Sequencing linkers for nanopore sequencing and uses thereof

By introducing non-B-form structures of G-rich and C-rich regions into the nanopore sequencing linker, the motor proteins are prevented from de-rotating nucleic acid function in the non-sequencing state, solving the high-cost problem and achieving low-cost and efficient nanopore sequencing.

CN120366293AActive Publication Date: 2025-07-25BGI HANGZHOU CYCLONESEQ TECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510881103.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-27
Publication Date
2025-07-25
Estimated Expiration
2045-06-27

AI Technical Summary

Technical Problem

The existing nanopore sequencing linkers are expensive to synthesis and do not meet market demand.

Method used

A nanopore sequencing linker is designed to include a first single strand and a second single strand, the first single strand comprises a single strand nucleotide region for guiding the nucleic acid to be tested into the nanopore and a single strand nucleotide region for binding to the motor protein, and a third segment contains a G-rich region and/or a C-rich region to prevent the motor protein from unrotating the nucleic acid in a non-sequencing state, and is sequenced through the secondary structural region only after the pilot strand enters the nanopore.

Benefits of technology

The cost of synthesis of nanopore sequencing linkers is reduced while maintaining sequencing accuracy and resolution. By introducing non-B-form structures to effectively prevent the non-essential de-rotating function of motor proteins, a cost-effective sequencing process is achieved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366293A_ABST
    Figure CN120366293A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of sequencing, in particular to a sequencing joint for nanopore sequencing and application of the sequencing joint. According to the sequencing joint provided by the invention, different non-B-form structures are designed in the sequencing joint and are used for preventing motor protein from unwinding nucleic acid in a non-sequencing state, so that the motor protein can pass through a secondary structure region for sequencing only when a pilot chain enters a nanopore and under the action of electric field force. The synthesis cost of the sequencing linker for sequencing by using the nanopore is lower than that of the existing sequencing linker.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of sequencing technology, and particularly relates to a sequencing adapter for nanopore sequencing and its uses. Background Art

[0002] Nanopore sequencing is a newly emerging sequencing technology in recent years. As a high-throughput single-molecule sequencing method, the principle of nanopore sequencing lies in detecting the change in current within the pore brought about by a single-stranded nucleic acid molecule passing through the nanopore, and then determining the type of base passing through the pore through signal recognition. In nanopore sequencing, the nucleic acid to be tested (DNA / RNA) is ligated to a sequencing adapter loaded with motor proteins to obtain a sequencing library that can be captured by the nanopore.

[0003] Existing nanopore sequencing adapters mainly perform two functions: 1. Loading motor proteins; 2. Nanopore capture, so that the DNA to be tested can be subjected to nanopore sequencing. Among them, the function of nanopore capture is achieved through the leading strand and the anchoring region, while the function of loading motor proteins requires two regions: 1. The loading region, which is the site where the motor protein can bind, usually a single-stranded DNA; 2. The modification region. Under non-sequencing conditions, the motor protein does not function and does not move. Only when the leading strand part of the sequencing adapter enters the nanopore, the motor protein is located above the nanopore, and the movement directions of the DNA to be tested and the motor protein are opposite, under the action of the electric field force, the motor protein unwinds / polymerizes / digests across the modification region and starts to move relative to the direction of the DNA to be tested entering the pore, and the DNA to be tested enters the pore for sequencing.

[0004] However, the synthesis cost of the nucleic acid sequence of the existing adapter is extremely high, which does not meet the market demand. Therefore, there is an urgent need to develop a sequencing adapter for nanopore sequencing with a lower cost to reduce the sequencing cost. Summary of the Invention

[0005] The present invention aims to solve at least one of the technical problems in the related technologies to some extent. For this reason, an object of the present invention is to provide a sequencing adapter for nanopore sequencing. The inventors designed different non-B-form structures in the sequencing adapter to prevent the motor protein from unwinding nucleic acids in the non-sequencing state, so that it can only pass through the secondary structure region under the action of the electric field force when the leading strand enters the nanopore for sequencing.

[0006] For this reason, the first aspect of the present invention provides a sequencing adapter. In some embodiments of the present invention, the sequencing adapter is used for nanopore sequencing, wherein it includes a first single strand, and the first single strand includes: A first segment, which is a single-stranded nucleotide region for guiding the nucleic acid to be tested into the nanopore; A second segment, which is a single-stranded nucleotide region for binding the motor protein; A third segment, a single-stranded nucleotide region for preventing a motor protein from exercising its nucleic acid unwinding function in a non-sequencing state; A fourth segment for linking an analyte to be detected; Wherein, the third segment contains a G-rich region and / or a C-rich region; The G-rich region forms a G-quadruplex structure; The C-rich region forms an i-Motif structure.

[0007] The inventors found that by designing non-B-form structures (G-rich regions and / or C-rich regions) in the sequencing adaptor for nanopore sequencing, it is possible to prevent the motor protein from unwinding nucleic acids in the non-sequencing state, so that it can only pass through the secondary structure region under the action of the electric field force when the leading strand enters the nanopore for sequencing. The sequencing adaptor provided by the present invention has a lower synthesis cost compared to the existing sequencing adaptors.

[0008] In some embodiments of the present invention, the sequencing adaptor contains at least 10 - 30 consecutive base Ts.

[0009] In some embodiments of the present invention, the nucleic acid sequence of the third segment is shown as any one of the sequences in SEQ ID NO: 22 - 25.

[0010] In some embodiments of the present invention, the sequencing adaptor further includes a second single strand, and the second single strand includes a ligation segment for linking an analyte to be detected, which is complementary paired with the fourth segment of the first single strand.

[0011] The second aspect of the present invention provides the use of the sequencing adaptor described in the first aspect in the preparation of a kit for nanopore sequencing.

[0012] The third aspect of the present invention provides a kit for nanopore sequencing. In some embodiments of the present invention, the kit includes the sequencing adaptor described in the first aspect, and further includes a polynucleotide-binding protein; the polynucleotide-binding protein is selected from at least one of polymerase, helicase or exonuclease.

[0013] The fourth aspect of the present invention provides a construct. In some embodiments of the present invention, the construct includes a nucleic acid to be sequenced and the sequencing adaptor described in the first aspect, wherein the sequencing adaptor is linked to one or both ends of the nucleic acid to be sequenced.

[0014] The fifth aspect of the present invention provides a complex for sequencing. In some embodiments of the present invention, the complex includes a polynucleotide-binding protein, and the sequencing adaptor described in the first aspect or the construct described in the fourth aspect, The polynucleotide-binding protein is selected from at least one of a polymerase, a helicase, or an exonuclease.

[0015] The sixth aspect of the present invention provides a method for constructing a sequencing complex. In some embodiments of the present invention, the method includes: (1) constructing the sequencing adapter described in the first aspect; (2) assembling the sequencing adapter with the nucleic acid to be sequenced to form a construct; (3) contacting the construct with a polynucleotide-binding protein to obtain a sequencing complex; The polynucleotide-binding protein is selected from at least one of a polymerase, a helicase, or an exonuclease.

[0016] The seventh aspect of the present invention provides the use of the sequencing adapter described in the first aspect, the construct described in the fourth aspect, and the complex for sequencing described in the fifth aspect in nanopore sequencing.

[0017] The eighth aspect of the present invention provides a nanopore sequencing method. In some embodiments of the present invention, the nanopore sequencing method includes performing nanopore sequencing on the nucleic acid to be sequenced using at least one of the sequencing adapter described in the first aspect, the kit described in the third aspect, the construct described in the fourth aspect, and the complex for sequencing described in the fifth aspect.

[0018] The inventors optimized the sequencing adapter for nanopore sequencing, designed different non-B-form structures in the sequencing adapter, used it to prevent the motor protein from unwinding the nucleic acid in the non-sequencing state, so that it can only pass through the secondary structure region under the action of the electric field force when the leading strand enters the nanopore for sequencing. By introducing the natural nucleotide sequence of the secondary structure on the adapter, a novel nanopore sequencing adapter can be constructed and sequencing can be successfully performed. The synthesis cost of this sequencing adapter is low.

[0019] The additional aspects and advantages of the present invention will be partially given in the following description, partially become apparent from the following description, or be understood through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The above and / or additional aspects and advantages of the present invention will become apparent and be readily understood from the description of the embodiments in conjunction with the following drawings, in which: Figure 1 shows a schematic diagram of the sequencing adapter of an embodiment of the present invention; Figure 2The non-denaturing PAGE electrophoresis results of the DNA samples prepared in Example 1 are shown, wherein lanes 1-9 are 50 bp DNA ladder (TIANGEN), G4-1, G4-1_neg, G4-2, G4-2_neg, ds-1, G4-2_neg, ds-2, ds-2_neg, respectively; Figure 3 The fluorescence quenching experiment is shown to detect the inhibition of DNA samples on helicase Dda; Figure 4 The nanopore sequencing current signal is displayed, where AE are the current signals of the neg-Adp, a1-Adp, a2-Adp, a3-Adp, a4-Adp connectors and the connected DNA to be tested. DETAILED DESCRIPTION

[0021] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0022] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0023] The endpoints and any values of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, the endpoint values of each range and the individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0024] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by those skilled in the art to which the present invention belongs.

[0025] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention but not excluding other contents.

[0026] As used herein, the terms "optionally", "optional" or "option" generally mean that the subsequent described event or condition may but need not occur, and the description includes cases where the event or condition occurs and cases where the event or condition does not occur.

[0027] As used herein, the term "B-form structure" refers to the most stable and common double-helix conformation of DNA under physiological conditions, and its structural features include a right-handed double helix, base pairing, specific helical parameters, and the presence of major and minor grooves. The stability, functional adaptability, and dynamics of B-form DNA enable it to efficiently carry out important biological processes such as replication and transcription in organisms.

[0028] As used herein, the term "motor protein" refers to a class of proteins that can convert chemical energy (usually from ATP hydrolysis) into mechanical energy. In nanopore sequencing, the motor protein plays a crucial role. It can control the speed of DNA or RNA molecules passing through the nanopore, keeping it at an appropriate rate. This speed control is essential for accurately detecting the current changes caused by each base. By stably controlling the movement of DNA or RNA molecules, the motor protein can reduce the noise of the current signal and improve the accuracy and resolution of sequencing. During nanopore sequencing, the motor protein binds to the adapter of the library molecule to help the DNA or RNA molecule stably enter the nanopore. Additionally, a motor protein (such as phi29 DNA polymerase) can bind to the DNA double strand during nanopore sequencing and, under the drive of an electric field, perform the function of unwinding nucleic acids to unwind the double strand into single-stranded nucleic acids. This process ensures that the single-stranded nucleic acids can smoothly pass through the nanopore, thereby enabling accurate detection of each base.

[0029] As used herein, the term "G-rich region" refers to a region of DNA or RNA sequence rich in guanine, and these regions can form stable G-quadruplex structures.

[0030] As used herein, the term "C-rich region" refers to a region of DNA or RNA sequence rich in cytosine. These regions have special structures and functions in biomolecules, especially being able to form specific secondary structures (such as i-motif structures).

[0031] According to a specific embodiment of the present invention, the present invention provides a sequencing adapter for nanopore sequencing, comprising a first single strand, and the first single strand includes: A first segment, a single-stranded nucleotide region for guiding a nucleic acid to be tested into the nanopore; A second segment, a single-stranded nucleotide region for binding a motor protein; A third segment, a single-stranded nucleotide region for preventing the motor protein from exercising the function of unwinding nucleic acid in a non-sequencing state; A fourth segment for connecting an analyte to be detected; Wherein, the third segment contains a G-rich region and / or a C-rich region; The G-rich region forms a G-quadruplex structure; The C-rich region forms an i-Motif structure.

[0032] According to a specific embodiment of the present invention, the sequencing adapter contains at least 10-30 consecutive base Ts. For example, the sequencing adapter may contain 10, 15, 20, 25, or 30 consecutive base Ts. These consecutive base Ts are usually located in the first segment of the sequencing adapter. For example, the consecutive base Ts in the first segment (also called the guiding region) are shown in sequence SEQ ID NO: 21 (5’-TTTTTTTTTTTTTTTTTTTT-3’).

[0033] According to a specific embodiment of the present invention, the first segment and the second segment may be the same segment.

[0034] According to a specific embodiment of the present invention, the nucleic acid sequence of the third segment is shown in any one of SEQ ID NOs: 22-25.

[0035] SEQ ID NO: 22: 5’-GGGTGGGTGGGTGGGT-3’ SEQ ID NO: 23: 5’-GGGTGGGTGGGTGGGTTTGGGTGGGTGGGTGGGT-3’ SEQ ID NO: 24: 5’-CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG-3’ SEQ ID NO: 25: 5’-CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG -3’.

[0036] According to a specific embodiment of the present invention, the sequencing adapter further includes a second single strand, and the second single strand includes a connection segment for connecting an analyte to be detected, which is complementary to the fourth segment of the first single strand.

[0037] According to a specific embodiment of the present invention, the sequencing adapter of the present invention is as Figure 1As shown, the sequencing adapter includes a first single strand and a second single strand. The first single strand includes a first segment (guide region), a second segment (loading region), a third segment (blocking region), and a fourth segment. The fourth segment includes a double-stranded pairing region and a segment for connecting the analyte to be tested. The second single strand includes a side chain region, a segment complementary to the fourth segment, and a connecting segment for connecting the analyte to be tested.

[0038] According to a specific embodiment of the present invention, the sequence of the double-stranded pairing region in the sequencing adapter of the present invention is as shown in 5’-GGTTGTTTCTGTTGGTGCTGATATTGCT-3’ (SEQ ID NO: 26) or 5’-GCAATATCAGCACCAACAGAAACAACC-3’ (SEQ ID NO: 27). It should be noted that the sequence of the double-stranded pairing region in the sequencing adapter structure for nanopore sequencing, or any sequence capable of complementary pairing, is covered by the protection scope of the present invention. However, the length of the double-stranded pairing region needs to meet the commonly used length range in the art. Additionally, it should be noted that there is a sticky end T at the 3’ end of the first single strand.

[0039] It should be noted that there are no specific requirements for the length and sequence of the side chain region of the second single strand. All sequences of the side chain region of the sequencing adapter for nanopore sequencing available in the art are covered by the protection scope of the present invention. For example, it can be 5’-TTTGAGGCGAGCGGTCAA-3’ (SEQ ID NO: 28).

[0040] According to a specific embodiment of the present invention, the above-mentioned sequencing adapter of the present invention can be used to prepare a kit for nanopore sequencing.

[0041] According to a specific embodiment of the present invention, the present invention provides a kit for nanopore sequencing. The kit includes the aforementioned sequencing adapter and also includes a polynucleotide-binding protein. The polynucleotide-binding protein is selected from at least one of polymerase, helicase, or exonuclease.

[0042] It should be noted that any type of polymerase, helicase, or exonuclease known in the art that can be used for nanopore sequencing is covered by the protection scope of the present invention.

[0043] According to a specific embodiment of the present invention, the present invention provides a construct. The construct includes the nucleic acid to be sequenced and the aforementioned sequencing adapter, wherein the sequencing adapter is connected to one or both ends of the nucleic acid to be sequenced. Based on the construct structure, nanopore sequencing of the nucleic acid to be sequenced is thus achieved.

[0044] According to a specific embodiment of the present invention, the present invention provides a complex for sequencing, the complex comprising a polynucleotide-binding protein, and the aforementioned sequencing adaptor or the aforementioned construct; the polynucleotide-binding protein is selected from at least one of a polymerase, a helicase or an exonuclease.

[0045] According to a specific embodiment of the present invention, the present invention provides a method for constructing a sequencing complex, the method comprising: (1) constructing the aforementioned sequencing adaptor; (2) assembling the sequencing adaptor with the nucleic acid to be sequenced to form a construct; (3) contacting the construct with a polynucleotide-binding protein so as to obtain a sequencing complex; the polynucleotide-binding protein is selected from at least one of a polymerase, a helicase or an exonuclease.

[0046] Based on the sequencing complex and nanopore sequencing chip constructed according to the present invention, sequencing of the nucleic acid to be sequenced is thereby achieved. It should be noted that the nanopore sequencing chip may contain a transmembrane pore protein, which may be pre-inserted into the sequencing chip, and the transmembrane pore may be a protein pore or a solid-state pore.

[0047] According to a specific embodiment of the present invention, the present invention provides the use of the aforementioned sequencing adaptor, construct, complex for sequencing in nanopore sequencing.

[0048] According to a specific embodiment of the present invention, the present invention provides a nanopore sequencing method, the nanopore sequencing method comprising performing nanopore sequencing on the nucleic acid to be sequenced by using at least one of the aforementioned sequencing adaptor, the aforementioned kit, the aforementioned construct, the aforementioned complex for sequencing.

[0049] The solutions of the present disclosure will be explained below in conjunction with examples. Those skilled in the art will understand that the following examples are only for illustrating the present disclosure and should not be regarded as limiting the scope of the present disclosure. For those not specified in the examples in terms of specific techniques or conditions, the techniques or conditions described in the literature in the art or according to the product specifications are followed. For reagents or instruments not specified in terms of the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0050] Example 1 Preparation of DNA with non-B-form structure In this example, a DNA sample with a non-B-form DNA structure was prepared by annealing two chemically synthesized nucleotide chains with complementary fragments.

[0051] 1. Order the nucleotide chains (primers) shown in Table 1 below from Sangon Biotech. Dissolve the solid primers into a stock solution with a final concentration of 100 μM using nuclease-free water according to the manufacturer's instructions; Table 1

[0052] Note: The 3' end of the nucleic acid sequences shown as SEQ ID NO: 1 - 7 in Table 1 is linked to the fluorescent reporter group 6-FAM (6-carboxyfluorescein); the 5' end of the nucleic acid sequence shown as SEQ ID NO: 8 is linked to the fluorescent quenching group BHQ1.

[0053] 2. Take 5 μL of the stock solution of the Top strand primer and 5 μL of the stock solution of the Bottom strand primer respectively, add them to 40 μL of Anneal buffer (70 mM KCl, 20 mM KH2PO4, pH = 7.0), mix them together, and use a vortex oscillator to fully mix them evenly. Use a thermal cycler to anneal the primer mixture to obtain DNA samples G4-1 / G4-1_neg / G4-2 / G4-2_neg / ds-1 / ds-2 / ds-2_neg.

[0054] Use 15% non-denaturing PAGE to perform quality detection on DNA samples G4-1 / G4-1_neg / G4-2 / G4-2_neg / ds-1 / ds-2 / ds-2_neg, and the results are as Figure 2 , indicating that the target DNA samples are successfully obtained.

[0055] Example 2 Cloning, Expression and Purification of Helicase Dda In this example, helicase Dda is prepared by recombinant expression in Escherichia coli, and this helicase is used as the motor protein for sequencing. The process of preparing helicase Dda is as follows: 1. Order the full-length cDNA sequence of full-length Dda from Sangon Biotech, and ligate it into the PET.28a(+) plasmid. The double digestion sites used are Nde I and Xho I, so the N-terminus of the expressed Dda protein has a 6*His tag and a thrombin cleavage site; 2. Transform the cloned PET.28a(+)-Dda plasmid into ArcticExpress (DE3) competent bacteria (Tolo Biotech., 96183-02) or its derivative strains. Pick a single colony and inoculate it into 5 mL of LB medium containing kanamycin, and culture it overnight at 37°C with shaking. Then transfer it into 1 L of LB (containing kanamycin), culture it at 37°C with shaking until OD600 = 0.6 - 0.8, cool down to 16°C, and add IPTG with a final concentration of 500 μM to induce the expression of Dda overnight; 3. Prepare five buffer solutions according to the following formulations: Buffer A: 20 mM Tris-HCl pH 7.5, 250 mM NaCl, 20 mM imidazole; Buffer B: 20 mM Tris-HCl pH 7.5, 250 mM NaCl, 300 mM imidazole; Buffer C: 20 mM Tris-HCl pH 7.5, 50 mM NaCl; Buffer D: 20 mM Tris-HCl pH 7.5, 1000 mM NaCl; Buffer E: 20 mM Tris-HCl pH 7.5, 100 mM NaCl; 4. Collect the cells expressing Dda, resuspend the cells using Buffer A, break the cells with a cell disruptor, and then centrifuge to obtain the supernatant. Mix the supernatant with Ni-NTA resin that has been pre-equilibrated with Buffer A and bind for 1 h. Collect the resin and wash the resin extensively with Buffer A until no contaminating proteins are eluted. Then add Buffer B to the resin to elute Dda. Pass the eluted Dda through a desalting column equilibrated with Buffer C to change the buffer. Then add thrombin (Yeasen Biotech, 20402ES05), and then add it to ssDNA cellulose (Sigma, D8273-10G) resin equilibrated with Buffer C, and digest and bind overnight at 4°C. Collect the ssDNA cellulose resin, wash it 3 - 4 times with Buffer C, and then elute with Buffer D. Concentrate the protein purified by ssDNA cellulose and load it onto a Superdex 200 molecular sieve (Sigma, GE28-9909-44), and the molecular sieve buffer used is Buffer E. Collect the target protein peak, concentrate it, and store it frozen. Quantify the concentration of the purified protein using Nanodrop.

[0056] Nucleotide sequence of helicase Dda (SEQ ID NO: 9): Amino acid sequence of helicase Dda protein (SEQ ID NO: 10): MTFDDLTEGQKNAFNIVMKAIKEKKHHVTINGPAGTGKTTLTKFIIEALISTGGTGIILAAPTHAAKKILSKLSGKEASTIHSILKINPVTYEENVLFEQKEVPDLAKCRVLICDEVSMYDRKLFKILLSTIPPWCTIIGIGDNKQIRPVEPGENTAYISPFFTHKDFYQCELTEVKRSNAPIIDVATDVRNGKWNYDKVVDGHGVRGFTGDTALRDFMVNYFSIVKSLDDLFENRVMAFTNKSVDKLNSIIRKKIFETDKDFIVGEIIVMQEPLFKTYKIDGKPVSEIIFNNGQLVRIIEAEYTSTFVKARGVPGEYLIRHWDLTVETYGDDEYYREKIKIISSDEELYKFNLFLAKTAETYKNWNKGGKAPWSDFWDAKSQFSKVKALPASTFHKAQGMSVDRAFIYTPCIHYADVELAQQLLYVGVTRGRYDVFYV* (* indicates termination) Example 3 Fluorescence quenching experiment to test the effect of non-B-form structure on helicase In this example, a fluorescence quenching experiment was used to detect the helicase activity of Dda on DNA with non-B-form structure. In Example 1, the FAM group and BHQ1 group of the DNA duplex were close to each other when the DNA duplex formed, resulting in fluorescence quenching. When the helicase unwound the DNA duplex, the fluorescence was restored.

[0057] 1. Prepare buffer S according to Table 2 below: Table 2

[0058] After buffer S was prepared, it was filtered through a 0.2 μm filter membrane.

[0059] 2. Prepare a 0.75 μM Dda solution of helicase: Mix buffer S and NF Water in a 1:1 ratio to prepare 0.5× buffer S, and dilute the purified helicase Dda solution obtained in Example 2 with 0.5× buffer S to a 0.75 μM solution. Prepare a 100 mM ATP solution using 0.5× buffer S.

[0060] 3. Prepare the fluorescence quenching experiment system according to Table 3 below: Table 3

[0061] SEQ ID NO: 11: AGCAATATCAGCACCAACAGAAACAACC 4. Prepare the single-stranded control system for the fluorescence quenching experiment according to Table 4 below: Table 4

[0062] 5. Add the above experimental system to a 96-well plate. For the experimental system of the G4-1 sequence, add 50 μL to six wells respectively. Before the reaction, add 10 μL of 0.75 μM Dda solution to three of the wells, and add 10 μL of 0.5× buffer S to the other three wells as a control reaction without helicase. Then add 50 μL of the single-stranded DNA of SEQ ID NO.1 to the three wells respectively as a control reaction. Before the reaction, add 10 μL of 0.75 μM Dda solution to these three wells respectively.

[0063] For the experimental systems of G4-1 / G4-1_neg / G4-2 / G4-2_neg / ds-1 / ds-2 / ds-2_neg, refer to the G4-1 sequence for input.

[0064] 6. After adding Dda helicase, use a microplate reader (TECAN, SPARK) to detect the fluorescence recovery of the experimental system in each well within 2 h, and analyze the inhibition efficiency of different sequences on the helicase according to the experimental results as Figure 3 , compared with the negative control sequences G4-1_neg / G4-2_neg / ds-2_neg that do not contain non-B-form structure sequences, the sequences G4-1 / G4-2 / ds-1 / ds-2 that can form G4 quadruplex or i-motif structures have a higher inhibition rate on the helicase and can hinder the helicase from unwinding the nucleic acid double strand.

[0065] Example 4 Preparation of Adapter DNA In this example, adapter DNA with a non-B-form DNA structure was prepared by annealing two chemically synthesized nucleotide chains with complementary fragments.

[0066] 1. Order the nucleotide chains in Table 5 from Sangon Biotech, and dissolve the solid primers into a stock solution with a final concentration of 100 μM using nuclease-free water according to the manufacturer's instructions.

[0067] Table 5

[0068] 2. 5 μL of the stock solution of the Top strand primer and 5 μL of the stock solution of the Bottom strand primer were respectively taken and added to 40 μL of Anneal buffer (70 mM KCl, 20 mM KH2PO4, pH = 7.0), mixed together, and thoroughly mixed using a vortex oscillator. The primer mixture was annealed using a thermal cycler to obtain adaptors a1-Adp / a2-Adp / a3-Adp / a4-Adp / neg-Adp.

[0069] Example 5 Preparation of the DNA to be tested In this example, the Lambda phage genome was amplified to obtain amplicons as the DNA to be tested.

[0070] In this example, a sequence of approximately 500 bp in the Lambda phage genome was amplified by polymerase chain reaction (PCR) and used as the insertion fragment substrate (i.e., the target nucleotide to be tested) for the subsequent ligation reaction. The specific process is as follows: 1. The sequences shown in SEQ ID NO: 18 and SEQ ID NO: 19 were ordered from Sangon Biotech. According to the manufacturer's instructions, the SEQ ID NO: 18 primer (Primer #1) and the SEQ ID NO: 19 primer (Primer #2) were dissolved in TE buffer (pH = 8) to a stock solution with a final concentration of 100 μM. Subsequently, 10 μL of the stock solution was respectively taken and diluted with 90 μL of TE buffer (pH = 8) to a working solution with a final concentration of 10 μM.

[0071] SEQ ID NO: 18: 5’-GCCATCAGATTGTGTTTGTTAGT-3’ SEQ ID NO: 19: 5’-AAGCTTCGAGTCAGTACCGATGT-3’ 2. Using the Lambda phage genomic DNA (NEB, N3011L) as a template, a PCR reaction was carried out. The PCR mixture was prepared on ice according to the formula shown in Table 6.

[0072] Table 6: Formulation of the PCR mixture

[0073] After the PCR mixture was thoroughly mixed, it was placed in a PCR instrument and the program shown in Table 7 was run.

[0074] Table 7: PCR program

[0075] 3. Take out the Ampure XP magnetic beads (Beckman Coulter, A63882) from the refrigerator in advance. After shaking well, place them at room temperature for half an hour to equilibrate. Add 100 μL of the equilibrated magnetic beads into the above PCR system, shake well, briefly centrifuge, and then let it stand at room temperature for 10 minutes.

[0076] 4. Place the centrifuge tube on the magnetic stand for 10 minutes. After the magnetic beads are completely adsorbed to the side of the magnetic stand and the solution becomes completely clear, carefully remove the supernatant.

[0077] 5. Resuspend the magnetic beads with 200 μL of 80% ethanol solution and pipette to wash. Place the centrifuge tube on the magnetic stand for 10 minutes. After the magnetic beads are completely adsorbed to the side of the magnetic stand and the solution becomes completely clear, carefully remove the supernatant.

[0078] 6. Repeat the above ethanol solution washing step once. After removing the supernatant, place the centrifuge tube on the magnetic stand and let it stand. After the surface of the magnetic beads becomes dry, add 100 μL of TE buffer (pH = 8) to resuspend the magnetic beads, and let it stand at room temperature for 10 minutes.

[0079] 7. Place the centrifuge tube on the magnetic stand. After all the magnetic beads are adsorbed to the side of the magnetic stand, transfer the supernatant to a new centrifuge tube. Thus, the amplified inserted fragment sequence SEQ ID NO: 20 is obtained.

[0080] SEQ ID NO: 20: GCCATCAGATTGTGTTTGTTAGTCGCTTTTTTTTTTTGGAATTTTTTTTTTGGAATTTTTTTTTTGCGCTAACAACCTCCTGCCGTTTTGCCCGTGCATATCGGTCACGAACAAATCTGATTACTAAACACAGTAGCCTGGATTTGTTCTATCAGTAATCGACCTTATTCCTAATTAAATAGAGCAAATCCCCTTATTGGGGGTAAGACATGAAGATGCCAGAAAAACATGACCTGTTGGCCGCCATTCTCGCGGCAAAGGAACAAGGCATCGGGGCAATCCTTGCGTTTGCAATGGCGTACCTTCGCGGCAGATATAATGGCGGTGCGTTTACAAAAACAGTAATCGACGCAACGATGTGCGCCATTATCGCCTAGTTCATTCGTGACCTTCTCGACTTCGCCGGACTAAGTAGCAATCTCGCTTATATAACGAGCGTGTTTATCGGCTACATCGGTACTGACTCGAAGCTT Example 6 Library Ligation and Nanopore Sequencing In this example, a nanopore detection platform based on the patch clamp platform was constructed to perform nanopore sequencing on the target sequencing library prepared in Example 5, so as to verify that the linker constructed in this application can restrict motor proteins and be passed through by motor proteins under the action of sequencing voltage, achieving the purpose of sequencing the sequencing library in the nanopore.

[0081] 1. Use a library preparation kit (Hangzhou BGI Xufeng Technology Co., Ltd.) to perform end repair, 5'-phosphorylation and 3'-adenylation on Lambda0.5k in Example 5. The total volume of the reaction system is 60 μL, including: 6 μL of end repair enzyme 1 buffer, 3 μL of end repair enzyme 1, 3 μL of end repair enzyme 2 buffer, 4 μL of end repair enzyme 2, 1 μg of the DCS500 fragment (SEQ ID NO: 20) obtained in Example 5, and nuclease-free water was added to make up to 60 μL. The reaction solution was prepared on ice, thoroughly vortexed and then placed on a thermal cycler and incubated at 20°C for 10 minutes and at 65°C for 10 minutes. The reaction product was purified using 1× volume magnetic beads and quantified using the Qubit DNA HS kit (Yeasen Biotechnology).

[0082] 2. Ligate the end-repaired DNA to be tested and the adapters obtained in Example 4 respectively. The total volume of the ligation reaction system is 100 μL, including: 60 μL of the end-repaired DNA to be tested in Example 5 (1 μg), 25 μL of 4× ligation buffer (library preparation kit), 10 μL of T4 DNA ligase (library preparation kit), adapter a1-Adp / a2-Adp / a3-Adp / a4-Adp / neg-Adp (Example 4), and nuclease-free water is added to make up to 100 μL. After mixing well and centrifuging, place it in a 25°C constant-temperature metal bath and react for 30 min. The product is purified with 1× volume of magnetic beads and quantified with the Qubit DNA HS kit to obtain the ligated library.

[0083] 3. Helicase Dda binding and cross-linking. Introduce helicase Dda to the adapter-ligated library to be tested obtained in Step 2, and prepare the following reaction system: 200 ng of the library obtained in Step 2 is made up to 10 μL with water, 25 μL of binding buffer (HEPES-Na 50 mM, KCl 100 mM, EDTA 1 mM, MgCl2 5 mM), 5 μL of 1 μM helicase Dda, and 10 μL of NF water. After mixing the reaction system, use a PCR instrument to incubate at 25°C for 60 min. After incubation, add 1 μL of 1 mM TMAD.

[0084] 4. Use a nanopore detection platform to perform nanopore sequencing on the target sequencing library prepared in the example. There is no structure of the sequencing switch in the neg-Adp adapter. Before the library enters the nanopore, the motor protein unwinds the library and falls off, so the nucleic acid single strand cannot generate a sequencing signal when passing through the nanopore instantaneously under the action of the electric field force. The instantaneous perforation signal is as shown in Figure 4 A in. The non-B-form structures in the a1-Adp, a2-Adp, a3-Adp, and a4-Adp adapters can achieve the effect of restricting helicase Dda, so that the nucleic acid single strand can pass through the nanopore at a stable speed under the action of the electric field force, as shown in Figure 4 B-E in. The current signal for sequencing is collected. The characteristic signal of poly dT or polydA of the sequence to be sequenced SEQ ID NO: 20 is present in the current signal measured for each new adapter.

[0085] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "examples", "specific examples", "some implementation manners" or "some examples", etc. means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0086] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A sequencing adapter, which is used for nanopore sequencing, wherein, Comprising a first single strand, the first single strand comprising: A first segment, a single-stranded nucleotide region for guiding a nucleic acid to be tested into a nanopore; A second segment, a single-stranded nucleotide region for binding to a motor protein; A third segment, a single-stranded nucleotide region for preventing the motor protein from exercising the function of unwinding nucleic acid in a non-sequencing state; A fourth segment, for linking an analyte to be tested; Wherein, the third segment contains a G-rich region and / or a C-rich region; The G-rich region forms a G-quadruplex structure; The C-rich region forms an i-Motif structure.

2. The sequencing adapter according to claim 1, wherein, The sequencing adaptor contains at least 10 - 30 consecutive bases T.

3. The sequencing adaptor according to claim 1, wherein The nucleic acid sequence of the third segment is shown as any one of SEQ ID NO:22 - 25.

4. The sequencing adapter according to claim 1, wherein, The sequencing adaptor further comprises a second single strand, the second single strand comprising a ligation segment for ligating an analyte to be tested, which is complementary to the fourth segment of the first single strand.

5. Use of the sequencing adaptor according to any one of claims 1 - 4 in the preparation of a kit for nanopore sequencing.

6. A kit for nanopore sequencing, wherein, Comprising the sequencing adaptor according to any one of claims 1 - 4, and further comprising a polynucleotide-binding protein; the polynucleotide-binding protein is selected from at least one of polymerase, helicase or exonuclease.

7. A construct, wherein, Comprising a nucleic acid to be sequenced and the sequencing adaptor according to any one of claims 1 - 4, wherein the sequencing adaptor is ligated to one or both ends of the nucleic acid to be sequenced.

8. A complex for sequencing, wherein, Comprising a polynucleotide-binding protein, and The sequencing adaptor according to any one of claims 1 - 4 or the construct according to claim 7; The polynucleotide-binding protein is selected from at least one of polymerase, helicase or exonuclease.

9. A method for constructing a sequencing complex, wherein, The method comprises: (1) Constructing the sequencing adaptor according to any one of claims 1 - 4; (2) Assembling the sequencing adaptor with a nucleic acid to be sequenced to form a construct; (3) Contacting the construct with a polynucleotide-binding protein to obtain a sequencing complex; The polynucleotide-binding protein is selected from at least one of polymerase, helicase or exonuclease.

10. Use of the sequencing adaptor according to any one of claims 1 - 4, the construct according to claim 7, and the complex for sequencing according to claim 8 in nanopore sequencing.

11. A nanopore sequencing method, wherein, Comprising performing nanopore sequencing on a nucleic acid to be sequenced by using at least one of the sequencing adaptor according to any one of claims 1 - 4, the kit according to claim 6, the construct according to claim 7, and the complex for sequencing according to claim 8.

Citation Information

Patent Citations

  • Sequences, linkers comprising sequences and uses thereof

    CN114854826A

  • Design and application of sequencing joint for nanopore sequencing

    CN115747211A

  • Method of characterizing polynucleotides moving through nanopores

    CN115968410A

  • Sequencing linker, sequencing linker compound and method for multiple nanopore sequencing of target nucleic acid sequence

    CN120265789A

  • Systems and methods for nanopore-based analyte detection

    GB202313202D0