SWEET15A01 gene promoter and application of Indel variation of SWEET15A01 gene promoter in improvement of cottonseed oil content
By regulating cottonseed oil components by using the SWEET15_A01 gene promoter Indel variant in cotton, the competition problem between cottonseed oil components and fiber yield was solved, and the oil components of cottonseed oil components were significantly improved, providing efficient cottonseed oil components and germplasm screening methods.
Patent Information
- Application Number
- CN202510598503.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-07-25
AI Technical Summary
There are few researches on the genetic improvement of cottonseed oil components in the prior art. There is a competition and distribution relationship between the oil content of cottonseed and the clothing components in cotton germplasm, and it is difficult to significantly improve cottonseed oil components through gene regulation without affecting fiber yield and quality.
It was discovered and confirmed that the SWEET15_A01 gene promoter had a 21bp Indel variant between upland cotton E22 and sea cotton 3-79. The deleted variant island cotton 3-79 promoter drove the expression of the SWEET15_A01 gene, and improved the cottonseed oil content by regulating its expression level in the late stage of ovule development, and developed corresponding molecular markers for screening and cultivating high-oil cotton germplasm.
It significantly improves the oil content of cotton seeds and has no adverse impact on fiber yield and quality, providing efficient cottonseed oil-based oil-based germplasm screening methods.
Smart Images

Figure CN120366310A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular marker-assisted breeding and gene breeding, and particularly relates to the application of the SWEET15_A01 gene promoter and its Indel variation in improving cottonseed oil content, as well as the development of molecular markers based on this variation and the method for screening high-oil cotton germplasm. Background Art
[0002] Cottonseed is an important by-product of cotton. Cottonseed is rich in oil, protein, vitamin E, etc., and also has important application values in the fields of food, feed and industry. The cottonseed oil is rich in unsaturated fatty acids beneficial to the human body. The full development and utilization of cottonseed oil is expected to relieve the supply pressure of the oil market in China. At present, more research focuses on the improvement of cotton fiber, and relatively less research focuses on the genetic improvement of cottonseed oil content.
[0003] Cotton lint percentage refers to the ratio of the weight of fiber on seed cotton to the weight of seed cotton, which is one of the important economic indexes for evaluating the quality of cotton varieties, and also an important index for measuring cotton quality and processing production. Cottonseed oil content refers to the proportion of oil in cottonseed. Cottonseed is not only an important source of protein, but also its oil has high economic value. Cottonseed oil is rich in components such as protein, oil, vitamin E, etc., and has functions such as antioxidation and anti-aging, and can be processed into high-quality edible oil and pollution-free biodiesel. By measuring and analyzing the lint percentage and cottonseed oil content of different cotton varieties, it is found that varieties with higher lint percentage often have lower cottonseed oil content, while varieties with lower lint percentage have relatively higher cottonseed oil content. This relationship may be because during the growth process of cotton, there is a certain competition and distribution relationship between resources in fiber and cottonseed oil synthesis.
[0004] The SWEET (sugars will eventually be exported transporters) gene family is a newly discovered class of sugar transporters, which play key roles in various physiological processes of plants, including the transport and distribution of photosynthetic products, seed formation and development, oil accumulation, pollen vitality maintenance, pathogen interaction, and response to stress. At present, there is no report on the functional variation and application of the SWEET15_A01 gene promoter in regulating cottonseed oil content. Summary of the Invention
[0005] In view of the above problems, the object of the present invention is to provide the SWEET15_A01 gene promoter related to cotton oil content, its molecular marker and application. The main content is to discover and confirm that there is a 21bp Indel variation in the promoter region of the SWEET15_A01 gene between upland cotton E22 and sea-island cotton 3-79: in E22, there is an insertion sequence (GGCCAAAATTACATTTTTTCT) at this site, and in 3-79, this site is a deletion (G-). This variation is significantly correlated with cotton oil content. In low-oil cotton germplasms, this site is an insertion-type variation, and in high-oil cotton germplasms, this site is a deletion-type variation. This Indel variation affects cotton oil content accumulation by regulating the expression level of the SWEET15_A01 gene in the late stage of ovule development. Using the transgenic cotton material with the promoter of sea-island cotton 3-79 containing the deletion-type variation to drive the expression of the SWEET15_A01 gene, the seed oil content is significantly increased, and there is no adverse effect on fiber yield and quality. The present invention can be used to screen and cultivate new cotton high-oil germplasms for production application.
[0006] The present invention provides the SWEET15_A01 gene promoter, and the sequence of the promoter is shown in SEQ ID NO.2, and this promoter can induce the high expression of the SWEET15_A01 gene.
[0007] The present invention also provides the SWEET15_A01 gene with natural high expression, the gene contains the above promoter sequence, and then reaches the high expression effect induced by the promoter, and the sequence of this gene is shown in SEQ ID NO.5.
[0008] The present invention also provides the application of the above promoter and / or the SWEET15_A01 gene with natural high expression in any of the following:
[0009] A1) Improvement of cotton oil content;
[0010] A2) Preparation of cotton oil content improvement products;
[0011] A3) Increase of cottonseed oil content in cotton;
[0012] A4) Preparation of products for increasing cottonseed oil content in cotton;
[0013] A5) Cultivation of cotton high-oil germplasms;
[0014] A6) Preparation of products for cultivating cotton high-oil germplasms.
[0015] The present invention also provides a method for improving cottonseed oil content and / or cultivating cotton germplasm with high oil content, which induces the high expression of the SWEET15_A01 gene in cotton plants through the above promoter, or introduces the above naturally highly expressed SWEET15_A01 gene into cotton materials for expression.
[0016] Furthermore, construct an overexpression vector of the SWEET15_A01 gene induced by the above promoter, or construct an overexpression vector containing the above naturally highly expressed SWEET15_A01 gene, and introduce the overexpression vector into cotton materials to obtain cotton germplasm with high oil content.
[0017] The present invention also provides an Indel molecular marker for distinguishing Gossypium barbadense from Gossypium hirsutum and / or identifying the high or low cottonseed oil content of cotton. The Indel molecular marker has a variation at the 670th position of the sequence shown in SEQ ID NO.1. Among them, in Gossypium hirsutum or cotton germplasm with low oil content, the nucleotide sequence of the Indel molecular marker is the insertion type GGCCAAAATTACATTTTTTCT, and in Gossypium barbadense or cotton germplasm with high oil content, the nucleotide sequence of the Indel molecular marker is the deletion type G-.
[0018] The present invention also provides a method for distinguishing Gossypium barbadense from Gossypium hirsutum and / or identifying the high or low cottonseed oil content of cotton. Detect the above Indel molecular marker, and divide the cotton population into an insertion haplotype Indel_I and a deletion haplotype Indel_D according to the detection results. Among them, Indel_I is Gossypium hirsutum germplasm, and Indel_D is Gossypium barbadense germplasm; the lint percentage of Indel_I is significantly higher than that of Indel_D, and the seed oil content and seed index of Indel_D are significantly higher than those of Indel_I.
[0019] Furthermore, use the primers pSWEET15_A01-InDel-F / R to detect the Indel molecular marker, where pSWEET15_A01-InDel-F: GTGTTTAAAAGGATTAAATTGCATTAT (SEQ ID NO.6); pSWEET15_A01-InDel-R: GATAGTGTCGAAGTTAGAGTTAGGC (SEQ ID NO.7).
[0020] The present invention also provides the application of the above-mentioned Indel molecular marker in distinguishing Gossypium barbadense from Gossypium hirsutum and / or identifying the high or low oil content of cottonseed oil. According to the detection results of the Indel molecular marker, the cotton population is divided into an insertion haplotype Indel_I and a deletion haplotype Indel_D, where Indel_I is a Gossypium hirsutum germplasm, and Indel_D is a Gossypium barbadense germplasm; the lint percentage of Indel_I is significantly higher than that of Indel_D, and the seed oil content and seed index of Indel_D are significantly higher than those of Indel_I.
[0021] Further, primers pSWEET15_A01-InDel-F / R are used to detect the Indel molecular marker, where pSWEET15_A01-InDel-F: GTGTTTAAAAGGATTAAATTGCATTAT (SEQ ID NO.6); pSWEET15_A01-InDel-R: GATAGTGTCGAAGTTAGAGTTAGGC (SEQ ID NO.7).
[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention discovers and confirms that there is a 21bp Indel variation in the promoter region of the SWEET15_A01 gene between Gossypium hirsutum E22 and Gossypium barbadense 3-79: in E22, there is an insertion sequence (GGCCAAAATTACATTTTTTCT) at this site, and in 3-79, this site is a deletion (G-). This variation is significantly correlated with the cottonseed oil content. In cotton germplasms with low oil content, this site is an insertion-type variation, and in cotton germplasms with high oil content, this site is a deletion-type variation. This Indel variation affects the accumulation of cottonseed oil by regulating the expression level of the SWEET15_A01 gene in the late stage of ovule development. Using the transgenic cotton material with the promoter of Gossypium barbadense 3-79 containing the deletion-type variation to drive the expression of the SWEET15_A01 gene, the seed oil content is significantly increased, and there is no adverse effect on fiber yield and quality, which is of great significance for improving cottonseed oil content and screening and cultivating new cotton germplasms with high oil content for production applications. Description of the Drawings
[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for use in the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.
[0024] Figure 1DNA sequences and expression levels of SWEET15_A01 in upland cotton E22 and sea-island cotton 3-79. Figure A shows a comparative analysis of the DNA sequence of SWEET15_A01 in upland cotton E22 and sea-island cotton 3-79. Figure B shows the expression analysis of SWEET15_A01 in various tissues of upland cotton E22. Figure C shows the RT-qPCR analysis of SWEET15_A01 during different stages of fiber and ovule development in E22 and 3-79. Error bars represent the standard deviation of three technical replicates. **p < 0.01, ***p < 0.001, t-test.
[0025] Figure 2 Promoter activity of SWEET15_A01. Figure A shows a schematic diagram of the construction of the Dual-LUC vector. Figure B shows the Dual-LUC activity analysis in cotton protoplasts. Three biological replicates, **p < 0.01, ***p < 0.001, t-test. Figure C shows the LUC activity analysis in tobacco leaves. P3-79 represents the promoter of SWEET15_A01 of genotype 3-79, PV1-PV8 are promoters of SWEET15_A01 of different genotypes, and PE22 represents the promoter of SWEET15_A01 of genotype E22. Promoters of different genotypes drive the expression of LUC, and the fluorescence intensity of LUC is detected in cotton protoplasts and tobacco leaves. Figure D shows the expression level of SWEET15_A01 in 25DPA ovules of upland-sea cotton germplasms. Orange bars represent upland cotton germplasms, and blue bars represent sea-island cotton germplasms.
[0026] Figure 3 Haplotype analysis of SWEET15_A01. Figure A shows that eight variations in the gene sequence of SWEET15_A01 divide the upland-sea population into three haplotypes, Hap1-Hap3. Figure B shows a comparative analysis of the distribution and lint percentage of the three haplotypes in the sea-island cotton and upland cotton populations. Figure C shows a comparative analysis of the distribution and lint percentage of the haplotypes divided by the 21bp Indel in the sea-island cotton and upland cotton populations. Figure D shows a comparative analysis of the agronomic traits of the haplotypes divided by the 21bp Indel in a population of 100 upland cotton and 95 sea-island cotton germplasms. Seed oil content: seed oil content; Lint percentage: lint percentage; Seed index: seed index. The lines in the box plot represent the minimum value, the first quartile, the median, the third quartile, and the maximum value, t-test.
[0027] Figure 4Genotyping of the 21bp Indel molecular marker in Gossypium barbadense and Gossypium hirsutum populations. Figure A shows the genotyping results of the molecular marker in 20 Gossypium barbadense and 20 Gossypium hirsutum germplasms. 1 - 20 are the genotyping results of Gossypium barbadense germplasms, and 21 - 40 are the genotyping results of Gossypium hirsutum germplasms. Figure B shows the genotyping results of the molecular marker in 95 Gossypium barbadense and 500 Gossypium hirsutum germplasms.
[0028] Figure 5 For proSWEET15_A01 3-79 ::Phenotypic investigation of SWEET15_A01 transgenic materials. Figure A shows the relative expression levels of SWEET15_A01 in fibers and ovules at 10 DPA, 15 DPA, and 20 DPA in transgenic positive lines, and the detection method is RT-qPCR. Figure B shows the cottonseed oil content. Figure C shows the cottonseed protein content. Figure D shows the lint percentage. WT is Jin668, CK is the negative control, and 379-ProSW-1 and 379-ProSW-2 are proSWEET15_A01 3-79 ::SWEET15_A01 overexpression materials. Three biological replicates, *p < 0.05, **p < 0.01, ***p < 0.001, ns indicates no significant difference, t-test. Detailed implementation methods
[0029] The following examples are only used to more clearly illustrate the technical solutions of the present invention. Therefore, they are only examples and cannot be used to limit the protection scope of the present invention. It should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should have the common meaning understood by those skilled in the art to which the present invention belongs. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0030] Example 1 Cloning and expression analysis of the SWEET15_A01 gene
[0031] 1. Planting of plant materials
[0032] Gossypium hirsutum E22 and Gossypium barbadense 3 - 79 were planted in the experimental field of Huazhong Agricultural University in Wuhan. Tags were hung on the day of flowering (0 DPA), and cotton fibers and ovules were harvested at specific developmental stages, immediately frozen in liquid nitrogen, and stored at -80 °C for later use. Nicotiana benthamiana was planted in the greenhouse (25 °C / 16 h / light, 20 °C / 8 h / dark); the T0 generation of transgenic materials was planted in the greenhouse (28 °C / 16 h / light, 20 °C / 8 h / dark), and the transgenic and transgenic receptor material Jin668 of the T1 generation was planted in Wuhan in 2024 for investigating seed and fiber-related agronomic traits.
[0033] 2. Cloning of SWEET15_A01 Gene
[0034] Specific primers proSWEET15_A01-F / R were designed for the upstream region of approximately 2000 bp of the SWEET15_A01 gene of Gossypium hirsutum reference genome TM-1 and Gossypium barbadense reference genome 3-79 downloaded from the CottonFGD database, and specific primers SWEET15_A01-F / R were designed for the coding region sequence (Table 3). Using the leaf DNA of Gossypium hirsutum E22 and Gossypium barbadense 3-79 as templates, PCR amplification and TA cloning of the promoter of SWEET15_A01 were carried out, and using the 25DPA ovule cDNA as a template, PCR amplification and TA cloning of the coding region of SWEET15_A01 were carried out to obtain the true sequences of the promoter (proSWEET15_A01) and coding region (CDS-SWEET15_A01) of SWEET15_A01 in Gossypium hirsutum E22 and Gossypium barbadense 3-79: SEQ ID NO.1 (proSWEET15_A01 E22 ), SEQ ID NO.2 (proSWEET15_A01 3-79 ), SEQ ID NO.3 (CDS-SWEET15_A01 E22 ) and SEQ ID NO.4 (CDS-SWEET15_A01 3-79 ). The sequence alignment results showed that there were 8 variations in the promoter region of the SWEET15_A01 gene in E22 and 3-79, including 7 single nucleotide polymorphisms (SNPs) and 1 insertion-deletion (Indel), and there were no variations in the coding region ( Figure 1 A).
[0035] DNA was extracted by the CTAB method, and the specific steps are as follows:
[0036] Select around 10 am on a sunny day. Take about 0.1 g of fresh and tender leaves and place them in a 2 mL centrifuge tube in an ice box. After arranging them on ice, add steel beads and 200 μL of DNA extraction buffer one by one, and grind with a grinding machine for 60 s at a frequency of 60 Hz; adjust the water bath to 65 °C; add 600 μL of DNA extraction lysate and shake well; incubate in a 65 °C water bath for 30 min, gently invert the tube up and down several times every 10 min. Avoid violent shaking during this and subsequent steps; add an equal volume of chloroform:isopropanol (volume ratio 24:1), gently shake and extract for 20 min to remove impurities such as pigments, centrifuge at 10000 r / min for 10 min at room temperature. Since there are steel beads, the centrifugation speed should not be too high; pipette 500 μL of the supernatant into a new tube, add an equal volume of isopropanol and mix well. At this time, a white flocculent precipitate is the crude DNA extract; pour out the supernatant, wash the flocculent precipitate twice with 75% alcohol and then air-dry, and dissolve it with 500 μL of TE Buffer for standby.
[0037] For RNA extraction, the Tiangen Total RNA Extraction Kit (Tiangen Biochemical Technology, DP411) was used and the operation was carried out according to the product instruction manual.
[0038] The reverse transcription steps of RNA are as follows: Take 3 μg of RNA in a new 0.5 mL RNA centrifuge tube, add 1 μL of oligo(dT), and then supplement DEPC water to 15 μL, mix well. Incubate in a reverse transcription instrument at 70 °C for 5 min and place on ice for 10 min. Then add the following reaction mixture (10 μL) in proportion: 5 μL of 5×MLV Buffer, 1.25 μL of 10 mmol / L dNTPs, 1 μL of Rnasin (40 U), 1 μL of M-MLV RTase (200 U), and make up to 25 μL with RNase free H2O. After mixing, place it in a reverse transcription instrument, and the program is as follows: 42 °C for 60 min, 70 °C for 15 min. After reverse transcription is completed, dilute the cDNA to 250 μL and store it at -20 °C for standby.
[0039] The PCR amplification kit used is Phanta Max Super-Fidelity DNA Polymerase (Vazyme, P505). The 25 μL reaction system is as follows: 13.5 μL of Mix, 1 μL of template, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and make up to 25 μL with sterile water. Among them, the concentration of genomic DNA is 30 - 40 ng / μL, and the cDNA is a 100-fold dilution of the original solution.
[0040] The PCR amplification program is as follows: Pre-denature at 95 °C for 5 min; denature at 95 °C for 30 s, anneal at 57 °C for 30 s, extend at 69 - 72 °C for 1 min, cycle 34 times; extend at 72 °C for 5 min.
[0041] 3. SWEET15_A01 Expression Analysis
[0042] The tissue expression pattern of SWEET15_A01 in upland cotton E22 and its expression levels during the fiber and ovule development stages of upland cotton E22 and sea-island cotton 3-79 were analyzed by RT-qPCR. The analysis of the tissue expression pattern in upland cotton E22 showed that SWEET15_A01 was expressed to a certain extent in petals, anthers, stigmas, and 25 DPA fibers, and was predominantly expressed in the late stage of ovule development (25-35 DPA) ( Figure 1 B). The detection results of the expression levels of the SWEET15_A01 gene during the fiber and ovule development stages of E22 and 3-79 showed that during each fiber development stage, almost no expression of the SWEET15_A01 gene was detected in either sea-island cotton 3-79 or upland cotton E22, and only a low expression level was detected in the 25 DPA fibers of E22; while in the ovules at 25 DPA, 30 DPA, and 35 DPA, the SWEET15_A01 gene had a relatively high expression level, and the expression level in the ovules of 3-79 was significantly higher than that of E22 ( Figure 1 C), indicating that the SWEET15_A01 gene plays a role in the late stage of cottonseed development.
[0043] The reaction system for RT-qPCR was as follows: 8 μL of cDNA template (diluted 100-fold from the original solution), 6 μL of SybrGreen-mix (from BIO-RAD), 0.5 μL of forward primer, 0.5 μL of reverse primer. The prepared reaction system was centrifuged briefly to ensure that the mixture was at the bottom of the PCR plate. It was placed in a real-time fluorescence quantitative PCR instrument (ABI Prism 7500 system), and the running program was as follows: Stage1: 95 °C for 30 s, 1 cycle; Stage2: 95 °C for 5 s, 60 °C for 35 s, 40 cycles. After the program ended, using the cotton endogenous gene GhUBQ7 (Ghir_A11G011460) as the internal reference gene, the relative expression level of the gene was calculated using the 2 -ΔΔCT method.
[0044] 4. Detection of SWEET15_A01 Promoter Activity
[0045] In E22 and 3-79, since SWEET15_A01 only differed in the promoter region and there were significant differences in expression levels, it was speculated that the variation in the promoter was the main reason for the differential expression of this gene in sea-island cotton and upland cotton.
[0046] For the variant sites in 8 promoter regions, the variant type of E22 was introduced into the promoter sequences of the 3-79 genotype. The primers used were PSWv1-PSWv8-F / R in Table 3, which were respectively constructed into the pGreenⅡ0800-LUC vector and transformed into the Agrobacterium strain GV3101. The restriction enzyme sites selected were PstⅠ and BamHⅠ. The schematic diagram of vector construction is shown in Figure 2 A. Eight genotypes PV1-PV8, and the 3-79 and E22 genotypes P3-79 and PE22 were obtained and transformed into cotton protoplasts. The LUC / REN results corresponding to these genotypes are as Figure 2 shown in B. The results indicate that, except for PV6, the LUC / REN values of the remaining genotypes are significantly lower than that of the 3-79 genotype P3-79, indicating that the variant at PV6 does not cause differences in promoter activity, while the variants at the other sites can cause changes in promoter activity. The LUC analysis in tobacco leaves obtained results consistent with those in Figure 2 B ( Figure 2 C). The above results show that the promoter variants (except for the 6th variant) lead to differences in the promoter activities of the SWEET15_A01 gene in upland cotton E22 and sea island cotton 3-79.
[0047] To explore whether promoter variants affect gene expression, 10 upland cotton and 10 sea island cotton germplasms were selected and planted in the Wuhan experimental base. Tags were attached for sampling at the full flowering stage, and the expression levels of the SWEET15_A01 gene in 25DPA ovules were analyzed by RT-qPCR. The gene expression level in sea island cotton was higher than that in upland cotton ( Figure 2 D), indicating that promoter variants can affect the expression of this gene in ovules.
[0048] The information of 10 upland cotton and 10 sea island cotton germplasms is as follows:
[0049] Table 1
[0050]
[0051] 5, proSWEET15_A01 3-79 ::Phenotypic identification of SWEET15_A01 transgenic plants
[0052] (1) Construction of the proSWEET15_A01 3-79 ::SWEET15_A01 overexpression vector:
[0053] Using upland cotton Jin668 (WT) as the receptor, transgenic materials with the 3-79 genotype promoter driving the expression of the SWEET15_A01 gene were created, proSWEET15_A01 3-79::SWEET15_A01. The vector construction process is as follows:
[0054] Design specific primers for the coding region of the SWEET15_A01 gene with BP adapters. The primer information is BP-SWEET15_A01-F / R in Table 3. Use the cDNA of 25DPA ovules at 3 - 79 as a template for PCR amplification.
[0055] The PCR reaction system is 20 μL: 10 μL cDNA template, 7 μL ddH2O, 2 μL 10×LongTaq Buffer, 0.4 μL dNTP, 0.2 μL Forward / Reverse Primer, 0.2 μL LongTaq.
[0056] The PCR reaction program is: 95°C for 5 min; 95°C for 30 s, 57°C for 90 s, 72°C for 60 s, for 32 cycles; 72°C for 5 min. After PCR amplification, the correct SWEET15_A01 coding region fragment containing the BP adapter is obtained, and then the BP ligation reaction is carried out.
[0057] The BP ligation reaction system is 5 μL: 1.5 μL ddH2O, 1 μL pDONERZeo (Zeo + )), 2 μL PCR product, 0.5 μL Gateway BP Clonase (Invitrogen, USA). The reaction condition is to place at 25°C for 4 h, transform into Escherichia coli strain Top10, and spread on the LB plate with Zeo + . Through monoclonal positive detection and sequencing, the positive detection primers are the M13 forward primer 5’CCCAGTCACGACGTTGTAAAACG 3’ and the reverse primer BP-SWEET15_A01-R. The positive strain is sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. After obtaining the correct BP plasmid, the LR ligation reaction is carried out.
[0058] The LR reaction system is 5 μL: 2.5 μL ddH2O, 1 μL pGWB417 (Spe + ), 1 μL BP plasmid, 0.5 μL GatewayLR Clonase. The reaction condition is to place at 25°C for 4 h, transform into Escherichia coli strain Top10, and spread on the LB plate with Spe + . The pGWB417-SWEET15_A01 recombinant plasmid is obtained.
[0059] Specific primers with Sbf and XbaⅠ restriction site linkers were designed for the SWEET15_A01 promoter. The primer information is ProSW-F / R in Table 3. Using the leaf DNA of 3-79 as a template, PCR amplification was performed to obtain the proSWEET15_A01 3-79 fragment; at the same time, the pGWB417-SWEET15_A01 recombinant plasmid was digested with Sbf and XbaⅠ to obtain a linearized plasmid; the amplified PCR fragment was ligated to the linearized pGWB417-SWEET15_A01 recombinant plasmid by Infusion method, and then transformed into the Escherichia coli strain Top10, and spread on the Spe + LB plate. Through monoclonal positive detection and sequencing, the positive detection primers were the forward primer BP-SWEET15_A01-F and the reverse primer M13-R 5’CAGGAAACAGCTATGACC 3’, and the positive plasmid proSWEET15_A01 3-79 -SWEET15_A01 was obtained.
[0060] The positive plasmid was transformed into the Agrobacterium strain GV3101 by electroporation, and spread on the Spe + and Rif + LB plate, and positive strains were detected and picked for cotton genetic transformation. The transformation method refers to (Jin Shuangxia, 2006).
[0061] (2) Analysis of the expression level of transgenic materials:
[0062] The expression level of the SWEET15_A01 gene was detected in the ovules and fiber development stages of the two obtained transgenic positive lines (379-ProSW-1 and 379-ProSW-2). Compared with the control WT, in the transgenic materials, the expression level of the SWEET15_A01 gene did not change significantly in the ovules and fibers at 10 DPA and 15 DPA, the expression level in the ovules at 20 DPA was extremely significantly increased, and there was a low expression in the fibers at 20 DPA ( Figure 5 A).
[0063] (3) Phenotypic investigation of transgenic materials:
[0064] Harvest the mature cotton bolls from the middle part of wild-type Jin668, transgenic negative control CK, and transgenic plants in the field. Harvest 3-4 biological replicates for each line. After ginning, weigh the cotton seeds and fibers to examine the lint percentage; examine the seed oil content and protein content of mature cotton seeds; use the HVI (High Volume Instrument) (HFT9000, Premier, India) instrument to measure the quality indexes of mature cotton fibers. The weight of the fiber sample for each replicate is 9.5-11 g. The fiber quality indexes include: fiber length, uniformity, micronaire value, fiber strength, elongation rate, and short fiber index. Investigation of the related traits of transgenic mature seeds shows that, compared with WT, the oil content of mature seeds in transgenic materials increases significantly ( Figure 5 B), the protein content decreases ( Figure 5 C), and the lint percentage does not change significantly ( Figure 5 D). There is no significant change in the related traits of mature fiber quality in transgenic materials (Table 2). The above results analysis shows that the transgenic materials overexpressing SWEET15_A01 using the promoter of Gossypium barbadense genotype can significantly increase the seed oil content without adverse effects on the fiber yield and related quality indexes.
[0065] Table 2 proSWEET15_A01 3-79 ::SWEET15_A01 transgenic material fiber quality
[0066]
[0067]
[0068] Example 2 Haplotype analysis of SWEET15_A01 and development of molecular markers
[0069] 1. Haplotype analysis of SWEET15_A01
[0070] To explore whether the variation of the promoter of SWEET15_A01 between Gossypium barbadense and Gossypium hirsutum will affect the cottonseed oil content, haplotype analysis was carried out using the sequencing data of publicly available Gossypium barbadense and Gossypium hirsutum germplasm resources. Given that the published Gossypium barbadense population lacks the cottonseed oil content phenotype data, and there is a significant negative correlation between oil content and lint percentage, haplotype analysis was first carried out using the lint percentage data.
[0071] The promoter variation sites can divide these germplasm resources into 3 haplotypes: Hap1 (3-79), which is consistent with the genotype of 3-79; Hap2, except that the 6th variation site is the genotype of E22, the variation types of other sites are the genotypes of 3-79; Hap3 (E22), which is consistent with the genotype of E22 ( Figure 3A). Haplotype statistics showed that all the germplasms of Hap1 and Hap2 were Gossypium barbadense, the germplasms of Hap3 were Gossypium hirsutum, and there was no difference in lint percentage between Hap1 and Hap2, indicating that this type of PV6 variation would not cause changes in lint percentage. This result was consistent with Figure 2 the result in B that the PV6 variation did not cause differences in promoter activity; the lint percentage of Hap1 and Hap2 was significantly lower than that of Hap3, indicating that the germplasms with the 3-79 genotype had a significantly lower lint percentage than those with the E22 genotype ( Figure 3 B). The 21bp Indel could divide the population into two haplotypes, the insertion haplotype Indel_I and the deletion haplotype Indel_D. All the germplasms of Indel_I were Gossypium hirsutum, all the germplasms of Indel_D were Gossypium barbadense, and the lint percentage of Indel_I was significantly higher than that of Indel_D ( Figure 3 C).
[0072] Ninety-five Gossypium barbadense germplasms were collected, and the seed oil content was measured using a near-infrared instrument. The results showed that the lint percentage of the Indel_I haplotype was significantly higher than that of Indel_D, but the seed oil content and seed index of the Indel_D haplotype were significantly higher than those of the Indel_I haplotype ( Figure 3 D). In summary, the variation of the promoter of SWEET15_A01 between Gossypium barbadense and Gossypium hirsutum, especially the 21bp Indel variation, was significantly associated with seed oil content and lint percentage. The 21bp deletion-type Indel variation led to a higher cottonseed oil content.
[0073] 2. Development of 21bp Indel molecular marker
[0074] Molecular markers were developed for the 21bp Indel, and the sequences of the molecular markers are shown as pSWEET15_A01-InDel-F / R in Table 3:
[0075] pSWEET15_A01-InDel-F GTGTTTAAAAGGATTAAATTGCATTAT(SEQ ID NO.6)
[0076] pSWEET15_A01-InDel-R GATAGTGTCGAAGTTAGAGTTAGGC(SEQ ID NO.7)
[0077] Genotyping was performed on 503 Gossypium hirsutum germplasms and 95 Gossypium barbadense germplasms using polyacrylamide gel electrophoresis. The genotyping results of this molecular marker in 20 Gossypium barbadense and 20 Gossypium hirsutum germplasms are shown in Figure 4 A, and the genotyping results of all germplasms are shown in Figure 4B. This molecular marker can effectively distinguish between the genotypes of upland cotton and sea-island cotton and can be directly used for molecular marker-assisted selection breeding.
[0078] Table 3 Primers used in the present invention
[0079]
[0080]
[0081] The above specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and the technical concept of the present invention, various simple modifications and changes can be made to the technical solutions of the present invention, and these simple variations all fall within the protection scope of the present invention.
Claims
1. The promoter of the SWEET15_A01 gene, characterized in that, The sequence of the promoter is shown in SEQ ID NO.2, and this promoter can induce the high expression of the SWEET15_A01 gene.
2. The naturally highly expressed SWEET15_A01 gene, characterized in that, The gene contains the promoter sequence described in claim 1, and thus achieves a high expression effect induced by the promoter. The sequence of this gene is shown in SEQ ID NO.
5.
3. Use of the promoter described in claim 1 and / or the gene described in claim 2 in any of the following: A1) Improvement of cottonseed oil content; A2) Preparation of products for improving cottonseed oil content; A3) Increasing the cottonseed oil content of cotton; A4) Preparation of products for increasing the cottonseed oil content of cotton; A5) Cultivation of cotton germplasm with high oil content; A6) Preparation of products for cultivating cotton germplasm with high oil content.
4. A method for improving cottonseed oil content and / or cultivating cotton germplasm with high oil content, characterized in that, Induce the high expression of the SWEET15_A01 gene in cotton by the promoter described in claim 1, or introduce the gene described in claim 2 into cotton materials for expression.
5. The method according to claim 4, characterized in that, Construct an overexpression vector of the SWEET15_A01 gene induced by the promoter of claim 1, or construct an overexpression vector containing the gene described in claim 2, and introduce the overexpression vector into cotton materials to obtain cotton germplasm with high oil content.
6. An Indel molecular marker for distinguishing Sea Island cotton from Upland cotton and / or identifying the high or low oil content of cottonseed oil, characterized in that, The Indel molecular marker has a variation at the 670th position of the sequence shown in SEQ ID NO.
1. Among upland cotton or cotton germplasm with low oil content, the nucleotide sequence of the Indel molecular marker is the insertion type GGCCAAAATTACATTTTTTCT, and among sea-island cotton or cotton germplasm with high oil content, the nucleotide sequence of the Indel molecular marker is the deletion type G-.
7. A method for distinguishing Gossypium barbadense from Gossypium hirsutum and / or identifying the high or low oil content of cottonseed oil of cotton, characterized in that, Detect the Indel molecular marker described in claim 6, and divide the cotton population into the insertion haplotype Indel_I and the deletion haplotype Indel_D according to the detection results. Among them, Indel_I is upland cotton germplasm, and Indel_D is sea-island cotton germplasm; the lint percentage of Indel_I is significantly higher than that of Indel_D, and the seed oil content and seed index of Indel_D are significantly higher than those of Indel_I.
8. The method according to claim 7, wherein Detect the Indel molecular marker using the primers pSWEET15_A01-InDel-F / R, where pSWEET15_A01-InDel-F: GTGTTTAAAAGGATTAAATTGCATTAT (SEQ ID NO.6); pSWEET15_A01-InDel-R: GATAGTGTCGAAGTTAGAGTTAGGC (SEQ ID NO.7).
9. Use of the Indel molecular marker according to claim 7 in differentiating Gossypium barbadense from Gossypium hirsutum and / or identifying high or low cottonseed oil content in cotton, characterized in that, Divide the cotton population into the insertion haplotype Indel_I and the deletion haplotype Indel_D according to the detection results of the Indel molecular marker described in claim 6. Among them, Indel_I is upland cotton germplasm, and Indel_D is sea-island cotton germplasm; the lint percentage of Indel_I is significantly higher than that of Indel_D, and the seed oil content and seed index of Indel_D are significantly higher than those of Indel_I.
10. The application according to claim 9, wherein Detect the indel molecular marker using the primers pSWEET15_A01-InDel-F / R, where pSWEET15_A01-InDel-F: GTGTTTAAAAGGATTAAATTGCATTAT (SEQ ID NO.6); pSWEET15_A01-InDel-R: GATAGTGTCGAAGTTAGAGTTAGGC (SEQ ID NO.7).