Aptamer specifically binding to aflatoxin B1 and application thereof

By modifying the aptamer sequence and designing the fluorescence polarization method, the problem of insensitive and specificity of aflatoxin B1 detection in the prior art is solved, and efficient specific detection of aflatoxin B1 is achieved.

CN120366316APending Publication Date: 2025-07-25JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510590084.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

There is a lack of methods for efficiently identifying and specifically detecting aflatoxin B1 in the prior art, resulting in insufficient sensitivity and specificity in the detection.

Method used

By directed evolution and modification of aptamer sequences, binding to molecular dynamics and free energy, aptamers with high affinity and specific recognition of aflatoxin B1 were obtained, and the cross-linked double amplification design of streptavidin and DNA strands were used for detection.

Benefits of technology

High affinity and specificity detection for aflatoxin B1 is achieved, reducing the recognition of other aflatoxins and improving the sensitivity and specificity of the detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366316A_ABST
    Figure CN120366316A_ABST
Patent Text Reader

Abstract

The invention relates to an aptamer specifically bound with aflatoxin B1 and application of the aptamer, and belongs to the technical field of biological detection. According to the invention, aflatoxin B1 is taken as a target, on the basis of broad-spectrum recognition of aflatoxin (aflatoxin B1, aflatoxin B2, aflatoxin M1 and aflatoxin G1) by an original aptamer, an aptamer sequence is modified by using directed evolution, and the aflatoxin B1, aflatoxin B2, aflatoxin M1 and aflatoxin G1 are identified on the basis of molecular dynamics in combination with free energy. And the aptamer sequence for recognizing the aflatoxin B1 with high affinity and specificity is obtained. The dissociation constant of the aptamer to the aflatoxin B1 is 9.2 nM, and the aptamer has high affinity to the aflatoxin B1; in addition, the aptamer provided by the invention can only detect the aflatoxin B1, has no recognition force on the aflatoxin B2, the aflatoxin M1, the aflatoxin G1, the fumonisins B1, the zearalenone and the ochratoxin A, and has good specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to an aptamer specifically binding to aflatoxin B1 and application thereof. Background Art

[0002] Molecular dynamics technology is a computer simulation method based on the principles of classical mechanics. It is used to study the movement and interaction of molecular systems within a certain time scale, revealing the structure, energy, dynamic behavior and thermodynamic properties of molecular systems. It can be used to simulate the conformational changes of biological macromolecules (such as proteins and nucleic acids) to provide theoretical support and prediction methods for experimental research. Fluorescence polarization is a detection technology based on the polarization characteristics of fluorescent molecules. When polarized light excites fluorescent molecules, the polarization degree of the fluorescent photons it emits will change due to the size and motion state of the molecules: large molecules or bound molecules have high polarization degrees, and small molecules or free molecules have low polarization degrees. By detecting polarization changes, the interaction between biological molecules can be analyzed, which has the advantages of high sensitivity, rapid detection and no need for separation. Introducing streptavidin into fluorescence polarization can reduce the rotational freedom of fluorescent molecules, thereby changing the signal intensity of polarized light.

[0003] Aflatoxin B1 (AFB1) is the most toxic component of the aflatoxin family. It is carcinogenic, teratogenic and mutagenic, and is certified as a Class I carcinogen by the International Agency for Research on Cancer. Agricultural products and foods may be contaminated by AFB1, and countries around the world have strict regulations on the content of AFB1 in food. Therefore, accurate and sensitive detection of AFB1 in food is extremely important for ensuring food safety and protecting human health. Instrumental analysis is a major means of AFB1 detection, such as high-performance liquid chromatography and gas chromatography-mass spectrometry. Although they are highly sensitive, the equipment is expensive and the operation is complex; immunoassays are highly specific and easy to operate, but the cost is high and high-quality antibodies are required.

[0004] Aptamers are a type of single-stranded nucleic acid molecules (DNA or RNA) obtained through in vitro screening technology, which can bind to specific target molecules (such as proteins, small molecules, metal ions, etc.) with high specificity. They have similar recognition functions to antibodies, but have advantages such as better stability, easy synthesis and modification, and thus show broad application prospects in the fields of biosensing, disease diagnosis, drug delivery and targeted therapy.

[0005] The existing technology for detecting aflatoxin B1 has the problem of poor sensitivity and specificity. The aptamer used to detect aflatoxin B1 can not only detect aflatoxin B1, but also aflatoxin B2, aflatoxin M1 and aflatoxin G1, but cannot achieve specific detection of aflatoxin B1. Therefore, a detection method that can efficiently identify and specifically detect aflatoxin B1 is urgently needed. Summary of the Invention

[0006] For this reason, the technical problem to be solved by the present invention is to overcome the problem in the prior art that there is a lack of a detection method for efficiently identifying and specifically detecting aflatoxin B1.

[0007] To solve the above technical problem, the present invention provides an aptamer that specifically binds to aflatoxin B1 and its application. The present invention uses aflatoxin B1 as a target. On the basis that the original aptamer can broadly recognize aflatoxins (aflatoxin B1, aflatoxin B2, aflatoxin M1, and aflatoxin G1), the aptamer sequence is modified by directed evolution. Based on the binding free energy of molecular dynamics, an aptamer sequence that can recognize AFB1 with high affinity and specificity is obtained. In addition, based on this aptamer, the present invention also designs a new fluorescence polarization method for detecting AFB1 by using the cross-linking dual amplification of streptavidin and DNA strands. The AFB1 aptamer labeled with the fluorescent group FAM has a small molecular weight and a small fluorescence polarization due to its own small molecular weight. Two extension sequences are designed at both ends of the aptamer to be connected to the DNA sequence on streptavidin through base complementary pairing, thus forming a cross-linking of streptavidin-FAM aptamer-streptavidin-FAM aptamer. The molecular weight of the system increases, resulting in an increase in the fluorescence polarization value. When AFB1 is present, the aptamer preferentially binds to AFB1, and the cross-linking between the aptamer and biotin is destroyed. The FAM aptamer-target complex is free in the solution, and the fluorescence polarization of the system decreases, achieving the purpose of quantitative / qualitative detection of AFB1.

[0008] The first object of the present invention is to provide an aptamer that specifically binds to aflatoxin B1, and the gene sequence of the aptamer is as shown in SEQ ID NO.1.

[0009] Furthermore, the aptamer of the present invention is obtained by mutating the 12th C to G, the 21st A to T, and the 23rd G to T on the original aptamer whose gene sequence is as shown in SEQ ID NO.2. The present invention has studied the mutation sites of the original aptamer and found that only the combined mutation of the C12G, G23T, and A21T sites results in the aptamer A32 having the best affinity for aflatoxin B1 and good specificity for aflatoxin B1.

[0010] The second object of the present invention is to provide an application of the above aptamer in the preparation of aflatoxin B1 detection products.

[0011] The third object of the present invention is to provide a product for detecting aflatoxin B1, and the product includes the above aptamer.

[0012] Further, the aptamer is modified with a fluorescent group.

[0013] Further, the detection product further includes streptavidin and a biotinylated single strand specifically binding to the streptavidin, and nucleotide sequences complementary to the biotinylated single strand extend from both ends of the aptamer.

[0014] Further, the biotinylated single strand includes a first biotinylated single strand modified with poly thymine and a second biotinylated single strand modified with poly guanine;

[0015] The 5'-end of the aptamer is connected to poly adenine, and the 3'-end is connected to poly cytosine; or, the 5'-end of the aptamer is connected to poly cytosine, and the 3'-end is connected to poly adenine;

[0016] The poly thymine is complementary to the poly adenine, and the poly guanine is complementary to the poly cytosine.

[0017] Further, streptavidin and the biotinylated single strand can be connected together through streptavidin-biotin specific recognition to form streptavidin-biotin-polyT and streptavidin-biotin-polyG. When the aptamer strand is present, polyA and polyC extended from both ends of the aptamer sequence can be connected to streptavidin-biotin-polyT and streptavidin-biotin-polyG through base complementary pairing. The presence of streptavidin increases the molecular weight of the system and thus enhances the fluorescence polarization value; the aptamer sequence further enhances the fluorescence polarization value by connecting two streptavidin-biotin systems together. When AFB1 is present, due to the binding of the aptamer to AFB1, the aptamer dissociates from the streptavidin system. The fluorescence polarization value of the FAM aptamer itself is relatively small, and the fluorescence polarization value of the system decreases.

[0018] The fourth object of the present invention is to provide an application of the above-mentioned aptamer or the above-mentioned detection product in the preparation of an aflatoxin B1 capture product.

[0019] The fifth object of the present invention is to provide an aflatoxin B1 detection method, and the aflatoxin B1 detection method is to detect aflatoxin B1 using the above-mentioned detection product.

[0020] The sixth object of the present invention is to provide an application of the above-mentioned aptamer in the separation, enrichment or analysis and detection of aflatoxin B1.

[0021] The beneficial effects of the present invention:

[0022] The present invention targets AFB1. Based on the original aptamer's broad-spectrum recognition of aflatoxins (AFB1, aflatoxin B2, aflatoxin M1, and aflatoxin G1), the aptamer sequence was modified by directed evolution. Based on the binding free energy of molecular dynamics, an aptamer sequence that can recognize AFB1 with high affinity and specificity was obtained, without recognizing aflatoxin B2 (AFB2), aflatoxin M1 (AFM1), and aflatoxin G1 (AFG1). The detection of AFB1 was realized using fluorescence polarization technology. The present invention provides a highly specific detection recognition element with high affinity, good specificity, easy preparation, and easy labeling for the detection of AFB1, as well as application examples, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to specific embodiments of the present invention in conjunction with the accompanying drawings, where

[0024] Figure 1 is the schematic diagram of the modification of aptamer specificity by directed evolution;

[0025] Figure 2 is the binding saturation curve of the original aptamer B32 and aflatoxins (AFB1, AFB2, AFM1, and AFG1);

[0026] Figure 3 is the secondary structure of the original aptamer B32 and the mutant aptamer A32 fitted by Mfold;

[0027] Figure 4 are the binding saturation curve (a) and specificity (b) of the mutant aptamer A32;

[0028] Figure 5 is the schematic diagram of the detection of AFB1 based on streptavidin and strand cross-linked amplification fluorescence polarization signal;

[0029] Figure 6 is the standard curve graph for AFB1 detection. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] The following further describes the present invention in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the examples given are not intended to limit the present invention.

[0031] The synthesis and detection methods involved in the following examples are as follows:

[0032] 1. Synthesis of aptamer

[0033] The aptamer labeled with FAM group was synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.

[0034] 2. Fluorescence Polarization Assay for Detecting AFB1 Based on Streptavidin and Chain Crosslinking to Enhance Signals

[0035] (1) Construction of the Detection System

[0036] In the detection system, the concentration of the aptamer labeled with the fluorescent group FAM is 10 nmol / L. The bases extended from both ends of the aptamer sequence are connected to the streptavidin-biotin-complementary strand (concentration: 40 nmol / L) system through base complementary pairing, so that there is no free aptamer in the solution. Then, different concentrations of AFB1 are added and incubated in the aptamer binding buffer for 30 min. Finally, 200 μL is taken out and the fluorescence polarization value of the solution is measured on an enzyme-linked immunosorbent assay (ELISA) reader.

[0037] (2) Detection of Actual Samples

[0038] Weigh 5 grams of corn samples, crush and mix them evenly with a tissue grinder. Subsequently, add 20 mL of extraction solution (70% methanol / 30% aqueous solution, by volume) to the above powder. Vortex and stir the mixture for 20 minutes. Centrifuge at 6000 revolutions per minute for 10 minutes, and filter the supernatant with filter paper to obtain a clear solution. For the spike recovery test, different concentrations of AFB1 were added to the samples before extraction.

[0039] Example 1: Screening of Aptamers

[0040] The binding domain of the original aptamer B32 to AFB1 is located in the loop region of its three-dimensional structure. As Figure 1 shown, the 7 bases within the red box are the key bases involved in binding. First, use an internal Python script to call the Chimera program to enumerate mutations of the 7 key bases in the binding domain of the B32 sequence and establish a virtual library of mutant sequences. Then call the sander module of AmberTools21 for energy minimization. Finally, use the MM / GB(PB)SA method to calculate the binding free energy.

[0041] To reduce the workload, first calculate the binding free energy for the mutant sequence-AFB1 complex, select the 1000 mutants with the strongest binding force, and then perform energy minimization and binding free energy calculations with AFM1, AFB2, and AFG1 respectively. First, use the relatively faster and more accurate MM / GBSA method in terms of relative energy to calculate the binding free energy, select 50% of the candidate mutant sequences with the strongest binding force, and then use the slower but more accurate MM / PBSA method in terms of absolute energy to calculate the binding free energy. The process is as Figure 1 shown.

[0042] The fluorescence polarization method was used to determine the affinity between the aptamer and AFB1. The experimental procedure was as follows: Preparation of the aptamer solution, the synthesized aptamer was dissolved in TE buffer to prepare a 10 μM solution and stored at -20 °C for later use. An appropriate amount of FAM-labeled aptamer was taken and heated and denatured at 95 °C for 5 minutes, and then left to stand at room temperature for 30 minutes to form a stable secondary structure; Construction of the binding reaction system, aptamer solutions with different final concentrations (10, 25, 50, 100, 150, 200, 300 nmol / L) were prepared and mixed with the target at a constant final concentration of 1 μM respectively, placed in the binding buffer, and incubated in the dark at room temperature for 40 minutes to ensure that the aptamer was fully bound to AFB1. Control group setting, a control group without the target was set up to evaluate the background fluorescence polarization value. Data analysis, the experiment was repeated 3 times to ensure the reliability of the data. The affinity was characterized by calculating the fluorescence polarization difference of the samples, and the saturation binding curve was fitted using GraphPad Prism 5 software to calculate the dissociation constant (Kd) of the aptamer.

[0043] The binding free energy difference (ΔΔG) of the mutant sequences to different targets was calculated according to the following formula:

[0044] ΔΔG = ΔG 其他 - ΔG AFB1

[0045] Finally, the 4 mutant sequences with the largest binding energy difference ΔΔG were selected to determine the affinity of the sequences for AFB1 and other aflatoxins (AFB2, AFG1, and AFM1). The saturation binding curves of the original aptamer B32 with aflatoxins (AFB1, AFB2, AFM1, and AFG1) are as Figure 2 shown.

[0046] Aptamer specificity analysis: Aptamer solutions with a final concentration of 50 nmol / L were incubated with AFB2, AFM1, AFG1, and other common mycotoxins, such as fumonisin B1 (FB1), zearalenone (ZEN), and ochratoxin A (OTA) in the binding buffer at room temperature for 40 min, and then the corresponding concentration of GO was added and incubated at room temperature for 20 min, and then placed in an enzyme-linked immunosorbent assay plate to measure the fluorescence polarization value.

[0047] As shown in Table 1, the results of the affinity and specificity determination showed that the mutant aptamer A32 obtained by directed evolution had an increased affinity for AFB1 and only recognized AFB1, no longer recognized other aflatoxins (AFB2, AFG1, and AFM1), and lost the affinity for other aflatoxins (AFB2, AFG1, and AFM1), indicating that aptamer A32 had excellent affinity and specificity. Aptamer B32 and aptamer A32 had similar secondary structures, see Figure 3, the detailed sequence composition is shown in Table 2. The binding saturation curve and specificity of mutant aptamer A32 and AFB1 are as Figure 4 shown.

[0048] Table 1 Calculation results of the affinity of different aptamers

[0049] Sequence Name Mutated Base Combinations <![CDATA[ΔG total (kcal / mol)]]> <![CDATA[K d (nM)]]> A32 G12C, T23G, T21A -36.19 9.2 C32 T13C, C14T, G20A -35.89 21 D32 T23C, T21G -33.83 no binding E32 T13G, G22C -33.75 49 B32 None -32.33 36.1

[0050] Table 2 Base composition of the sequences obtained by directed evolution

[0051] Name Sequence (5'—3') SEQ ID A32 GGGCACGTGTTCTCCTCTCGAGGCTCGTGCCC SEQ ID NO.1 C32 GGGCACGTGTTGCTCTCTCATGTCTCGTGCCC SEQ ID NO.3 D32 GGGCACGTGTTGTCCTCTCGGGCCTCGTGCCC SEQ ID NO.4 E32 GGGCACGTGTTGGCCTCTCGTCTCTCGTGCCC SEQ ID NO.5 B32 GGGCACGTGTTGTCCTCTCGTGTCTCGTGCCC SEQ ID NO.2

[0052] Example 2: Detection of AFB1

[0053] The detection principle diagram is as Figure 5 shown. The detection system includes streptavidin, biotinylated polyT single-strand, biotinylated polyG single-strand, and an aptamer strand modified with a fluorescent group FAM with polyA and polyC extended at both ends. Among them, streptavidin and the biotinylated single-strand can be specifically recognized and linked together through streptavidin-biotin to form streptavidin-biotin-polyT and streptavidin-biotin-polyG. When the aptamer strand is present, polyA and polyC extended at both ends of the aptamer sequence can be linked together with streptavidin-biotin-polyT and streptavidin-biotin-polyG through base complementary pairing. Streptavidin is a tetrameric protein with a size of 66Kda, which increases the molecular weight of the system and thus enhances the fluorescence polarization value; the aptamer sequence further enhances the fluorescence polarization value by linking two streptavidin-biotin systems together. When AFB1 is present, due to the binding of the aptamer and AFB1, the aptamer dissociates from the streptavidin system. The fluorescence polarization value of the FAM aptamer itself is relatively small, and the fluorescence polarization value of the system decreases. The standard curve for the fluorescence polarization detection of AFB1 is plotted according to the fluorescence polarization value and the concentration of AFB1, see Figure 6 .

[0054] Example 3: Detection of AFB1 toxin in actual samples

[0055] After the actual sample is pretreated, AFB1 toxin with final concentrations of 2, 5, and 10 ng / mL is added to the filtrate respectively. The fluorescence polarization method based on streptavidin and strand cross-linking amplification signal is used to determine the addition recovery rate of AFB1 in the actual sample. The results are shown in Table 3.

[0056] Table 3 Detection and spike recovery rate of AFB1 in actual corn samples

[0057]

[0058] Obviously, the above embodiments are merely examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. An aptamer that specifically binds to aflatoxin B1, characterized in that, The sequence of the aptamer is shown as SEQ ID NO.

1.

2. Use of the aptamer according to claim 1 in the preparation of aflatoxin B1 detection products.

3. A detection product for aflatoxin B1, characterized in that, The detection product includes the aptamer according to claim 1.

4. The detection product according to claim 3, characterized in that, The aptamer is modified with a fluorescent group.

5. The detection product according to claim 4, wherein, The detection product further includes streptavidin and a biotinylated single strand specifically binding to the streptavidin, and nucleotide sequences complementary to the biotinylated single strand extend from both ends of the aptamer.

6. The detection product according to claim 5, wherein The biotinylated single strand includes a first biotinylated single strand modified with poly-thymine and a second biotinylated single strand modified with poly-guanine; The 5'-end of the aptamer is linked to poly-adenine and the 3'-end is linked to poly-cytosine; or, the 5'-end of the aptamer is linked to poly-cytosine and the 3'-end is linked to poly-adenine.

7. The detection product according to claim 4, wherein The fluorescent group is selected from one or more of 5-carboxyfluorescein, fluorescein isothiocyanate, rhodamine B, methylene blue, indole orange, and anthocyanin.

8. Use of the aptamer according to claim 1 or the detection product according to any one of claims 3-7 in the preparation of aflatoxin B1 capture products.

9. A method for detecting aflatoxin B1, characterized in that, The aflatoxin B1 detection method is to detect aflatoxin B1 using the detection product according to any one of claims 3-7.

10. Use of the aptamer according to claim 1 in the separation, enrichment or analytical detection of aflatoxin B1.