut southern blight, reaching more than 95%. It is speculated that this may be because strain MJ18 has a strong hyperparasitic ability to Sclerotium rolfsii of peanut. After strain MJ18 enters the soil, due to its hyperparasitic effect, it can colonize better and play a control role. While strain MJ20 does not have hyperparasitic ability, so it grows weakly in the soil and the inhibition of Sclerotium rolfsii of peanut becomes worse, resulting in a poor control effect.
[0076] Table 3 Statistical results of the incidence, disease index, and control effect of peanuts in each treatment group
[0077] Example 4 Test on the hyperparasitic effect of strain MJ18 on Sclerotinia sclerotiorum Take 30 g of wheat grains and put them into a 500 mL Erlenmeyer flask, add 70 mL of water, mix, and sterilize at 121 °C for 30 min to obtain sterile wheat grains; scrape an appropriate amount of agar plugs from the Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ) plate with an inoculation spatula and inoculate it into the sterile wheat grains. After mixing evenly, place it in an incubator at 30 °C for 7 d to obtain a large amount of mycelium of Sclerotinia sclerotiorum. Add 200 g of organic soil to a clean disposable lunch box, take 10 g of the mycelium of Sclerotinia sclerotiorum and mix evenly to obtain diseased soil; take 1 mL of MJ18 spore suspension with a concentration of 1×10 9 cfu / mL and evenly drip it on the surface of the diseased soil as the experimental group, and at the same time set a blank control group with 1 mL of water dripped; the experimental group and the blank control group are simultaneously placed at room temperature of 20 - 35 °C for 11 d.
[0078] The results of the hyperparasitism test of strain MJ18 against Sclerotinia sclerotiorum are as Figure 4 shown. It can be Figure 4 seen that after 11 days of culture, the mycelia of Sclerotinia sclerotiorum in the blank control group grew vigorously, while the mycelia of Sclerotinia sclerotiorum in the experimental group were parasitized by MJ18 after growth, indicating that MJ18 has a strong hyperparasitic effect on Sclerotinia sclerotiorum.
[0079] Furthermore, the colonies of Sclerotinia sclerotiorum on the blank control group and the experimental group were taken for subculture tests on the plate to verify the control effect of strain MJ18 against Sclerotinia sclerotiorum. The specific method is as follows: Use forceps to pick up the mycelia of Sclerotinia sclerotiorum in the blank control group and place them in the center of the PDA plate, set 10 parallels for subculture, as the mycelia blank control group; Use forceps to pick up the sclerotia of Sclerotinia sclerotiorum in the blank control group and place them in the center of the PDA plate, set 10 parallels for subculture, as the sclerotia blank control group; After picking the mycelia of Sclerotinia sclerotiorum inoculated with MJ18 spore solution and rinsing them three times under sterile water, pick the mycelia of Sclerotinia sclerotiorum without MJ18 mycelia and spores attached under the microscope and place them on the PDA plate, set 10 parallels for subculture, as the mycelia experimental group; After picking the mycelia of Sclerotinia sclerotiorum inoculated with MJ18 spore solution and rinsing them three times under sterile water, pick the sclerotia of Sclerotinia sclerotiorum without MJ18 mycelia and spores attached under the stereomicroscope to the PDA plate, set 10 parallels for subculture, as the sclerotia experimental group; Place the above subcultured plates in a constant temperature incubator at 30 °C in the dark for 5 days and observe whether the Sclerotinia sclerotiorum grows normally. The results are shown in Table 4.
[0080] Table 4 Test on the hyperparasitic effect of strain MJ18 against Sclerotinia sclerotiorum
[0081] It can be seen from the results shown in Table 4 that strain MJ18 has a strong hyperparasitic effect on Sclerotinia sclerotiorum, and can kill 100% of the parasitized mycelia and sclerotia of Sclerotinia sclerotiorum, and can be used for the control of Sclerotinia sclerotiorum and the plant diseases caused by it.
[0082] Example 5 Effect of strain MJ18 on the emergence of peanut seedlings In addition to diseases such as southern blight of peanut, the control of peanut pests is also an important issue in the peanut planting process. And most of the preparations for controlling peanut pests are chemical reagents, and when used in combination with biocontrol bacteria, it may affect the function of biocontrol bacteria. For example, it has been reported that imidacloprid, thiamethoxam and difenoconazole have no obvious effect on the diversity of endophytic bacterial communities in the roots and leaves of rice, but will reduce the richness of the root community. In this invention, taking clothianidin as an example, by testing its effect on the growth of strain MJ18, and its combined effect with strain MJ18 on the germination rate and germination potential of peanuts, it is tested whether the two can be used in combination for the control of peanut fungal diseases and pests.
[0083] 1. Effects of the combination of clothianidin and strain MJ18 on the germination rate and germination potential of peanuts As shown in Table 5, experimental groups were set up. The MJ18 spore solution with a concentration of 1×10 9 cfu / mL was coated with 18% clothianidin at a dose of 800 g / 100 kg of seeds at doses of 50, 100, 200, and 400 g / 100 kg of seeds respectively. When coating, the spore solution, 18% clothianidin, and film-forming agent were mixed evenly to obtain a seed coating agent, and then the seed coating agent was mixed with peanut seeds and placed in a coating machine to be fully stirred to obtain coated peanut seeds. Organic soil and inorganic soil were mixed in a mass ratio of 1:2 and placed in small flower pots. The coated peanut seeds were sown in the pots at a ratio of 5 seeds per pot. The growth of each treatment was observed 14 - 21 days after sowing, and a control group without MJ18 was set up.
[0084] Table 5
[0085] The results of the combined use of strain MJ18 and 18% clothianidin on the emergence of peanuts are as Figure 5 shown. As Figure 5 can be seen, the growth of the treatment with the addition of strain MJ18 was higher than that of the treatment with clothianidin alone, and with the increase in the dose of the MJ18 spore solution, its growth also continuously increased, reaching the highest level when the dose of the MJ18 spore solution was 400 g / 100 kg of seeds.
[0086] 2. Effects of clothianidin on the growth of strain MJ18 PDA plates containing 0.1, 1, 10, and 50 ppm of clothianidin were prepared respectively, and a PDA plate without clothianidin was used as a control. Freshly cultured strain MJ18 plates were taken, and fungal discs with a diameter of 6 mm were punched out and placed in the center of the PDA plates containing different concentrations of clothianidin. After culturing in a constant temperature incubator for the same time, the growth of strain MJ18 was observed. The results are as Figure 6 shown. As Figure 6 can be seen, clothianidin has no inhibitory effect on the growth of strain MJ18.
[0087] Combined with the above results, it can be known that strain MJ18 can be combined with clothianidin to better control peanut diseases and pests. The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. A strain of Trichoderma viride ( Trichoderma virens ), characterized in that The above-mentioned Trichoderma virens was deposited at the China Center for Type Culture Collection on January 15, 2025, with the deposit number of CCTCC NO: M 2025149; or contains one or more of the specific genes 1-4, and the nucleotide sequences of the specific genes 1-4 are shown in SEQ ID NO.4-7 in sequence.
2. A preparation, characterized in that, Contains the Trichoderma virens and / or its culture as described in claim 1.
3. The preparation according to claim 2, characterized in that, Also contains neonicotinoid insecticides.
4. The preparation according to claim 3, wherein The neonicotinoid insecticide is one or more of imidacloprid, acetamiprid, thiamethoxam, clothianidin, thiacloprid, dinotefuran, nitenpyram, clothianidin, cycloxaprid, and flupyradifurone.
5. Use of the Trichoderma viride described in claim 1 or the preparation described in any one of claims 2 to 4 in inhibiting phytopathogenic fungi, characterized in that, The plant pathogenic fungi are Sclerotium rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Fusarium pseudograminearum, and / or Rhizoctonia solani.
6. Use of the Trichoderma viride according to claim 1 or the preparation according to any one of claims 2 to 4 in the preparation of a product for inhibiting phytopathogenic fungi, characterized in that, The plant pathogenic fungi are Sclerotium rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Fusarium pseudograminearum, and / or Rhizoctonia solani.
7. Use of the Trichoderma viride as claimed in claim 1 or the preparation as claimed in any one of claims 2 to 4 in controlling plant fungal diseases, characterized in that, The plant fungal diseases are caused by Sclerotium rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Fusarium pseudograminearum, and / or Rhizoctonia solani.
8. Use of the Trichoderma viride according to claim 1 or the preparation according to any one of claims 2 to 4 in the preparation of a product for controlling plant fungal diseases, characterized in that, The plant fungal diseases are caused by Sclerotium rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Fusarium pseudograminearum, and / or Rhizoctonia solani.
9. Use of the Trichoderma virens as described in claim 1 or the preparation as described in any one of claims 2-4 in increasing the emergence rate of peanuts and / or promoting the growth of peanut seedlings.
10. Use of the Trichoderma virens as described in claim 1 or the preparation as described in any one of claims 2-4 in the preparation of a product for increasing the emergence rate of peanuts and / or promoting the growth of peanut seedlings.
Citation Information
Patent Citations
Trichoderma aureoviride strain and application thereof
CN103320330A
Trichoderma citrinoviride and application thereof
CN105039168A
Trichoderma virens strain RM9 for antagonizing jasmine southern blight and application of trichoderma virens strain RM9
CN115975816A
Control of plant diseases and enhancing plant growth using a combination of a trichoderma virens species and a rhizosphere competent trichoderma harzianum species
US20100028303A1
Microbial compositions and methods
US20190320661A1